This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moland, E. S.
Right arrow Articles by Pottumarthy, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moland, E. S.
Right arrow Articles by Pottumarthy, S.

 Previous Article

Antimicrobial Agents and Chemotherapy, July 2003, p. 2382-2383, Vol. 47, No. 7
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.7.2382-2383.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

LETTER TO THE EDITOR

Discovery of CTX-M-Like Extended-Spectrum ß-Lactamases in Escherichia coli Isolates from Five U.S. States


arrow
LETTER
 
The most commonly reported extended-spectrum ß-lactamases (ESBLs) in U.S. isolates of Escherichia coli are TEM and SHV derived (2). CTX-M ESBLs have been reported elsewhere, mostly for clinical isolates of Salmonella enterica serovar Typhimurium, E. coli, and Klebsiella pneumoniae, but not in the United States (5). In this report we describe nine U.S. isolates of E. coli from five different states (Virginia, Idaho, Ohio, Washington, and Texas) that appear to produce CTX-M-like ESBLs. These isolates were discovered as we began to investigate the types of ESBLs produced by organisms in a U.S. hospital surveillance study.

All isolates were obtained from patient specimens during 2001-2002. The origins of the isolates, pIs of the ß-lactamases, and NCCLS broth microdilution MICs (4) are shown in Table 1. Pulsed-field gel electrophoresis (PFGE) results after restriction with XbaI (7; R. V. Goering and F. C. Tenover, Letter, J. Clin. Microbiol. 35:2432-2433, 1997) determined that all but isolates 1 and 4 were unique (data not shown). Isolates 8 and 9 were obtained from the same patient but had distinctly different antibiotic susceptibility and PFGE patterns. Cefepime MICs were generally higher than usual for TEM- and SHV-derived ESBL-producing isolates, with cefepime MICs being ≥64 µg/ml for seven of these isolates. Clavulanate-based ESBL tests confirmed ESBL production, although ceftazidime MICs for two isolates were <1 µg/ml below the NCCLS ESBL screening criterion (4).


View this table:
[in this window]
[in a new window]
 
TABLE 1. MICs of antibiotics for the E. coli isolates that produced CTX-M-like ESBLs

Isoelectric focusing of crude sonicates of the isolates by a cefotaxime-ß-lactamase inhibitor overlay procedure (1, 6) revealed that all isolates produced a cefotaxime-hydrolyzing ß-lactamase that was inhibited by clavulanate but not cloxacillin. The pIs of these enzymes were ≥9.0 for seven isolates and 8.0 for two (Table 1). All isolates except isolate 7 produced other clavulanate-inhibited ß-lactamases. PCR amplification confirmed the presence of CTX-M-like genes within the isolates: isolates 1 to 7 resulted in amplified products of 414 bp with forward primer MEN-1F, CGGAAAAGCACGTCGATGGG, and reverse primer MEN-1R, GCGATATCGTTGGTGGTGCC; these primers correspond to nucleotide numbers 397 to 416 and 811 to 792, respectively, of the sequence with accession number X92506; isolates 8 and 9 yielded products of 1,346 bp with the forward primer CTX-M14 F1, GAGTGTTGCTCTGTGGATAAC, and the reverse primer CTX-M14 R2, GGCAAGGTCAGAATAGCGCTG; these primers correspond to nucleotide numbers 1514 to 1534 and 2860 to 2840, respectively, of the sequence with accession number AF252622. PCR amplification was performed as previously described (3) using an annealing temperature of 55°C for the MEN-1 primer pair and 50°C for the CTX-M14 primer pair. Both amplification reactions were performed using 2.0 mM MgCl2. The isoelectric focusing results combined with the PCR data suggest the presence of at least two different types of CTX-M-like enzymes.

To our knowledge this is the first report of CTX-M-like ESBLs in the United States. Since the isolates were from five different states, all but two were unrelated, and at least two different types of CTX-M-type enzymes were detected, it is clear that the CTX-M ESBL family is possibly spreading throughout the United States. This suggests that these enzymes may have been previously overlooked. With these isolates, although the susceptibility patterns may not have been due solely to the CTX-M ß-lactamases, the elevated cefepime MICs (≥64 µg/ml) for seven isolates were distinctive, and the very low ceftazidime MICs (<1 µg/ml) for two isolates reaffirmed the need to utilize multiple ESBL screening agents and not to rely solely on ceftazidime to screen for ESBLs.


arrow
ACKNOWLEDGMENTS
 
We thank Thomas R. Fritsche at the University of Washington, Seattle, and Jinxin Hu, Ravi Pallipamu, and Romesh Gautom at the Department of Health in Washington State for the PFGE testing. We also thank D. Wilson, The Cleveland Clinic Foundation, Cleveland, Ohio; C. Park, Inova Fairfax Hospital, Falls Church, Va.; J. Burch, St. Alphonsus Regional Medical Center, Boise, Idaho; C. Fierro, Thomason Hospital, El Paso, Tex.; and S. Swanzy, University of Washington, Seattle, for providing these isolates.

We thank Merck & Co., Inc., for supporting this research.


arrow
REFERENCES
 
    1
  1. Bauernfeind, A., H. Grimm, and S. Schweighart. 1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection 18:294-298.[CrossRef][Medline]
  2. 2
  3. Bradford, P. A. 2001. Extended-spectrum ß-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14:933-951.[Abstract/Free Full Text]
  4. 3
  5. Hanson, N. D., K. S. Thomson, E. S. Moland, C. C. Sanders, G. Berthold, and R. G. Penn. 1999. Molecular characterization of a multiply resistant Klebsiella pneumoniae encoding ESBLs and a plasmid-mediated AmpC. J. Antimicrob. Chemother. 44:377-380.[Abstract/Free Full Text]
  6. 4
  7. National Committee for Clinical Laboratory Standards. 2002. Performance standards for antimicrobial susceptibility testing; 12th informational supplement (aerobic dilution) M100-S12. National Committee for Clinical Laboratory Standards, Wayne, Pa.
  8. 5
  9. Saladin, M., V. T. B. Cao, T. Lambert, J.-L. Donay, J.-L. Hermann, Z. Ould-Hocine, C. Verdet, F. Delisle, A. Philippon, and G. Arlet. 2002. Diversity of CTX-M ß-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol. Lett. 209:161-168.[Medline]
  10. 6
  11. Sanders, C. C., W. E. Sanders, Jr., and E. S. Moland. 1986. Characterization of ß-lactamases in situ on polyacrylamide gels. Antimicrob. Agents Chemother. 30:951-952.[Abstract/Free Full Text]
  12. 7
  13. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239.[Medline]
E. Smith Moland*
J. A. Black
A. Hossain
N. D. Hanson
K. S. Thomson

Department of Medical Microbiology and Immunology
Creighton University School of Medicine
2500 California Plaza
Omaha, NE 68178

S. Pottumarthy
Medical Microbiology
University of Washington
Seattle, WA 98195

* Phone: (402) 280-1826
Fax: (402) 280-1875
E-mail: esmoland{at}creighton.edu


Antimicrobial Agents and Chemotherapy, July 2003, p. 2382-2383, Vol. 47, No. 7
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.7.2382-2383.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Sidjabat, H. E., Paterson, D. L., Adams-Haduch, J. M., Ewan, L., Pasculle, A. W., Muto, C. A., Tian, G.-B., Doi, Y. (2009). Molecular Epidemiology of CTX-M-Producing Escherichia coli Isolates at a Tertiary Medical Center in Western Pennsylvania. Antimicrob. Agents Chemother. 53: 4733-4739 [Abstract] [Full Text]  
  • McGettigan, S. E., Hu, B., Andreacchio, K., Nachamkin, I., Edelstein, P. H. (2009). Prevalence of CTX-M {beta}-Lactamases in Philadelphia, Pennsylvania. J. Clin. Microbiol. 47: 2970-2974 [Abstract] [Full Text]  
  • Jones, C. H., Tuckman, M., Keeney, D., Ruzin, A., Bradford, P. A. (2009). Characterization and Sequence Analysis of Extended-Spectrum-{beta}-Lactamase-Encoding Genes from Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis Isolates Collected during Tigecycline Phase 3 Clinical Trials. Antimicrob. Agents Chemother. 53: 465-475 [Abstract] [Full Text]  
  • Lewis, J. S. II, Herrera, M., Wickes, B., Patterson, J. E., Jorgensen, J. H. (2007). First Report of the Emergence of CTX-M-Type Extended-Spectrum {beta}-Lactamases (ESBLs) as the Predominant ESBL Isolated in a U.S. Health Care System. Antimicrob. Agents Chemother. 51: 4015-4021 [Abstract] [Full Text]  
  • Lavigne, J.-P., Marchandin, H., Delmas, J., Bouziges, N., Lecaillon, E., Cavalie, L., Jean-Pierre, H., Bonnet, R., Sotto, A. (2006). qnrA in CTX-M-Producing Escherichia coli Isolates from France. Antimicrob. Agents Chemother. 50: 4224-4228 [Abstract] [Full Text]  
  • Moland, E. S., Hanson, N. D., Black, J. A., Hossain, A., Song, W., Thomson, K. S. (2006). Prevalence of Newer {beta}-Lactamases in Gram-Negative Clinical Isolates Collected in the United States from 2001 to 2002.. J. Clin. Microbiol. 44: 3318-3324 [Abstract] [Full Text]  
  • Xu, L., Ensor, V., Gossain, S., Nye, K., Hawkey, P. (2005). Rapid and simple detection of blaCTX-M genes by multiplex PCR assay. J Med Microbiol 54: 1183-1187 [Abstract] [Full Text]  
  • Paterson, D. L., Bonomo, R. A. (2005). Extended-Spectrum {beta}-Lactamases: a Clinical Update. Clin. Microbiol. Rev. 18: 657-686 [Abstract] [Full Text]  
  • Black, J. A., Moland, E. S., Thomson, K. S. (2005). AmpC Disk Test for Detection of Plasmid-Mediated AmpC {beta}-Lactamases in Enterobacteriaceae Lacking Chromosomal AmpC {beta}-Lactamases. J. Clin. Microbiol. 43: 3110-3113 [Abstract] [Full Text]  
  • Pitout, J. D. D., Gregson, D. B., Church, D. L., Elsayed, S., Laupland, K. B. (2005). Community-Wide Outbreaks of Clonally Related CTX-M-14 {beta}-Lactamase-Producing Escherichia coli Strains in the Calgary Health Region. J. Clin. Microbiol. 43: 2844-2849 [Abstract] [Full Text]  
  • Bert, F., Juvin, M., Ould-Hocine, Z., Clarebout, G., Keller, E., Lambert, N., Arlet, G. (2005). Evaluation and Updating of the Osiris Expert System for Identification of Escherichia coli {beta}-Lactam Resistance Phenotypes. J. Clin. Microbiol. 43: 1846-1850 [Abstract] [Full Text]  
  • Jacoby, G. A., Munoz-Price, L. S. (2005). The New {beta}-Lactamases. NEJM 352: 380-391 [Full Text]  
  • Munday, C. J., Boyd, D. A., Brenwald, N., Miller, M., Andrews, J. M., Wise, R., Mulvey, M. R., Hawkey, P. M. (2004). Molecular and Kinetic Comparison of the Novel Extended-Spectrum {beta}-Lactamases CTX-M-25 and CTX-M-26. Antimicrob. Agents Chemother. 48: 4829-4834 [Abstract] [Full Text]  
  • Pitout, J. D. D., Hossain, A., Hanson, N. D. (2004). Phenotypic and Molecular Detection of CTX-M-{beta}-Lactamases Produced by Escherichia coli and Klebsiella spp.. J. Clin. Microbiol. 42: 5715-5721 [Abstract] [Full Text]  
  • Abdalhamid, B., Pitout, J. D. D., Moland, E. S., Hanson, N. D. (2004). Community-Onset Disease Caused by Citrobacter freundii Producing a Novel CTX-M {beta}-Lactamase, CTX-M-30, in Canada. Antimicrob. Agents Chemother. 48: 4435-4437 [Abstract] [Full Text]  
  • Leflon-Guibout, V., Jurand, C., Bonacorsi, S., Espinasse, F., Guelfi, M. C., Duportail, F., Heym, B., Bingen, E., Nicolas-Chanoine, M.-H. (2004). Emergence and Spread of Three Clonally Related Virulent Isolates of CTX-M-15-Producing Escherichia coli with Variable Resistance to Aminoglycosides and Tetracycline in a French Geriatric Hospital. Antimicrob. Agents Chemother. 48: 3736-3742 [Abstract] [Full Text]  
  • Eckert, C., Gautier, V., Saladin-Allard, M., Hidri, N., Verdet, C., Ould-Hocine, Z., Barnaud, G., Delisle, F., Rossier, A., Lambert, T., Philippon, A., Arlet, G. (2004). Dissemination of CTX-M-Type {beta}-Lactamases among Clinical Isolates of Enterobacteriaceae in Paris, France. Antimicrob. Agents Chemother. 48: 1249-1255 [Abstract] [Full Text]  
  • Bonnet, R. (2004). Growing Group of Extended-Spectrum {beta}-Lactamases: the CTX-M Enzymes. Antimicrob. Agents Chemother. 48: 1-14 [Full Text]  

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moland, E. S.
Right arrow Articles by Pottumarthy, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moland, E. S.
Right arrow Articles by Pottumarthy, S.