This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, R. N.
Right arrow Articles by Morrissey, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, R. N.
Right arrow Articles by Morrissey, I.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, August 2003, p. 2696-2698, Vol. 47, No. 8
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.8.2696-2698.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Quinupristin-Dalfopristin Resistance in Streptococcus pneumoniae: Novel L22 Ribosomal Protein Mutation in Two Clinical Isolates from the SENTRY Antimicrobial Surveillance Program

Ronald N. Jones,1* David J. Farrell,2 and Ian Morrissey2

The JONES Group/JMI Laboratories, North Liberty, Iowa,1 GR Micro, Ltd., London, United Kingdom2

Received 17 January 2003/ Returned for modification 27 March 2003/ Accepted 24 May 2003


arrow
ABSTRACT
 
Resistance to quinupristin-dalfopristin (Q/D) among gram-positive cocci has been very uncommon. Two clinical isolates among 8,837 (0.02%) Streptococcus pneumoniae isolates were discovered in 2001 to 2002 with Q/D MICs of 4 µg/ml. Each had a 5-amino-acid tandem duplication (RTAHI) in the L22 ribosomal protein gene (rplV) preventing synergistic ribosomal binding of the streptogramin combination. Similar gene duplication has been reported in Q/D-resistant Staphylococcus aureus.


arrow
TEXT
 
Streptococcus pneumoniae is one of the most commonly isolated pathogens from patients diagnosed at any age with community-acquired respiratory tract infections. Recent reports have chronicled the steady increase and global dissemination of several forms of antimicrobial resistance among S. pneumoniae specifically for the penicillins, some cephalosporins, macrolides, tetracyclines, and trimethoprim-sulfamethoxazole (1-3, 5-7; R. N. Jones, D. Biedenbach, M. Beach, and D. Farrell, Abstr. 42nd Intersci. Conf. Antimicrob. Agents Chemother., abstr. C2-1978, 2002). Most disturbing has been the escalating rates of high-level resistance to penicillin and resistance to agents in the macrolide-lincosamide-streptogramin B class (1, 3, 5, 8; Jones et al., 42nd ICAAC). The latter group of antimicrobials has two principal mechanisms of resistance, target modification and efflux pump acquisition, but streptogramin combinations such as quinupristin-dalfopristin (Q/D) generally remain active (2, 6). Recent reports show Q/D resistance ranging from 0 to 1.1% (2, 6) for unconfirmed cases. The mechanisms of resistance in these S. pneumoniae strains remain unstudied.

In 2002, Malbruny et al. (9) reported resistance (MIC, 4 µg/ml) to Q/D mediated by a L22 ribosomal protein gene (rplV) mutation in a clinical isolate of S. aureus (strain 740-1). Sequencing of rplV revealed a 21-bp duplication encoding a 7-amino-acid (SAINKRT [Fig. 1 ]) insertion starting at position 101 (9). Also in 2002, Musher and colleagues noted a 6-amino-acid tandem duplication in a pneumococcal isolate associated with macrolide therapy for which the Q/D MIC was elevated (Fig. 2) (10). After discovering two clinical strains of S. pneumoniae with resistant Q/D MIC results (4 µg/ml) in the SENTRY Antimicrobial Surveillance Program, we explored the mechanism of resistance with an emphasis on possible mutations of rplV that could negate the synergistic ribosomal binding of streptogramins A and B (9).



View larger version (7K):
[in this window]
[in a new window]
  		FIG. 1. S. aureus L22 riboprotein amino acids (AA) sequences for positions 91 to 106 (9). Duplication of amino acids 93 to 99 is indicated by shading for strain 740-1. Regions corresponding to the tandem duplications found in S. pneumoniae strains described here and by Musher et al. (10) appear with shading.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. S. pneumoniae L22 riboprotein amino acids (AA) sequences for positions 96 to 113. Duplication of amino acids 103 to 107 (RTAHI) and of amino acids 103 to 108 is indicated by shaded area for both described clinical isolates.

During the respiratory tract disease seasons of 1997 to 2001, a total of 8,837 community-acquired isolates of S. pneumoniae were monitored for emerging resistance patterns to >30 antimicrobial agents. In 2001, isolates forwarded to the SENTRY Program monitor (JMI Laboratories, North Liberty, Iowa) were also screened for macrolide resistance by using reference broth microdilution methods of the National Committee for Clinical Laboratory Standards, and those strains with nonsusceptible MIC results were further tested for molecular mechanisms of resistance (11, 12). The initial molecular screens utilized a novel rapid-cycle multiplex PCR-probe detection format described earlier by Farrell et al. (4). Among 332 S. pneumoniae strains tested from Europe (120 strains from 18 centers), Canada (31 strains from five centers), Latin America (23 strains from six centers), and the United States (158 strains from 22 centers), nine strains were noted to possess macrolide resistance but were negative by PCR screens for erm(B) and mef(A) (Jones et al., 42nd ICAAC). One of these organisms was also resistant to Q/D (MIC, 4 µg/ml; strain 17-3167B) for an overall prevalence rate of 0.01% over the 5-year interval. This strain and a second similar pneumococcus (107-612B) identified in 2002 were further characterized by (i) gene sequencing for all four alleles of the 23S rRNA and the L4 and L22 ribosomal protein genes to detect mutations; (ii) antibiogram analysis; (iii) pulsed-field gel electrophoresis and automated ribotyping; and (iv) serotyping.

For gene sequencing of the L22 ribosomal protein, a 176-bp segment was amplified by PCR. The PCR primers used were derived from strain R6 (GenBank accession numbers AE008402 and AF126059): DF-L22-F (GAACTCAGCTGTAGCTAACGC) and DF-L22-R (TTCTGCAACAGCTACAGTGATG).

The cycling (Perkin-Elmer 9700 cycler; Applied Biosystems, Warrington, United Kingdom) parameters were as follows: 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 40 s, followed by a product extension cycle of 72°C for 7 min. The sequences were determined with the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Sequence analysis was performed by using the DNASTAR analysis program (DNASTAR, Madison, Wis.).

These two, Q/D-resistant community-acquired strains of S. pneumoniae were isolated in June 2001 (17-3167B) and March 2002 (107-612B) in New York and Kentucky, respectively. Both strains were isolated from an invasive tissue site (pleural or shoulder joint fluid) in female patients aged 36 and 79 years, respectively. The antibiogram (MIC for the strain in micrograms per milliliter for 17-3167B and 107-612B) were Q/D (4 and 4); erythromycin (1 and 1); telithromycin (0.5 and 0.25); clindamycin (<=0.06 and <=0.06); penicillin (<=0.015 and <=0.015); amoxicillin-clavulanic acid (<=0.06 and <=0.06); cefepime (<=0.06 and <=0.06); ceftriaxone (0.03 and 0.015); cefuroxime (<=0.06 and <=0.06); ciprofloxacin (4 and 1); garenoxacin (0.03 and 0.03); gatifloxacin (0.25 and 0.25); levofloxacin (1 and 1); chloramphenicol (<=2 and <=2); doxycycline (<=0.5 and <=0.5); rifampin (<=0.5 and <=0.5); trimethoprim-sulfamethoxazole (<=0.5 and <=0.5); linezolid (1 and 0.5); and vancomycin (0.25 and 0.25). The MICs for the components of the streptogramin combination were as follows: quinupristin at 8 µg/ml and dalfopristin at 128 µg/ml. MICs for other macrolides (azithromycin, clarithromycin, rokitamycin, and roxithromycin) ranged from 0.5 µg/ml for azithromycin to 16 µg/ml for roxithromycin, each MIC indicating reduced susceptibility (11).

Among the nine PCR screen-negative S. pneumoniae isolates observed in 2001 (all in North America), mechanisms of resistance were determined for all strains that included 23S rRNA mutations at A2059G (six strains), A2058G (two strains), and A2059C (one strain) and the L22 mutation P84T (two strains). Strain 17-316B had an A2059G (one allele) mutation and an additional unique change in the L22 ribosomal protein, shared with the year-2002 isolate (107-612B). Figure 2 illustrates the 5-amino-acid duplication (RTAHI) at positions 103 to 107 that was present in both Q/D-resistant S. pneumoniae strains presented here. Figure 2 also shows the 6-amino-acid duplication noted earlier in another S. pneumoniae isolate (10). Although having an identical resistance mechanism and similar antibiograms, our described isolates were not the same by pulsed-field gel electrophoresis patterns, riboprints, or serotyping, e.g., not clonal emergence and dissemination.

The mechanism of low-level Q/D resistance in S. pneumoniae appears to be secondary to a tandem duplication of 5 or 6 amino acids (RTAHI or RTAHIT [Fig. 2]) in the L22 ribosomal protein, a finding similar to that duplication phenomenon responsible for resistance to the streptogramin combination in S. aureus (9) and in other pneumococci reported by Musher et al. (10). These L22 mutations did not effect the susceptibility to clindamycin but did compromise the potency of the ketolides in S. aureus (9). Since the use of macrolides has been implicated in the increased resistance to macrolide-lincosamide-streptogramin B agents and penicillin (3), continued surveillance appears necessary to detect the wider selection of Q/D-resistant streptococci where these agents have been applied clinically. The tandem duplications of ribosomal target proteins found in this study and elsewhere (9, 10) may be more widespread and need further investigation in other gram-positive species such as Enterococcus faecium and coagulase-negative staphylococci and as an intrinsic resistance trait among Enterococcus faecalis strains.


arrow
ACKNOWLEDGMENTS
 
This study was funded by an unrestricted research grant from The JONES Group. The SENTRY Program was sponsored via an educational research grant from Bristol-Myers Squibb.

We also acknowledge Sarah Bakker for DNA sequencing.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: The JONES Group/JMI Laboratories, Inc., 345 Beaver Kreek Centre, Suite A, North Liberty, IA 52317. Phone: (319) 665-3370. Fax: (319) 665-3371. E-mail: ronald-jones{at}jmilabs.com. Back


arrow
REFERENCES
 
    1
  1. Appelbaum, P. C. 2002. Resistance among Streptococcus pneumoniae: implications for drug selection. Clin. Infect. Dis. 34:1613-1620.[CrossRef][Medline]
    2. 2
  2. Ballow, C. H., R. N. Jones, D. J. Biedenbach, and the North American ZAPS Research Group. 2002. A multicenter evaluation of linezolid antimicrobial activity in North America. Diagn. Microbiol. Infect. Dis. 43:75-83.[CrossRef][Medline]
    3. 3
  3. Bronzwaer, S. L. A. M., O. Cars, U. Buchholz, S. Molstad, W. Goettsch, I. K. Veldhuijzen, J. L. Kool, M. J. W. Sprenger, J. E. Degener, and the European Antimicrobial Resistance Surveillance System. 2002. A European study on the relationship between antimicrobial use and antimicrobial resistance. Emerg. Infect. Dis. 8:278-282.[Medline]
    4. 4
  4. Farrell, D. J., I. Morrissey, S. Bakker, and D. Felmingham. 2001. Detection of macrolide resistance mechanisms in Streptococcus pneumoniae and Streptoccus pyogenes using a multiplex rapid cycle PCR with microwell-format probe hybridization. J. Antimicrob. Chemother. 48:541-544.[Abstract/Free Full Text]
    5. 5
  5. Hoban, D. J., G. V. Doern, A. C. Fluit, M. Roussel-Delvallez, and R. N. Jones. 2001. Worldwide prevalence of antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis in the SENTRY Antimicrobial Surveillance Program, 1997-1999. Clin. Infect. Dis. 32(Suppl. 2):S81-S93.
    6. 6
  6. Jones, R. N., C. H. Ballow, D. J. Biedenbach, and The ZAPS Study Group Medical Centers. 2001. Multi-laboratory assessment of the linezolid spectrum of activity using the Kirby-Bauer disk diffusion method: Report of the Zyvox® Antimicrobial Potency Study (ZAPS) in the United States. Diagn. Microbiol. Infect. Dis. 40:59-66.[CrossRef][Medline]
    7. 7
  7. Low, D. E. 2002. The era of antimicrobial resistance—implications for the clinical laboratory. Clin. Microbiol. Infect. 8(Suppl. 3):9-20.
    8. 8
  8. Leclercq, R. 2002. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 34:482-492.[CrossRef][Medline]
    9. 9
  9. Malbruny, B., A. Canu, B. Bozdogan, B. Fantin, I. Zarrouk, S. Dutka-Malen, C. Feger, and R. Leclercq. 2002. Resistance to quinupristin-dalfopristin due to mutation of L22 ribosomal protein in Staphylococcus aureus. Antimicrob. Agents Chemother. 46:2200-2207.[Abstract/Free Full Text]
    10. 10
  10. Musher, D. M., M. E. Dowell, V. D. Shortridge, J. H. Jorgensen, P. Le Magueres, and K. L. Krause. 2002. Emergence of macrolide resistance during treatment of pneumococcal pneumonia. N. Engl. J. Med. 346:630-631.[Free Full Text]
    11. 11
  11. NCCLS. 2000. Methods for dilution antimicrobial tests for bacteria that grows aerobically. Approved standard M7-A5. NCCLS, Wayne, Pa.
    12. 12
  12. NCCLS. 2002. Performance standards for antimicrobial susceptibility testing. Supplemental tables, M100-S12. NCCLS, Wayne, Pa.

Antimicrobial Agents and Chemotherapy, August 2003, p. 2696-2698, Vol. 47, No. 8
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.8.2696-2698.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Obert, C. A., Miller, M. L., Montgomery, J., Adamkiewicz, T., Tuomanen, E. I. (2007). Quinupristin-Dalfopristin Nonsusceptibility in Pneumococci from Sickle Cell Disease Patients. Antimicrob. Agents Chemother. 51: 386-389 [Abstract] [Full Text]  
  • Farrell, D. J., Morrissey, I., Bakker, S., Buckridge, S., Felmingham, D. (2004). In Vitro Activities of Telithromycin, Linezolid, and Quinupristin-Dalfopristin against Streptococcus pneumoniae with Macrolide Resistance Due to Ribosomal Mutations. Antimicrob. Agents Chemother. 48: 3169-3171 [Abstract] [Full Text]  
  • Achour, W., Guenni, O., Malbruny, B., Canu, A., Leclercq, R., Ben Hassen, A. (2004). Phenotypic and molecular characterization of macrolide and streptogramin resistance in Streptococcus mitis from neutropenic patients. J Antimicrob Chemother 54: 117-121 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, R. N.
Right arrow Articles by Morrissey, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, R. N.
Right arrow Articles by Morrissey, I.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»