AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Young, L. Y.
Right arrow Articles by Heitman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Young, L. Y.
Right arrow Articles by Heitman, J.

Next Article 

Antimicrobial Agents and Chemotherapy, September 2003, p. 2717-2724, Vol. 47, No. 9
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.9.2717-2724.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Disruption of Ergosterol Biosynthesis Confers Resistance to Amphotericin B in Candida lusitaniae

Laura Y. Young,1,4 Christina M. Hull,1 and Joseph Heitman1,4*

Departments of Molecular Genetics and Microbiology,1 Medicine,2 Pharmacology and Cancer Biology,3 Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 277104

Received 31 January 2003/ Returned for modification 21 March 2003/ Accepted 9 June 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Candida lusitaniae is an emerging human pathogen that, unlike other fungal pathogens, frequently develops resistance to the commonly used antifungal agent amphotericin B. Amphotericin B is a member of the polyene class of antifungal drugs, which impair fungal cell membrane integrity. Here we analyzed mechanisms contributing to amphotericin B resistance in C. lusitaniae. Sensitivity to polyenes in the related fungi Saccharomyces cerevisiae and Candida albicans requires the ergosterol biosynthetic gene ERG6. In an effort to understand the mechanisms contributing to amphotericin B resistance in C. lusitaniae, we isolated the ERG6 gene and created a C. lusitaniae erg6{Delta} strain. This mutant strain exhibited a growth defect, was resistant to amphotericin B, and was hypersensitive to other sterol inhibitors. Based on the similarities between the phenotypes of the erg6{Delta} mutant and clinical isolates of C. lusitaniae resistant to amphotericin B, we analyzed ERG6 expression levels and ergosterol content in multiple clinical isolates. C. lusitaniae amphotericin B-resistant isolates were found to have increased levels of ERG6 transcript as well as reduced ergosterol content. These changes suggest that another gene in the ergosterol biosynthetic pathway could be mutated or misregulated. Further transcript analysis showed that expression of the ERG3 gene, which encodes C-5 sterol desaturase, was reduced in two amphotericin B-resistant isolates. Our findings reveal that mutation or altered expression of ergosterol biosynthetic genes can result in resistance to amphotericin B in C. lusitaniae.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Infectious disease is a major cause of morbidity and mortality worldwide. In developing countries, infectious disease remains the leading cause of death, with 9.2 million deaths in 1990 alone (1, 20). As organisms develop resistance to current antimicrobial agents and the population of immunocompromised patients continues to increase, infectious disease has become an escalating problem not only in developing countries, but also in the United States and Canada (42). More specifically, opportunistic fungal infections are on the rise because of the increasing prevalence of AIDS, organ transplantation, and cancer chemotherapy (29, 43).

Fungal infections pose a unique problem because both the mammalian host and invading fungi are eukaryotic, making it difficult to develop specific antifungal agents that target only the pathogen. One major distinction between fungi and mammals is the primary sterol in the cell membrane; mammalian cells utilize cholesterol, whereas fungi employ ergosterol. As a result, ergosterol and its biosynthetic pathway serve as targets for a number of antifungal agents, including the polyene amphotericin B. The polyene class of drugs are known to bind ergosterol in the cell membrane, creating pores and causing cell lysis, and amphotericin B is one of the more efficacious antifungals because of its fungicidal activity (17). Although amphotericin B is very effective against most fungal pathogens, the opportunistic pathogen Candida lusitaniae exhibits unusually high intrinsic or acquired resistance to the drug.

Candida lusitaniae is a haploid dimorphic yeast that was first described in 1970, and it is one of the few Candida species known to have a complete sexual cycle (13, 15, 45, 50). Our previous studies revealed that the STE12 homolog CLS12 is required for mating, and we demonstrated that genes in C. lusitaniae could be effectively disrupted via homologous recombination (50). Considered an emerging pathogen, C. lusitaniae is isolated in {approx}1% of all candidemia infections and, more importantly, is often clinically challenging because of its resistance to amphotericin B (9, 19, 21, 24, 32, 35, 37). Prior to 1985, the majority of C. lusitaniae infections were fatal, largely as a consequence of intrinsic or acquired amphotericin B resistance (7).

The introduction of the azole class of antifungal agents has improved treatment of C. lusitaniae infections, but amphotericin B-resistant strains continue to be difficult to treat. In addition, some clinical strains have been found to possess dual resistance to both azoles and amphotericin B. C. lusitaniae isolates sensitive to amphotericin B have been reported to develop resistance at a rate of 1 in 104 cells through reversible high-frequency phenotypic switching (49). A previous study also revealed a change in colony phenotype (alteration of color when plated on Chromagar) of C. lusitaniae as it developed amphotericin B resistance (31).

Despite this unique response to amphotericin B, little is known about the mechanisms involved in the development of resistance. One study found a correlation between amphotericin B resistance and sterol composition consistent with a defect in the {Delta}8-7 isomerase Erg2 (38, 39), which can also result in amphotericin B resistance in C. albicans and C. neoformans (8, 27), but overall, there is limited information on the genome of C. lusitaniae, and there have not been any specific attempts to identify genes in the ergosterol biosynthetic pathway.

Closely related to C. lusitaniae is Candida albicans, a diploid, primarily asexual species that causes more than 90% of all Candida infections. Unlike C. lusitaniae, C. albicans does not have a known complete sexual cycle, but both species are reported to violate the universal genetic code by utilizing the CUG codon to encode serine rather than leucine (40, 41, 45). Ergosterol and its biosynthetic pathway have been characterized extensively in C. albicans and the related model yeast Saccharomyces cerevisiae. In these yeasts, ergosterol has also been shown to play a role in cell permeability and the cell cycle (10). The ergosterol biosynthetic pathway consists of many genes whose products are necessary to convert acetyl-coenzyme A to ergosterol. Three genes in the pathway, ERG1, ERG7, and ERG9, are known to be essential for cell viability in other fungi (30). The nonessential gene ERG6 encodes an S-adenosylmethionine:{Delta}24-methyltransferase and has been isolated and disrupted in both C. albicans and S. cerevisiae. erg6 mutant strains display multiple phenotypes, including increased resistance to polyenes, decreased ergosterol content, and increased cycloheximide sensitivity (14, 25).

To test the hypothesis that ERG6 plays a similar role in the development of amphotericin B resistance in C. lusitaniae, we isolated, cloned, and sequenced an ERG6 homolog, created an erg6 deletion strain, and evaluated phenotypes relevant to drug resistance. We show that the erg6{Delta} mutants are viable but exhibit a severe growth defect, increased resistance to amphotericin B, increased susceptibility to azoles, terbinafine, and morpholines, and decreased ergosterol content. Based on these findings, we surmised that mutations in or decreased expression of ERG6 could be responsible for the development of resistance to amphotericin B in C. lusitaniae clinical isolates. Instead we found that ERG6 expression is induced {approx}5-fold in amphotericin B-resistant clinical isolates of C. lusitaniae, while ergosterol content is reduced. Because mutations that compromise ergosterol biosynthesis result in global induction of ergosterol biosynthetic genes (6, 12, 22), this increased expression of ERG6 indicates a possible deficiency elsewhere in the ergosterol pathway and implicates alterations within the ergosterol pathway in the development of amphotericin B resistance. In fact, we discovered a reduction in ERG3 gene expression in two amphotericin B-resistant clinical isolates, indicating a role for perturbations in the regulation of ERG3 in the clinical development of amphotericin B resistance.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Media and strains. Strains were grown on yeast peptone dextrose (YPD) medium and synthetic dextrose medium lacking uracil (SD-Ura). SD-Ura with 1 M sorbitol was used in biolistic transformations. The C. lusitaniae strains used in this study were obtained from the American Type Culture Collection (ATCC): 38533 (CL2, MATa), 42720 (CL3, MAT{alpha}), 350030, 350031, and 350032 (also called 2819); from Ann Favel at the Laboratoire de Botanique, Cryptogamie at Biologie Cellulaire, Faculte de Pharmacie we obtained 2-367, 679, 787, 6856-1, and 6856-1; and from Michael Pfaller at Iowa State University we obtained 20194, 20195, 20202, 20203.76, 20203.95, 20236, and 20239. Other strains from the Heitman laboratory include C. lusitaniae CL24 (CL3 background, MAT{alpha} ura3), C. albicans KPC8 (erg6{Delta}::hisG-URA3-hisG/erg6{Delta}::hisG), and S. cerevisiae SMY41-1 (erg6{Delta}::G418).

Cloning of C. lusitaniae ERG6 homolog. The wild-type ERG6 gene was cloned from C. lusitaniae by degenerate PCR. Primers were designed against regions of identity in the S. cerevisiae and C. albicans ERG6 genes, 5'-GTIACIGAYTTYTAYGARTAYGGITGG and 3'-CATIACCCAYTCRTAIAC, where Y is T or C, R is G or A, and I is inosine. PCR conditions were 2 min at 94°C and then 35 cycles of 30 s at 94°C, 30 s at 45°C, and 1 min at 72°C, and a final 5-min extension at 72°C. The resulting {approx}500-bp fragment was cloned in the TA system (Invitrogen) and sequenced, revealing identity to ERG6 genes of other fungi. Genomic DNA from strain CL3 was obtained with a protocol described previously (23) and restriction digested with XbaI. Southern analysis was carried out with the 500-bp ERG6 PCR product labeled with the Alk-Phos Direct kit (Amersham Pharmacia) as a probe.

To isolate the ERG6 gene by size selection, genomic DNA from strain CL3 was digested with XbaI, and 3.7- to 4.2-kb fragments containing the ERG6 gene were recovered and ligated into pBluescript, digested with XbaI, and dephosphorylated. The library was transformed into Escherichia coli DH5{alpha} cells, and colony lifts and secondary screens were performed with the Alk-Phos Direct kit. The 500-bp fragment described above was used as the probe, and multiple colonies that contained the pBluescript/ERG6 plasmid (pLYM001) were identified. The entire 3.8-kb DNA fragment was sequenced bidirectionally at the Duke sequencing facility.

Construction of erg6::CaURA3 disruption allele. The ERG6 gene was disrupted with the C. albicans URA3 (CaURA3) gene by PCR overlap (11). Primers 1 (CGGTGAAGCACGATTGGTG) and 6 (ACTACAACGGAAGACCAC) were created to amplify the 5' untranslated region 350 bp upstream of ERG6 and the 3' untranslated region 750 bp downstream of the end of the ERG6 gene, respectively. Primer 2 (CATCAAGCATTTTCAACGATGAAGCTTCGTACGCTGCAGGTC) and the reverse complement, primer 3 (GACCTGCAGCGTACGAAGCTTCATCGTTGAAAATGCTTGATG), were created with 18 bp of 5' ERG6 and 18 bp of 5'CaURA3. Primer 4 (TCCACTAGTGGCCTATGCGGCGGATGACAAGTTGTCTTACG) and the reverse complement, primer 5 (CGTAAGACAACTTGTCATCCGCCGCATAGGCCACTAGTGGA), were created with 18 bp of 3' ERG6 and 18 bp of 3' CaURA3.

PCR was performed with primers 1 and 3 with the 3.8-kb ERG6 fragment as the template, with primers 4 and 6 and the 3.8-kb ERG6 fragment as the template, and primers 2 and 5 with the CaURA3 gene from plasmid pAG60 as the template (18). The three PCR fragments were recovered, and a PCR was performed with primers 1 and 6 and the three gel-purified PCR products as the template. The resulting overlap disruption construct consisted of the CaURA3 gene flanked on the 5' end by the ERG6 5' untranslated region and on the 3' end by the distal and 3' untranslated region of the ERG6 gene. PCR conditions for all of the above reactions were an initial 1 min at 94°C, followed by 35 cycles of 15 s at 94°C, 15 s at 55°C, and 2 min at 72°C (the PCR with primers 1 and 6 had an extension time of 3 min), and a final extension of 5 min at 72°C. The PCR overlap disruption construct was cloned with the Topo TA system (Invitrogen). The disruption construct plasmid (pDERG6) was digested with KpnI and XbaI, and the linearized DNA was transformed into strain CL24 (CL3 background, MAT{alpha} ura3) with the biolistic transformation protocol developed for Cryptococcus neoformans (44). Ura+ isolates were selected on SD-Ura medium containing 1 M sorbitol and screened by PCR and Southern blot to identify erg6::CaURA3 transformants.

Northern blots. RNA was isolated from yeast strains as previously described (5). Yeast cultures were grown to log phase in 50 ml of YPD at 30°C. Northern analysis was performed with a 300-bp DNA fragment of the ERG6 gene labeled with 32P with the Rediprime II kit (Amersham Pharmacia). To obtain probes to measure levels of expression of other ergosterol pathway genes, degenerate primers were designed against regions of identity in the S. cerevisiae, C. albicans, Candida glabrata, and Schizosaccharomyces pombe ergosterol genes and used in low-stringency PCR: ERG2, 5'-AAYAAYGCIGGIGGIGCIATG and 3'-GGDATCCTICCYTGIGC; ERG3, 5'-CCYAARCCICCYCCYAARTGG and 3'-TGYCCRTARTTRTARTTRAARTA; ERG5, 5'-GARGARTAYAARGCIAARTGG and 3'-RCARTTYTCRAADATYTTCAT; ERG9, 5'-GAYACIATHGARGAYGAYATG and 3'-GCCATIACYTGIGGDATIGC; ERG11, 5'-GTITTYTAYTGGATHCCITGG and 3'-ATYTCYTGRTCIGTCATYTT; ERG24, 5'-ACIGAYGGITTYGGITTYATG and 3'-CCTRTCICCRAARTARTTDAT; and ERG25, 5'-GARGAYACITGGCAYTAYTGG and 3'-TGRTGRTCYTCRTGRTGRTG, where Y is T or C, R is G or A, H is A, C, or T, D is A, G, or T, and I is inosine.

PCR conditions were 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 48°C, and 45 s at 72°C, and a final 5-min extension at 72°C. PCR products were cloned and sequenced by the Duke sequencing facility. The individual PCR products were labeled with 32P with the Rediprime II kit (Amersham Pharmacia) and used as probes in Northern blot analysis. To quantify mRNA expression levels, the Northern blots were analyzed on a Typhoon 9200 phosphorimager (Amersham Pharmacia).

Antifungal susceptibility tests. (i) Etest. Etests (AB Biodisk, Skolne, Sweden) were performed, and the results were interpreted according to the Etest technical guide. Isolates from a 24- to 48-h culture on Sabouraud dextrose agar were suspended in 0.85% NaCl to achieve a 0.5 McFarland turbidity. Then 200 µl of the yeast suspension was plated on RPMI medium (RPMI 1640, 2% glucose, morpholinepropanesulfonic acid [MOPS], and 1.5% Bacto Agar [Difco]) and allowed to dry for 15 min. Etest strips containing antifungal drug were then applied to the center of each plate and placed in a moist 35°C incubator for 24- to 48-h. Due to the slow growth of the erg6 mutant, it was necessary to incubate for 72 h in order to accurately read the ellipse of inhibition. The MIC was read as the lowest point where the ellipse of inhibition intersected the strip.

(ii) YeastOne Sensititre. YeastOne Sensititre tests (Trek Diagnostics, Westlake, Ohio) were performed, and the results were interpreted according to the manufacturer's guidelines. Isolates from a 24- to 48-h culture on Sabouraud dextrose agar were suspended in the water provided to achieve a 0.5 McFarland turbidity. Then 20 µl of the yeast suspension was aliquoted into the provided inoculum broth, and 100 µl of the inoculated broth was added to each well of the Sensititre plate. These plates were incubated for 24 to 72 h (depending on the growth rate of the individual strains) at 35°C. The MIC was read as the lowest concentration that prevented a color change from purple to pink.

(iii) Halo assays. YPD cultures (50 ml) were inoculated and grown at 30°C overnight. Cells were pelleted in a Sorvall tabletop centrifuge and washed three times with sterile water. The cells were counted with a hemacytometer, and the cultures were diluted in water to 104 cells/ml. YPD plates were warmed in a 37°C incubator, and various quantities of terbinafine and fenpropimorph were added to sterile Whatman disks and allowed to dry. Then 4 ml of sterile top agar (0.7% Bacto Agar and water, autoclaved) was inoculated with 200 µl of yeast suspension. The top agar was then plated to the warmed YPD plates and allowed to solidify before applying the antifungal disks with sterile forceps. The plates were incubated for 24 to 72 h (depending on growth rate of individual strains) at 37°C. Halo size was measured to detect changes in resistance compared to the wild type.

Growth and ergosterol assays. Fifty-milliliter YPD cultures were inoculated with yeast cells and grown at 30°C overnight. The optical density was measured, and the cultures were diluted with YPD to an optical density at 600 nm of 0.5. Cultures were grown at 30°C, and the optical density was measured every 2 h over a period of 10 h.

Ergosterol content was measured as previously described (3). Fifty-milliliter YPD cultures were inoculated and grown at 30°C overnight. Cells were pelleted in a tabletop centrifuge and washed with sterile water. The pellets were weighed, and 3 ml of 25% alcoholic potassium hydroxide was added. The cells were incubated at 80°C for 1 h and allowed to cool to room temperature. Then 1 ml of sterile water and 3 ml of heptane were added, and the yeast cells were vortexed for 3 min. Then 200 µl of the heptane layer was mixed with 800 µl of 100% ethanol and measured by spectrophotometer at both 281.5 and 230 nm. The conversion from optical density to ergosterol content was calculated as follows: % ergosterol = [(A281.5/290 x F)/pellet weight] - [(A230/518 x F)/pellet weight], where F is the ethanol dilution factor.

Nucleotide sequence accession numbers. The ERG6 sequence was given GenBank accession number AY179503. The GenBank accession numbers for the partial sequences are as follows: ERG2, AY179504; ERG3, AY179505; ERG5, AY194119; ERG24, AY194121; and ERG25, AY194122.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of C. lusitaniae ERG6 gene. The C. lusitaniae ERG6 gene was isolated by degenerate PCR amplification with primers designed to areas of sequence identity between the C. albicans and S. cerevisiae ERG6 genes. Low-stringency PCR conditions led to the identification of a 500-bp product from the genomic DNA of both the wild-type MATa (CL2, ATCC 38533) and MAT{alpha} strains (CL3, ATCC 42740). The PCR products were cloned and sequenced to reveal a partial open reading frame with identity to known ERG6 genes. Southern analysis with the purified PCR product as a probe identified a single 3.8-kb hybridizing fragment in both the a and {alpha} strains. To obtain a full-length clone, a size-selected library was constructed from genomic DNA of the {alpha} strain, CL3, and a 3.8-kb fragment containing the entire ERG6 gene was isolated by colony hybridization. Sequence analysis revealed a 1,128-bp open reading frame encoding a predicted protein of 376 amino acids. The C. lusitaniae Erg6 protein shares 80% and 63% amino acid sequence identity with the C. albicans and S. cerevisiae Erg6 homologs, respectively. The C. lusitaniae ERG6 gene was similar in size to previously identified ERG6 genes, and the nine amino acids that constitute the S-adenosylmethionine binding site were completely conserved in the C. lusitaniae homolog.

Creation of C. lusitaniae erg6 mutant strains. An erg6::CaURA3 disruption allele was created by inserting the C. albicans URA3 gene cassette into the ERG6 gene by a PCR overlap method (11, 18). The linear erg6::CaURA3 disruption allele was transformed with a biolistic gun into the MAT{alpha} ura3 strain CL24. Uracil prototrophic strains were selected on synthetic medium lacking uracil and containing 1 M sorbitol. In 1 out of 70 Ura+ isolates, the wild-type ERG6 gene was disrupted with the erg6::CaURA3 disruption allele, based on PCR and Southern and Northern blot analyses (Fig. 1).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Disruption of ERG6 gene and Southern and Northern analysis of erg6 mutants. (A) The C. albicans URA3 gene was used to replace the 5' half of the ERG6 gene, and the resulting erg6::CaURA3 allele was introduced by biolistic transformation and homologous recombination. (B) Genomic DNA was prepared from wild-type (WT) parental strain CL3 and from the erg6::CaURA3 mutant strain and digested with XbaI, and a Southern blot was performed with the ERG6 open reading frame as a probe. (C) RNA was prepared from the ERG6 wild-type parental strain CL3 and from the erg6::CaURA3 mutant strain, and a Northern blot was preformed with the ERG6 gene as the probe. UTR, untranslated region.

 
C. lusitaniae erg6 mutants have a growth defect. The erg6{Delta} strain grew very slowly on solid medium compared with congenic ERG6 wild-type strains. To further analyze growth rate, overnight cultures of wild-type (CL3) and erg6 mutant (CL131) strains were diluted to an optical density of 0.5, and the OD600 was measured every 2 h for 10 h. The doubling time of the wild-type strain CL3 was 2.6 h, while the doubling time of the erg6 mutant was approximately 4 h (Fig. 2A). The erg6 mutant did not achieve a wild-type optical density even after 48 h (data not shown). In addition, microscopy of the erg6 mutant revealed a mixture of enlarged, vacuolated cells with a smaller number of ovoid cells (Fig. 2B). Ergosterol has been implicated in cell cycle initiation in S. cerevisiae (14), and this difference in cell size may suggest a similar role in C. lusitaniae. The sterol content of both the wild-type and erg6 mutant strains was analyzed through heptane extraction and UV spectrophotometry. The ergosterol content of wild-type cells (0.016%) was reduced by at least 50% (0.008%) in the erg6 mutant cells (data not shown). This decrease in ergosterol may contribute to the observed defect in growth.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2. erg6{Delta} mutant has a growth defect and enlarged, vacuolated cells. (A) The erg6{Delta} mutant had a doubling time of approximately 4 h, while the doubling time of the wild-type (WT) strains CL2 (MATa) and CL3 (MAT{alpha}) was 2.6 h. (B) Cells of the WT, erg6{Delta} mutant, 2819, and 6856-2 strains were examined with a Zeiss Axioskop microscope and found to contain enlarged (over 10 µm) and vacuolated cells. Magnification, 40x. The wild-type (WT, CL3) cells are 4 to 5 µm.

 
C. lusitaniae erg6 mutants have altered drug susceptibility profiles. The antifungal drug sensitivity profile of the C. lusitaniae erg6 mutant was established by several methods. Etest strips were used to measure MICs for both amphotericin B and fluconazole. The erg6 mutants showed an 85- to 128-fold increase in resistance to amphotericin B, with an MIC of 8 to 12 µg/ml, compared to the wild-type MIC of 0.094 µg/ml. The erg6 mutants also displayed a sixfold-increased sensitivity to fluconazole, with an MIC of 1.0 µg/ml compared to the wild-type MIC of 6 µg/ml (Fig. 3A). YeastOne Sensititre plates were also used and revealed an increased resistance to amphotericin B and a modest increase in susceptibility to fluconazole in the erg6 mutant (Fig. 3B). Itraconazole and ketoconazole were found to have similar inhibition profiles in the wild-type and erg6 mutant strains (data not shown). Lastly, halo assays were performed to assess the response of the mutant to the antifungal agents terbinafine and fenpropimorph, which target squalene epoxidase (Erg1) and C-8 sterol isomerase (Erg2), respectively, in the ergosterol biosynthetic pathway. The erg6 mutant was found to be hypersensitive to both terbinafine and fenpropimorph compared to wild-type cells (data not shown).



View larger version (69K):
[in this window]
[in a new window]
 
FIG. 3. erg6{Delta} mutant and clinical isolates are resistant to amphotericin B. (A) With Etest strips, the erg6{Delta} mutant and strains 2819 and 6856-2 have greatly increased resistance to amphotericin B compared to the wild-type (WT) strain CL3. The erg6{Delta} mutant has a slight increase in sensitivity to fluconazole, while 2819 and 6856-2 are resistant to fluconazole compared to the wild type. (B) The erg6{Delta} mutant has greater resistance to amphotericin B and increased sensitivity to fluconazole compared to wild-type cells in the Sensititre YeastOne test. The concentrations of the antifungals are in micrograms per milliliter.

 
Because of the slow growth of the erg6{Delta} strain, it was difficult to evaluate the sensitivity of the strain strictly according to the assay guidelines. To accommodate the properties of the erg6{Delta} strain and other strains with growth defects, the incubation times in the Etest assay were increased from 24 h to 48 h or longer, until the strains showed sufficient growth to be evaluated. This change in protocol may allow a sensitive strain to show resistance that is the result of overgrowth, known as trailing. Trailing has been observed in C. albicans but has not been studied in C. lusitaniae (4). The Etest assays conducted here were evaluated as soon as an ellipse was visible to avoid the influence of trailing growth on resistance measurements. Because of the difficulties in determining precise MICs from very slow growing strains, the data presented here can best be used to elucidate trends of increasing and decreasing susceptibilities to the various antifungal agents. In each assay, the trends were the same: the erg6{Delta} strain showed increased resistance to amphotericin B and increased sensitivity to fluconazole.

Ergosterol gene expression in amphotericin B-resistant clinical isolates of C. lusitaniae is misregulated. Eighteen clinical isolates of C. lusitaniae reported to be resistant to amphotericin B were obtained and tested for ergosterol content and sensitivity to antifungal drugs (39, 47). Two isolates, 2819 and 6856-2, were found to be exceedingly resistant to amphotericin B, with MICs of 4 to 16 µg/ml and 16 to 32 µg/ml, respectively. Both isolates 2819 and 6856-2 showed substantial growth within the ellipse of inhibition on the Etest assay with fluconazole, indicating an increased resistance to azoles (Fig. 3A). In addition, both isolates were hypersensitive to terbinafine and fenpropimorph and were found to completely lack ergosterol (data not shown). Microscopic observation revealed that these strains also had enlarged, vacuolated cells (Fig. 2B). Based on similar but not identical phenotypes observed in the erg6 mutant, we hypothesized that a defect in the ERG6 gene or another ergosterol pathway gene might be responsible for these phenotypes.

To generate probes for use in transcript analyses, portions of several genes in the ergosterol pathway were isolated and cloned by degenerate PCR. Degenerate primers were designed to conserved regions in the S. cerevisiae, C. albicans, S. pombe, and C. glabrata ERG2, ERG3, ERG5, ERG24, and ERG25 genes of the ergosterol biosynthetic pathway. Low-stringency PCR resulted in products from the genomic DNA of the C. lusitaniae {alpha} strain CL3. The PCR products were cloned and sequenced, revealing open reading frames with identity to the predicted ergosterol genes. The isolated PCR products were then used as probes for Northern blots to determine the expression levels of these ergosterol biosynthetic genes. The ERG2, ERG5, ERG6, ERG24, and ERG25 genes were all overexpressed in both strains 2819 and 6856-2 (Table 1 and data not shown). In contrast, ERG3 expression was reduced in both isolates. These findings support the idea that a mutation in the ERG3 gene or in a gene that controls ERG3 gene expression results in a defect in ergosterol biosynthesis, resistance to amphotericin B, and concomitant induction of other ergosterol biosynthesis genes.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Amphotericin B-resistant clinical isolates have defects in ERG3 expression and overexpression of the ERG2, ERG5, ERG6, ERG24, and ERG25 genesa

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
C. lusitaniae has been emerging as a fungal pathogen over the last decade and has gained clinical notoriety because of inherent or rapid acquisition of amphotericin B resistance. Despite this, relatively little is known about C. lusitaniae, let alone its mechanisms of antifungal resistance. With the consideration that amphotericin B action involves ergosterol binding, we investigated the ergosterol biosynthetic pathway for an alteration leading to decreased ergosterol content. Previous studies in C. albicans and S. cerevisiae have shown that the ERG6 gene is nonessential for viability but critical for the production of ergosterol and sensitivity to polyene agents (14, 25).

We hypothesized that reduced expression or mutation of the ERG6 gene could lead to amphotericin B resistance in C. lusitaniae. We cloned and sequenced the C. lusitaniae ERG6 homolog encoding an S-adenosylmethionine transferase. To evaluate its function, we disrupted the ERG6 gene through biolistic transformation and characterized the growth properties and drug sensitivity profiles of the resulting erg6 mutant strain. We found that erg6 mutants have a severe growth defect, decreased ergosterol content, increased resistance to amphotericin B, and hypersensitivity to other sterol biosynthesis inhibitors. We further surmised that decreased expression or mutation of the ERG6 gene may result in the development of amphotericin B resistance in C. lusitaniae clinical isolates. Instead, we found that the ERG6 gene was induced in these isolates, indicating a possible defect elsewhere in the ergosterol biosynthetic pathway. Our studies imply that although an ERG6 mutation is not the cause of amphotericin B resistance in the clinical isolates studied here, resistance mechanisms likely involve the ergosterol biosynthetic pathway.

Despite many similarities found between the ergosterol biosynthetic pathways of various fungi, striking differences have been found in the roles of ergosterol biosynthesis genes. Ergosterol has been shown in previous studies to play a role in cell cycle induction in S. cerevisiae. Strains deficient in ergosterol production but supplemented with cholesterol still required ergosterol to maintain membrane integrity and continue through a normal cell cycle. Surprisingly, despite a lack of ergosterol, the erg6{Delta} mutant of S. cerevisiae did not reveal any growth or cell cycle defects, indicating that a sterol precursor produced prior to the modifications induced by ERG6 may be sufficient to cause cell cycle induction (14). In the C. lusitaniae erg6 mutant, we did observe a growth defect and, by microscopy, greatly enlarged and vacuolated cells indicating a possible cell cycle defect. In addition, the ERG11 gene was found to be essential in S. cerevisiae but nonessential in C. albicans (25). These differences in the roles of ergosterol genes indicate that we cannot simply apply previous fungal ergosterol biosynthetic pathway findings to C. lusitaniae. There is a need to fully investigate the pathway within C. lusitaniae in order to understand the roles played by the specific genes and sterols.

Both C. albicans and S. cerevisiae erg6 mutants have been shown to have an increase in resistance to nystatin, another polyene antifungal agent (14, 25). We tested these strains and also found an increase in resistance to amphotericin B (data not shown). Our C. lusitaniae erg6 mutant was also found to have increased resistance to amphotericin B and at the same time increased sensitivity to fluconazole. One possibility for this sensitivity is a decrease in the ergosterol content in the cell membrane, leading to a diminished number of targets for amphotericin B but increased cell permeability, allowing easier penetration by fluconazole. Another possibility is that the increased susceptibility to other sterol biosynthesis inhibitors may be due not only to the increased cell permeability, but also to a synergistic effect when two steps are inhibited in the ergosterol pathway.

Although we did not discover a mutation or downregulation of the ERG6 gene in clinical isolates of amphotericin B-resistant C. lusitaniae, we did find that several ergosterol pathway genes were overexpressed, whereas expression of the ERG3 gene was reduced. erg3 mutants of S. cerevisiae and C. glabrata have demonstrated resistance to azoles, and C. albicans and Cryptococcus neoformans mutant strains with sterol compositions consistent with an erg2 or erg3 mutation have been demonstrated to be resistant to both amphotericin B and azoles (8, 16, 26-28, 34, 36). It has also been shown in S. cerevisiae that mutants with an erg3{Delta} phenotype can be created either by specific amino acid substitutions in the open reading frame or by inactivation of two upstream promoter elements, UAS1 and UAS2 (2). When considering downregulation of ERG3 in the C. lusitaniae strains 2819 and 6856-2 and the similar antifungal profiles they share with other erg3 mutants, one possible mechanism by which these and other clinical isolates may acquire amphotericin B resistance is through the mutation of as yet unidentified promoter sequences similar to the UAS1 and UAS2 sequences of S. cerevisiae. Clearly, there are many additional possible mechanisms for the acquisition of resistance in these clinical isolates, and further studies are warranted to better characterize the altered ergosterol pathways of these two strains.

Previous studies suggest that amphotericin B-resistant C. lusitaniae strains are often susceptible to flucytosine and azoles, and azoles have been specifically recommended as an appropriate first-line therapy for C. lusitaniae candidemia (46). Case reports have also demonstrated effective eradication of amphotericin B-resistant C. lusitaniae infection through subsequent administration of either fluconazole alone or flucytosine and ketoconazole together (33, 48). In contrast, our two highly amphotericin B-resistant clinical isolates were also resistant to fluconazole, and several case studies have also reported failure of azole therapy against known amphotericin B-resistant isolates (48). C. albicans clinical strains with phenotypes suggestive of mutations in ERG3 have been shown to be resistant to both fluconazole and amphotericin B (26, 36).

Based on our data and previous findings, a refined treatment for amphotericin B-resistant infection can be considered. If the resistance mechanism is found to involve mutation or downregulation of the ERG3 gene, flucytosine in combination with a nonazole sterol biosynthesis inhibitor would be advised. Otherwise, an azole, such as fluconazole or itraconazole, would be recommended due to azole sensitivity observed with some clinical isolates that are resistant to amphotericin B. Further studies evaluating the role of the ERG3 gene and other mechanisms in antifungal resistance are warranted to better help direct clinical therapy for patients with amphotericin B-resistant C. lusitaniae infection, but our preliminary evaluations reveal promising directions in the tailoring of therapy according to specific fungal genotypes.


    ACKNOWLEDGMENTS
 
We thank Alan Goldstein, Rob Davidson, Debbie Fox, Miguel Arevalo-Rodriguez, Jill Blankenship, Chiatogu Onyewu, Cletus D'Souza, and Tom Mitchell for valuable scientific advice and assistance, Marie-Josee Boily for technical excellence, and John Rex, Anne Favel, Mike Pfaller, Martin Bard, and Wiley Schell for C. lusitaniae strains. We also thank Rebecca Casey for assistance with manuscript preparation.

Laura Young is a Howard Hughes Medical Institute Medical Student Research Training Fellow. Christina Hull is a Fellow of the Damon Runyon Cancer Research Fund supported by fellowship DRG-1694. These studies were supported in part by RO1 grant AI50438 from NIAID to Joseph Heitman and program project grant PO1 AI44975 from NIAID to the Duke University Mycology Research Unit. Joseph Heitman is a Burroughs Wellcome Scholar in Molecular Pathogenic Mycology and an Associate Investigator of the Howard Hughes Medical Institute.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Genetics and Microbiology, 322 CARL Building, Box 3546, Research Drive, Duke University Medical Center, Durham, NC 27710. Phone: (919) 684-2824. Fax: (919) 684-5458. E-mail: heitm001{at}duke.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Archibald, L. K., and L. B. Reller. 2001. Clinical microbiology in developing countries. Emerg. Infect. Dis. 7:302-305.[Medline]
  2. Arthington-Skaggs, B. A., D. N. Crowell, H. Yang, S. L. Sturley, and M. Bard. 1996. Positive and negative regulation of a sterol biosynthetic gene (ERG3) in the post-squalene portion of the yeast ergosterol pathway. FEBS Lett. 392:161-165.[CrossRef][Medline]
  3. Arthington-Skaggs, B. A., H. Jradi, T. Desai, and C. J. Morrison. 1999. Quantitation of ergosterol content: novel method for determination of fluconazole susceptibility of Candida albicans. J. Clin. Microbiol. 37:3332-3337.[Abstract/Free Full Text]
  4. Arthington-Skaggs, B. A., D. W. Warnock, and C. J. Morrison. 2000. Quantitation of Candida albicans ergosterol content improves the correlation between in vitro antifungal susceptibility test results and in vivo outcome after fluconazole treatment in a murine model of invasive candidiasis. Antimicrob. Agents Chemother. 44:2081-2085.[Abstract/Free Full Text]
  5. Ausubel, F., R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith, and K. Struhl (ed.). 1997. Current protocols in molecular biology, vol. 2, p. 13. John Wiley and Sons, Inc., Boston, Mass.
  6. Bammert, G. F., and J. M. Fostel. 2000. Genome-wide expression patterns in Saccharomyces cerevisiae: comparison of drug treatments and genetic alterations affecting biosynthesis of ergosterol. Antimicrob. Agents Chemother. 44:1255-1265.[Abstract/Free Full Text]
  7. Blinkhorn, R. J., D. Adelstein, and P. J. Spagnuolo. 1989. Emergence of a new opportunistic pathogen, Candida lusitaniae. J. Clin. Microbiol. 27:236-240.[Abstract/Free Full Text]
  8. Broughton, M. C., M. Bard, and N. D. Lees. 1991. Polyene resistance in ergosterol producing strains of Candida albicans. Mycoses 34:75-83.[Medline]
  9. Christenson, J., A. Guruswamy, G. Mukwaya, and P. Rettig. 1987. Candida lusitaniae: an emerging human pathogen. Pediatr. Infect. Dis. J. 6:755-757.[Medline]
  10. Dahl, C., H.-P. Biemann, and J. Dahl. 1987. A protein kinase antigenically related to pp60v-src possibly involved in yeast cell cycle control: Positive in vivo regulation by sterol. Proc. Natl. Acad. Sci. USA 84:4012-4016.[Abstract/Free Full Text]
  11. Davidson, R. C., J. R. Blankenship, P. R. Kraus, M. D. Berrios, C. M. Hull, C. D'Souza, P. Wang, and J. Heitman. 2002. A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 148:2607-2615.[Abstract/Free Full Text]
  12. De Backer, M. D., T. Ilyina, X.-J. Ma, S. Vandoninck, W. H. M. L. Luyten, and H. V. Bossche. 2001. Genomic profiling of the response of Candida albicans to itraconazole treatment with a DNA microarray. Antimicrob. Agents Chemother. 45:1660-1670.[Abstract/Free Full Text]
  13. Francois, F., T. Noel, R. Pepin, A. Brulfert, C. Chastin, A. Favel, and J. Villard. 2001. Alternative identification test relying upon sexual reproductive abilities of Candida lusitaniae strains isolated from hospitalized patients. J. Clin. Microbiol. 39:3906-3914.[Abstract/Free Full Text]
  14. Gaber, R. F., D. M. Copple, B. K. Kennedy, M. Vidal, and M. Bard. 1989. The yeast gene ERG6 is required for normal membrane function but is not essential for biosynthesis of the cell cycle-sparking sterol. Mol. Cell. Biol. 9:3447-3456.[Abstract/Free Full Text]
  15. Gargeya, I. B., W. R. Pruitt, R. B. Simmons, S. A. Meyer, and D. G. Ahearn. 1990. Occurrence of Clavispora lusitaniae, the teleomorph of Candida lusitaniae, among clinical isolates. J. Clin. Microbiol. 28:2224-2227.[Abstract/Free Full Text]
  16. Geber, A., C. A. Hitchcock, J. E. Swartz, F. S. Pullen, K. E. Marsden, K. J. Kwon-Chung, and J. E. Bennett. 1995. Deletion of the Candida glabrata ERG3 and ERG11 genes: effect on cell viability, cell growth, sterol composition, and antifungal susceptibility. Antimicrob. Agents Chemother. 39:2708-2717.[Abstract]
  17. Georgopapadakou, N. H. 1998. Antifungals: mechanism of action and resistance, established and novel drugs. Curr. Opin. Microbiol. 1:547-557.[CrossRef][Medline]
  18. Goldstein, A. L., X. Pan, and J. H. McCusker. 1999. Heterologous URA3MX cassettes for gene replacement in Saccharomyces cerevisiae. Yeast 15:507-511.[CrossRef][Medline]
  19. Guinet, R., J. Chanas, A. Goullier, G. Bonnefoy, and P. Ambroise-Thomas. 1983. Fatal septicemia due to amphotericin B-resistant Candida lusitaniae. J. Clin. Microbiol. 18:443-444.[Abstract/Free Full Text]
  20. Hart, C. A., and S. Kariuki. 1998. Antimicrobial resistance in developing countries. Br. Med. J. 317:647-650.[Free Full Text]
  21. Hazen, K. C. 1997. New and emerging yeast pathogens. Clin. Microbiol. Rev. 8:462-478.
  22. Henry, K. W., J. T. Nickels, and T. D. Edlind. 2000. Upregulation of ERG genes in Candida species by azoles and other sterol biosynthesis inhibitors. Antimicrob. Agents Chemother. 44:2693-2700.[Abstract/Free Full Text]
  23. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267-272.[CrossRef][Medline]
  24. Holzschu, D. L., H. L. Presley, M. Miranda, and H. J. Phaff. 1979. Identification of Candida lusitaniae as an opportunistic yeast in humans. J. Clin. Microbiol. 10:202-205.[Abstract/Free Full Text]
  25. Jensen-Pergakes, K. L., M. A. Kennedy, N. D. Lees, R. Barbuch, C. Koegel, and M. Bard. 1998. Sequencing, disruption, and characterization of the Candida albicans sterol methyltransferase (ERG6) gene: drug susceptibility studies in erg6 mutants. Antimicrob. Agents Chemother. 42:1160-1167.[Abstract/Free Full Text]
  26. Kelly, S. L., D. C. Lamb, D. E. Kelly, N. J. Manning, J. Loeffler, H. Hebart, U. Schumacher, and H. Einsele. 1997. Resistance to fluconazole and cross-resistance to amphotericin B in Candida albicans from AIDS patients caused by defective sterol {Delta}5, 6-desaturation. FEBS Lett. 400:80-82.[CrossRef][Medline]
  27. Kelly, S. L., D. C. Lamb, M. Taylor, A. J. Corran, B. C. Baldwin, and W. G. Powderly. 1994. Resistance to amphotericin B associated with defective sterol {Delta}8-7 isomerase in a Cryptococcus neoformans strain from an AIDS patient. FEMS Microbiol. Lett. 122:39-42.[CrossRef][Medline]
  28. Kontoyiannis, D. P. 2000. Modulation of fluconazole sensitivity by the interaction of mitochondria and Erg3p in Saccharomyces cerevisiae. J. Antimicrob. Chemother. 46:191-197.[Abstract/Free Full Text]
  29. Lederberg, J. 1992. The interface of science and medicine. Mt. Sinai J. Med. 59:380-383.[Medline]
  30. Lees, N. D., B. Skaggs, D. R. Kirsch, and M. Bard. 1995. Cloning of the late genes in the ergosterol biosynthetic pathway of Saccharomyces cerevisiae—a review. Lipids 30:221-226.[Medline]
  31. McClenny, N. B., H. Fei, E. J. Baron, A. C. Gales, A. Houston, R. J. Hollis, and M. A. Pfaller. 2002. Change in colony morphology of Candida lusitaniae in association with development of amphotericin B resistance. Antimicrob. Agents Chemother. 46:1325-1328.[Abstract/Free Full Text]
  32. Merz, W. G. 1984. Candida lusitaniae: frequency of recovery, colonization, infection, and amphotericin B resistance. J. Clin. Microbiol. 20:1194-1195.[Abstract/Free Full Text]
  33. Minari, A., R. Hachem, and I. Raad. 2001. Candida lusitaniae: a cause of breakthrough fungemia in cancer patients. Clin. Infect. Dis. 32:186-190.[CrossRef][Medline]
  34. Miyazaki, Y., A. Geber, H. Miyazaki, D. Falconer, T. Parkinson, C. Hitchcock, B. Grimberg, K. Nyswaner, and J. E. Bennett. 1999. Cloning, sequencing, expression and allelic sequence diversity of ERG3 (C-5 sterol desaturase gene) in Candida albicans. Gene 236:43-51.[CrossRef][Medline]
  35. Nguyen, M. H., A. J. Morris, M. E. Dobson, D. R. Snydman, J. J. E. Peacock, M. G. Rinaldi, and V. L. Yu. 1996. Candida lusitaniae: an important emerging cause of candidemia. Infect. Dis. Clin. Pract. 5:273-278.
  36. Nolte, F. S., T. Parkinson, D. J. Falconer, S. Dix, J. Williams, C. Gilmore, R. Geller, and J. R. Wingard. 1997. Isolation and characterization of fluconazole- and amphotericin B-resistant Candida albicans from blood of two patients with leukemia. Antimicrob. Agents Chemother. 41:196-199.[Abstract]
  37. Pappagianis, D., M. S. Collins, R. Hector, and J. Remington. 1979. Development of resistance to amphotericin B in Candida lusitaniae infecting a human. Antimicrob. Agents Chemother. 16:123-126.[Abstract/Free Full Text]
  38. Peyron, F., A. Favel, R. Calaf, A. Michel-Nguyen, R. Bonaly, and J. Coulon. 2002. Sterol and fatty acid composition of Candida lusitaniae clinical isolates. Antimicrob. Agents Chemother. 46:531-533.[Abstract/Free Full Text]
  39. Peyron, F., A. Favel, A. Michel-Nguyen, M. Gilly, P. Regli, and A. Bolmstrom. 2001. Improved detection of amphotericin B-resistant isolates of Candida lusitaniae by Etest. J. Clin. Microbiol. 39:339-342.[Abstract/Free Full Text]
  40. Santos, M. A. S., G. Keith, and M. F. Tuite. 1993. Non-standard translational events in Candida albicans mediated by an unusual seryl-tRNA with a 5'-CAG-3' (leucine) anticodon. EMBO J. 12:607-616.[Medline]
  41. Santos, M. A. S., T. Ueda, K. Watanabe, and M. F. Tuite. 1997. The non-standard genetic code of Candida spp.: an evolving genetic code or a novel mechanism for adaptation? Mol. Microbiol. 26:423-431.[CrossRef][Medline]
  42. Sattar, S. A., J. Tetro, and V. S. Springthorpe. 1999. Impact of changing societal trends on the spread of infections in American and Canadian homes. Am. J. Infect. Control. 27:S4-21.[CrossRef][Medline]
  43. Singh, N. 2001. Trends in the epidemiology of opportunistic fungal infections: predisposing factors and the impact of antimicrobial use practices. Clin. Infect. Dis. 33:1692-1696.[CrossRef][Medline]
  44. Toffaletti, D. L., T. H. Rude, S. A. Johnston, D. T. Durack, and J. R. Perfect. 1993. Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J. Bacteriol. 175:1405-1411.[Abstract/Free Full Text]
  45. van Uden, N., and H. Buckley. 1970. Candida Berkhout, p. 893-1087. In J. Lodder (ed.), The yeasts: a taxonomic study. North-Holland, Amsterdam, The Netherlands.
  46. Viudes, A., J. Peman, E. Canton, P. Ubeda, J. Lopez-Ribot, and M. Gobernado. 2002. Candidemia at a tertiary-care hospital: epidemiology, treatment, clinical outcome and risk factors for death. Eur. J. Clin. Microbiol. Infect. Dis. 21:767-774.[CrossRef][Medline]
  47. Wanger, A., K. Mills, P. W. Nelson, and J. H. Rex. 1995. Comparison of Etest and National Committee for Clinical Laboratory Standards broth macrodilution method for antifungal susceptibility testing: enhanced ability to detect amphotericin B-resistant Candida isolates. Antimicrob. Agents Chemother. 39:2520-2522.[Abstract]
  48. Yinnon, A. M., K. A. Woodin, and K. R. Powell. 1992. Candida lusitaniae infection in the newborn: case report and review of the literature. Pediatr. Infect. Dis. 11:878-880.
  49. Yoon, S. A., J. A. Vazquez, P. E. Steffan, J. D. Sobel, and R. A. Akins. 1999. High-frequency, in vitro reversible switching of Candida lusitaniae clinical isolates from amphotericin B susceptibility to resistance. Antimicrob. Agents Chemother. 43:836-845.[Abstract/Free Full Text]
  50. Young, L. Y., M. C. Lorenz, and J. Heitman. 2000. A STE12 homolog is required for mating but dispensable for filamentation in Candida lusitaniae. Genetics 155:17-29.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, September 2003, p. 2717-2724, Vol. 47, No. 9
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.9.2717-2724.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Young, L. Y.
Right arrow Articles by Heitman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Young, L. Y.
Right arrow Articles by Heitman, J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS