This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quinteros, M.
Right arrow Articles by Gutkind, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quinteros, M.
Right arrow Articles by Gutkind, G.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, September 2003, p. 2864-2867, Vol. 47, No. 9
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.9.2864-2867.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Extended-Spectrum ß-Lactamases in Enterobacteriaceae in Buenos Aires, Argentina, Public Hospitals

M. Quinteros,1 M. Radice,2 N. Gardella,2 M. M. Rodriguez,2 N. Costa,1 D. Korbenfeld,1 E. Couto,1 G. Gutkind,2* and the Microbiology Study Group{dagger}

Hospital de Enfermedades Infecciosas "F. J. Muñiz",1 Facultad de Bioquímica y Farmacia UBA, Buenos Aires, Argentina2

Received 20 December 2002/ Returned for modification 21 March 2003/ Accepted 21 June 2003


arrow
ABSTRACT
 
Resistance to extended-spectrum cephalosporins is often associated with plasmid encoded extended spectrum ß-lactamases (ESBL). In order to evaluate the prevalence and diversity of ESBLs in enterobacteria in our city, a 1-month-period survey was carried out from April to May 2000. Extended-spectrum-cephalosporin-resistant strains, isolated from inpatient clinical specimens other than stools, were collected among 17 participating hospitals. From a total of 427 enterobacterial strains that were collected during this period, 39 were extended-spectrum cephalosporin resistant. The National Committee for Clinical Laboratory Standards' Screening and Confirmatory Tests for ESBL production were performed using cefotaxime and ceftazidime; cefepime and cefepime-clavulanic acid-containing disks were included. ß-Lactamases were characterized by isoelectric focusing and PCR amplification using specific primers. Three different ESBLs were detected: SHV-related (4 isolates), PER-2-type (9 isolates), and CTX-M-2-related (26 isolates). Sequencing of the corresponding genes confirmed CTX-M-2 in 19 of 21 and CTX-M-31 (an allelic variant) in the remaining 2 of 21. CTX-M-2 (or its variant) was detected in all Escherichia coli, Enterobacter aerogenes, Serratia marcescens, Proteus mirabilis, and Providencia stuartii strains, while PER-2 was detected in Enterobacter cloacae, E. aerogenes, and Klebsiella pneumoniae; SHV-related ESBL were found only in K. pneumoniae. These results clearly show that CTX-M-2 is the most prevalent ESBL produced by enterobacterial species isolated from public hospitals in Buenos Aires.


arrow
INTRODUCTION
 
Antimicrobial resistance among Enterobacteriaceae has become a growing problem in our country (1, 15, 16). Resistance to extended-spectrum cephalosporins is often associated with plasmid encoded extended-spectrum beta-lactamases (ESBL). Although elsewhere many of these enzymes are derived through a single amino acid substitution or a few amino acid substitutions from the parental enzymes TEM-1, TEM-2, and SHV-1, other emerging class A enzymes, such as CTX-M and PER enzymes (3-7, 10), have been reported as long as a decade ago in our region. Hyperproduction of inducible chromosomally encoded beta-lactamases in some species of Enterobacteriaceae may also contribute to resistance in those species (9, 11)

Since its first detection in our country (2, 4, 18), CTX-M-2 has been identified not only in all oxyiminocephalosporin-resistant members of Enterobacteriaceae (15-17) but also in Vibrio cholerae and Aeromonas hydrophila (14, 19) (M. Quinteros, M. Radice, P. Power, et al., Abstr. 9th Int. Congr. Infect. Dis., abstr. 15884, 2000). PER-2 has been reported in Klebsiella pneumoniae, Enterobacter cloacae, and Escherichia coli among others. Although frequently stated in national and international meetings as prevalent (in particular, CTX-M-2 has been repeatedly mentioned for different enterobacterial species), no reliable epidemiological data are available currently in our region.

In 1999, a network of microbiology laboratories was established within the metropolitan Public Hospitals under administration by the Buenos Aires City Government to optimize resource utilization and to establish rules for different methodologies and diagnostic criteria. Detection and classification of ESBL in public hospitals was one of the multicentric studies proposed by this group.

To evaluate the prevalence of diverse ESBLs in our hospitals, a 1-month survey was carried out from April to May of 2000 in Metropolitan Public Hospitals of Buenos Aires City. Epidemiological data both on antibiotic resistance and on the involved resistance mechanisms should be useful for public health workers in evaluating the current recommendations for antibiotic usage.


arrow
MATERIALS AND METHODS
 
Bacterial strains. During April to May 2000, 17 Public Hospitals of Buenos Aires City (see Acknowledgments) collected all consecutive and nonrepetitive enterobacterial isolates from inpatients. Due to the expected high number (and supposed resistance levels as reported in reference 1 and by Whonet (www.paho.org) of E. coli and K. pneumoniae isolates, only those corresponding to 1 week (within this period) were fully analyzed (see Table 1). All species were identified using both conventional techniques and automatized assays (MicroScan; Vitek). Isolates not involved in the primary infection according to the Centers for Disease Control and Prevention criteria and those from stools were excluded (8). All cefotaxime (CTX)-resistant and/or ceftazidime (CAZ)-resistant isolates (independently of bacterial species, with inhibition zone of <=27 mm for CTX or <=22 mm for CAZ) were further analyzed for their ESBL presence by microbiological, biochemical, and genetic analysis.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Percentage of resistance within each bacterial species

Susceptibility tests and detection of ESBL producers. Susceptibility tests were performed in each laboratory by disk diffusion assays according to National Committee for Clinical Laboratory Standards recommendations (13) and confirmed using MicroScan Neg Urine Combo 5 panel. MicroScan panels were tested using the AutoScan-4 instrument with v22.26 of MS Data Management System. Screening and Confirmatory Tests for ESBL production were assayed accordingly to National Committee for Clinical Laboratory Standards recommendations for E. coli and Klebsiella spp. (independently of bacterial species). CTX (30 µg)- and CAZ (30 µg)-containing disks and their combination with clavulanic acid (10 µg) were included (13). An increment in the inhibition zone of at least 5 mm was considered as ESBL production. We also included cefepime (FEP) (30 µg)- and FEP-clavulanic acid (30 and 10 µg)-containing disks for their proposed better discriminatory power between ESBL production and AmpC hyperproduction (21).

Isoelectric focusing analysis and enzyme inhibition assay. Soluble crude ß-lactamase extracts obtained by ultrasonic disruption followed by centrifugation (27,000 x g, 10 min, 4°C) were subjected to isoelectric focusing by the method of Mathew et al. on broad-range gels (pH, 3 to 10), using an LKB Multiphor apparatus (Pharmacia Sweden) (12). ß-Lactamase activity was revealed by the agar iodometric system using ampicillin (500 µg/ml) and ceftriaxone (1,000 µg/ml) as substrates (18). The pIs of the ß-lactamases were estimated from the pIs of known enzymes and commercial pI markers (Pharmacia). Inhibition assays were carried out after preincubating the gels in a clavulanic acid solution (20 mM) for 15 min, with activity revealed as previously mentioned.

Molecular detection of bla genes. Plasmid DNA was prepared by a modified Birnboim and Doly alkaline lysis method (20). bla genes were amplified using the following oligonucleotide primers (5 min at 95°C, 30 cycles [1 min at 94°C, 1 min of annealing at 52°C, 1.5-min extension at 72°C] followed by a 10-min final extension at 72°C): blaTEM (5' ATAAAATTCTTGAAGACGAAA 3', 5' GACAGTTACCAATGCTTAATCA 3'), blaSHV (5' TCGGGCCGCGTAGGCATGAT 3', 5' AGCAGGGCGACAATCCCGCG 3'), blaCTX-M (5' TTAATGATGACTCAGAGCATTC 3', 5' GATACCTCGCTCCATTTATTG 3'), and blaPER-2 (5' TGTGTTTTCACCGCTTCTGCTCTG 3', 5' CAGCTCAAACTGATAAGCCGCTTG 3').

Sequencing of CTX-M-positive PCR products. PCR products were automatically sequenced in both strands by primer extension with the same primers, using an ABI PRISM 3700 DNA.


arrow
RESULTS
 
Distribution of clinical isolates and resistance. From 427 enterobacteria recovered within this period, 9% of them (39 isolates) were considered resistant to oxyiminocephalosporins. No carbapenem-resistant isolates were detected in this period. They included 5 E. coli isolates, 10 K. pneumoniae isolates, 7 Proteus mirabilis isolates, 7 E. cloacae isolates, 3 Enterobacter aerogenes isolates, 3 Serratia marcescens isolates, 3 Providencia stuartii isolates, and 1 Citrobacter freundii isolate. The percentage of resistance in each bacterial species is shown in Table 1. Not a single CAZ-resistant, CTX-sensitive microorganism was detected.

A single S. marcescens strain reported in one hospital was not submitted for characterization and was not included in these numbers.

Detection of ESBL producers. CTX-CTX-clavulanic acid disks confirmed the presence of ESBL in E. coli, K. pneumoniae, and P. mirabilis isolates but failed to confirm ESBL production in four of six E. cloacae isolates, one of three S. marcescens isolates, and two of three Providencia spp. CAZ-CAZ-clavulanic acid-containing disks displayed less ESBL detection ability, as they failed to detect ESBL production in one E. coli isolate, all P. mirabilis isolates, four E. cloacae isolates, two S. marcescens isolates, and two Providencia spp. The use of FEP-FEP-clavulanic acid improved noticeably the detection of ESBL, as only one ESBL-producing Providencia spp. was not detected. ESBL distribution among species is shown in Table 2.


View this table:
[in this window]
[in a new window]
 
TABLE 2. NCCLS' ESBL confirmatory tests with ESBL-harboring enterobacteria

Prevalence of ESBL in enterobacterial strains. An extended-spectrum ß-lactamase with a pI of 5.4 was detected in all isolates included in this study. PCR amplification using specific primers for bla TEM was positive in all cases.

Of the 39 total strains, almost all of them (37 isolates) were ESBL producers.

Two isolates, one E. cloacae and the other C. freundii, were characterized as AmpC hyperproducers, corresponding to 5% of the resistant strains.

Isoelectric focusing and gene amplification allowed the characterization of three different ESBL: CTX-M-2-type (26 isolates), PER-2-type (7 isolates), and SHV enzymes (4 isolates). By sequencing of 21 of 26 of the CTX-M-2-type PCR-positive amplicons, it was confirmed that in 19 of 21 it was this gene (100% identity) and not one corresponding to any other known enzyme (CTX-M-4, CTX-M-5, CTX-M-6, CTX-M-7, CTX-M-20, TOHO-1, or KLU-A-1). However, two of them (one Providencia sp. and one E. coli isolate) were allelic variants (CTX-M-31) with a single nucleotide change, resulting in a Thr-162-Ser substitution.

Confirmation of clavulanic acid activity on each suspected ESBL active band could be achieved by isolectric focusing and preincubation with inhibitors, after which activity was revealed by the iodometric gel overlay.

The presence of two or more ESBLs in the same isolate was not detected. The distribution of different ESBLs in each species is shown in Table 3.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Distribution of ESBL in different enterobacterial species


arrow
DISCUSSION
 
In the past, detection of resistance mediated by classical ESBLs was carried out using any of the common extended-spectrum cephalosporins (CAZ or CTX) or aztreonam. Appearance of new resistance mechanisms made mandatory the use of more than one potential substrate and implied also modifications in the associated breakpoints (17). Overall resistance detection abilities of different disks proved, for our epidemiological situation, that CTX and CAZ outperformed CAZ as a single disk, due to the prevalence (suspected and confirmed in this work) of CTX-M-2.

Presumptive and confirmatory detection of ESBLs by methods based on the inhibitory effects of clavulanic acid are usually precluded for enterobacteria that may posses inducible chromosomal ß-lactamases, because of the potential induction effects of clavulanic acid over the chromosomal ß-lactamase expression, the final effect being a balance between the induction and the inhibitory effect. Even if in the past it was not critical from a clinical point of view, discrimination between ESBLs and hyperproduction of class C ß-lactamases is obviously of epidemiological importance for the hospital environment, and since availability of cefepime may also prove clinically relevant. The use of the FEP-FEP-clavulanic acid-containing disks improved detection of ESBLs in these species to 93% compared with 60 and 53% obtained with CTX and CAZ, respectively.

ESBL production was the main resistance mechanism in all enterobacterial strains, although 5% of resistance was due to AmpC hyperproduction.

CTX-M-2 (and its variant) was the prevalent ESBL in our hospitals, corresponding to 67% of the characterized ß-lactamases. CTX-M-2 was ubiquitous in all species, being the only ESBL detected in P. mirabilis and S. marcescens. PER-2 was detected in 18% of the isolates. SHV enzymes were the third-most-prevalent ESBLs, but they were almost restricted to K. pneumoniae.

As previously stated in different reports, no TEM-derived ESBL enzymes were detected as ESBLs.

Even if not formally published, resistance prevalences of different extended-spectrum cephalosporins have been estimated to be, for our region, much higher than in other regions of the world (1) (www.paho.org). However, most of these estimations have been obtained either from surveillance programs or by the analysis of microorganisms submitted for characterization in reference or "resistance analysis-dedicated" laboratories. These estimations may have been biased by the origin of the microorganisms, it not being an easy task to clean up the relevance of strain duplications, or cultivation only after unsuccessful treatments.

Our results, even if they still are higher than those reported for other cities or hospitals around the world, are much closer to the worldwide experience. We cannot discard the possibility, obviously, that just by chance resistance was underrepresented in this period, but it seems improbable, at least given the number of different hospitals involved, each one contributing to the final numbers.


arrow
ACKNOWLEDGMENTS
 
M.M.R. and N.G. are recipients of a Foncyt fellowship and a Carrillo-Oñativia fellowship (respectively). This work was supported in part by grants from the University of Buenos Aires, Argentina (TB 039), and SEPCYT (PICT 0693) to G.G.

G.G. is a member of "Carrera del Investigador Científico-CONICET."

Members of the Microbiology Study Group and the number of extended-spectrum cephalosporin-resistant isolates (if any) contributed are as follows: M. Badía and N. Gómez, General de Agudos "Dr. Cosme Argerich," four isolates; M. Iglesias, General de Agudos "Dr. Teodoro Alvarez," four isolates; R. Favre and M. Flaibene, General de Agudos "Dr. Carlos Durand, six isolates; S. Kauffman, General de Agudos "Dr. Juan Fernández," three isolates; E. Couto and M. Quinteros, de Infecciosas "Dr. Francisco Muñiz," six isolates; R. Glaser and M. Torchio, General de Agudos "Dr. José María Penna"; D. Vallester and L. Rivera, General de Agudos "Dr. Palmenio Piñero"; P. Fontana, General de Agudos "Bernardino Rivadavia," two isolates; A. Casimiro and C. Garbasz, General de Agudos "Dr. Ignacio Pirovano," two isolates; M. T. López Reyes, General de Agudos Donación "Santojanni," two isolates; L. Botto and M. Cervetto, Materno Infantil "Dr. Ramón Sardá," one isolate; M. Hoffman and H. Villar, General de Agudos "Dr. E. Tornú," one isolate; R. Mondino and L. Lobov, General de Agudos "Dr. Abel Zubizarreta," four isolates; H. Lopardo and E. Rubeglio, Nacional de Pediatría "Dr. Juan P. Garrahan," three isolates; O. Sivori, Instituto del Lisiado; M. L. Chavez, Instituto Oncológico, one isolate; and J. Kovensky, de Quemados.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Hospital de Enfermedades Infecciosas "F. J. Muñiz," Buenos Aires, Argentina Facultad de Bioquímica y Farmacia UBA, Junín 956, CP:1113, Buenos Aires, Argentina. Phone: 54 11 496 48285. Fax: 54 11 450 83645. E-mail: ggutkind{at}ffyb.uba.ar. Back

{dagger} Members are listed in Acknowledgments. Back


arrow
REFERENCES
 
    1
  1. Bantar, C., A. Famiglietti, M. Goldberg, The Antimicrobial Committee, and The National Surveillance Program (SIR) Participants Group. 2000. Three-year surveillance study of nosocomial bacterial resistance in Argentina. Int. J. Infect. Dis. 4:85-90.[CrossRef][Medline]
  2. 2
  3. Bauernfeind, A., J. M. Casellas, M. Goldberg, M. Holley, R. Jungwirth, P. Mangold, T. Röhnisch, S. Schweighart, and R. Wilhelm. 1992. A new plasmidic cefotaximase from patients infected with Salmonella typhimurium. Infection 20:158-163.[CrossRef][Medline]
  4. 3
  5. Bauernfeind, A., I. Stemplinger, R. Jungwirth, P. Mangold, S. Amann, E. Akalin, Ö. Ang, C. Bal, and J. M. Casellas. 1996. Characterization of ß-lactamase gene blaPER-2, which encodes an extended-spectrum class A ß-lactamase. Antimicrob. Agents Chemother. 40:616-620.[Abstract]
  6. 4
  7. Bauernfeind, A., I. Stemplinger, R. Jungwirth, S. Ernst, and J. M. Casellas. 1996. Sequences of beta-lactamase genes encoding CTX-M-1 (MEN-1) and CTX-M-2 and relationship of their amino acid sequences with those of other ß-lactamases. Antimicrob. Agents Chemother. 40:509-513.[Abstract]
  8. 5
  9. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for ß-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233.[Medline]
  10. 6
  11. Collatz, E., R. Labia, and L. Gutmann. 1990. Molecular evolution of ubiquitous ß-lactamases towards extended-spectrum enzymes active against newer ß-lactam antibiotics. Mol. Microbiol. 4:1615-1620.[CrossRef][Medline]
  12. 7
  13. Coudron, P. E., E. S. Moland, and C. C. Sanders. 1997. Occurrence and detection of extended-spectrum ß-lactamases in members of the family Enterobacteriaceae at a veterans medical center: seek and you may find. J. Clin. Microbiol. 35:2593-2597.[Abstract]
  14. 8
  15. Garner, J. S., W. R. Jarvis, T. G. Emori, T. C. Horan, and J. M. Hughes. 1988. CDC definitions for nosocomial infections, 1988. Am. J. Infect. Control 16:128-139.[CrossRef][Medline]
  16. 9
  17. Huber, T. W., and J. S. Thomas. 1994. Detection of resistance due to inducible ß-lactamase in Enterobacter aerogenes and Enterobacter cloacae. J. Clin. Microbiol. 32:2481-2486.[Abstract/Free Full Text]
  18. 10
  19. Jacoby, G. A. 1994. Extrachromosomal resistance in Gram-negative organisms: the evolution of ß-lactamase. Trends Microbiol. 2:357-360.[CrossRef][Medline]
  20. 11
  21. Livermore, D. M. 1995. ß-Lactamases in laboratory and clinical resistance. Clin. Microbiol. Rev. 8:557-584.[Abstract]
  22. 12
  23. Mathew, A., A. M. Harris, M. J. Marshall, and G. W. Ross. 1975. The use of analytical isoelectric focusing for detection and identification of ß-lactamases. J. Gen. Microbiol. 88:169-178.[Medline]
  24. 13
  25. National Committee for Clinical Laboratory Standards. 2000. Performance standards for antimicrobial disk susceptibility tests. Approved standard M2-A7, 7th ed., vol. 20. National Committee for Clinical Laboratory Standards, Wayne, Pa.
  26. 14
  27. Petroni, A., A. Corso, R. Melano, M. L. Cacace, A. M. Bru, A. Rossi, and M. Galas. 2002. Plasmidic extended-spectrum ß-lactamases in Vibrio cholerae O1 El Tor isolates in Argentina. Antimicrob. Agents Chemother. 46:1462-1468.[Abstract/Free Full Text]
  28. 15
  29. Power, P., M. Radice, C. Barberis, C. de Mier, M. Mollerach, M. Maltagliatti, C. Vay, A. Famiglietti, and G. Gutkind. 1999. Cefotaxime-hydrolysing ß-lactamases in Morganella morganii. Eur. J. Clin. Microbiol. Infect. Dis. 18:743-747.[CrossRef][Medline]
  30. 16
  31. Radice, M., C. Gonzalez, P. Power, M. C. Vidal, and G. Gutkind. 2001. Third-generation cephalosporin resistance in Shigella sonnei, Argentina. Emerg. Infect. Dis. 7:442-443.[Medline]
  32. 17
  33. Radice, M., P. Power, J. Di Conza, G. Gutkind, R. Bonnet, D. Sirot, J. Sirot, and R. Labia. 2002. Early dissemination of CTX-M-derived enzymes in South America. Antimicrob. Agents Chemother. 46:602-604.[Free Full Text]
  34. 18
  35. Rossi, A., H. Lopardo, M. Woloj, A. M. Picandet, M. Mariño, M. Galas, M. Radice, and G. Gutkind. 1995. Non-typhoid Salmonella spp resistant to cefotaxime. J. Antimicrob. Chemother. 36:697-702.[Abstract/Free Full Text]
  36. 19
  37. Rossi, A., M. Galas, A. Corso, M. Radice, M. Rivas, M. Caffer, N. Binztein, and G. Gutkind. 1993. Unusual multiresistant Vibrio cholerae O1 var. El Tor in Argentina. Lancet 342:1172-1173.
  38. 20
  39. Sambrook, J., E. F. Fristch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  40. 21
  41. Tzelepi, E., P. Giakkoupi, D. Sofianou, V. Loukova, A. Kemeroglou, and A. Tsakris. 2000. Detection of extended-spectrum ß-lactamases in clinical isolates of Enterobacter cloacae and Enterobacter aerogenes. J. Clin. Microbiol. 38:542-546.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, September 2003, p. 2864-2867, Vol. 47, No. 9
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.9.2864-2867.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Iabadene, H., Dallenne, C., Messai, Y., Geneste, D., Bakour, R., Arlet, G. (2009). Emergence of Extended-Spectrum {beta}-Lactamase PER-1 in Proteus vulgaris and Providencia stuartii Isolates from Algiers, Algeria. Antimicrob. Agents Chemother. 53: 4043-4044 [Full Text]  
  • Hawkey, P. M., Jones, A. M. (2009). The changing epidemiology of resistance. J Antimicrob Chemother 64: i3-i10 [Abstract] [Full Text]  
  • Empel, J., Filczak, K., Mrowka, A., Hryniewicz, W., Livermore, D. M., Gniadkowski, M. (2007). Outbreak of Pseudomonas aeruginosa Infections with PER-1 Extended-Spectrum {beta}-Lactamase in Warsaw, Poland: Further Evidence for an International Clonal Complex. J. Clin. Microbiol. 45: 2829-2834 [Abstract] [Full Text]  
  • Pallecchi, L., Bartoloni, A., Fiorelli, C., Mantella, A., Di Maggio, T., Gamboa, H., Gotuzzo, E., Kronvall, G., Paradisi, F., Rossolini, G. M. (2007). Rapid Dissemination and Diversity of CTX-M Extended-Spectrum {beta}-Lactamase Genes in Commensal Escherichia coli Isolates from Healthy Children from Low-Resource Settings in Latin America. Antimicrob. Agents Chemother. 51: 2720-2725 [Abstract] [Full Text]  
  • Miriagou, V., Tzouvelekis, L. S., Flevari, K., Tsakiri, M., Douzinas, E. E. (2007). Providencia stuartii with VIM-1 metallo-{beta}-lactamase. J Antimicrob Chemother 60: 183-184 [Full Text]  
  • Power, P., Di Conza, J., Rodriguez, M. M., Ghiglione, B., Ayala, J. A., Casellas, J. M., Radice, M., Gutkind, G. (2007). Biochemical Characterization of PER-2 and Genetic Environment of blaPER-2. Antimicrob. Agents Chemother. 51: 2359-2365 [Abstract] [Full Text]  
  • Apfalter, P., Assadian, O., Daxbock, F., Hirschl, A. M., Rotter, M. L., Makristathis, A. (2007). Extended double disc synergy testing reveals a low prevalence of extended-spectrum {beta}-lactamases in Enterobacter spp. in Vienna, Austria. J Antimicrob Chemother 59: 854-859 [Abstract] [Full Text]  
  • Xu, L., Evans, J., Ling, T., Nye, K., Hawkey, P. (2007). Rapid Genotyping of CTX-M Extended-Spectrum {beta}-Lactamases by Denaturing High-Performance Liquid Chromatography. Antimicrob. Agents Chemother. 51: 1446-1454 [Abstract] [Full Text]  
  • Lavigne, J.-P., Marchandin, H., Delmas, J., Moreau, J., Bouziges, N., Lecaillon, E., Cavalie, L., Jean-Pierre, H., Bonnet, R., Sotto, A. (2007). CTX-M {beta}-Lactamase-Producing Escherichia coli in French Hospitals: Prevalence, Molecular Epidemiology, and Risk Factors. J. Clin. Microbiol. 45: 620-626 [Abstract] [Full Text]  
  • Lavigne, J.-P., Marchandin, H., Delmas, J., Bouziges, N., Lecaillon, E., Cavalie, L., Jean-Pierre, H., Bonnet, R., Sotto, A. (2006). qnrA in CTX-M-Producing Escherichia coli Isolates from France. Antimicrob. Agents Chemother. 50: 4224-4228 [Abstract] [Full Text]  
  • Mugnaioli, C., Luzzaro, F., De Luca, F., Brigante, G., Perilli, M., Amicosante, G., Stefani, S., Toniolo, A., Rossolini, G. M. (2006). CTX-M-Type Extended-Spectrum {beta}-Lactamases in Italy: Molecular Epidemiology of an Emerging Countrywide Problem.. Antimicrob. Agents Chemother. 50: 2700-2706 [Abstract] [Full Text]  
  • Celenza, G., Pellegrini, C., Caccamo, M., Segatore, B., Amicosante, G., Perilli, M. (2006). Spread of blaCTX-M-type and blaPER-2 {beta}-lactamase genes in clinical isolates from Bolivian hospitals. J Antimicrob Chemother 57: 975-978 [Abstract] [Full Text]  
  • Aubert, D., Naas, T., Lartigue, M.-F., Nordmann, P. (2005). Novel Genetic Structure Associated with an Extended-Spectrum {beta}-Lactamase blaVEB Gene in a Providencia stuartii Clinical Isolate from Algeria. Antimicrob. Agents Chemother. 49: 3590-3592 [Abstract] [Full Text]  
  • Endimiani, A., Luzzaro, F., Brigante, G., Perilli, M., Lombardi, G., Amicosante, G., Rossolini, G. M., Toniolo, A. (2005). Proteus mirabilis Bloodstream Infections: Risk Factors and Treatment Outcome Related to the Expression of Extended-Spectrum {beta}-Lactamases. Antimicrob. Agents Chemother. 49: 2598-2605 [Abstract] [Full Text]  
  • Di Conza, J. A., Gutkind, G. O., Mollerach, M. E., Ayala, J. A. (2005). Transcriptional Analysis of the blaCTX-M-2 Gene in Salmonella enterica Serovar Infantis. Antimicrob. Agents Chemother. 49: 3014-3017 [Abstract] [Full Text]  
  • Moubareck, C., Daoud, Z., Hakime, N. I., Hamze, M., Mangeney, N., Matta, H., Mokhbat, J. E., Rohban, R., Sarkis, D. K., Doucet-Populaire, F. (2005). Countrywide Spread of Community- and Hospital-Acquired Extended-Spectrum {beta}-Lactamase (CTX-M-15)-Producing Enterobacteriaceae in Lebanon. J. Clin. Microbiol. 43: 3309-3313 [Abstract] [Full Text]  
  • Vignoli, R., Varela, G., Mota, M. I., Cordeiro, N. F., Power, P., Ingold, E., Gadea, P., Sirok, A., Schelotto, F., Ayala, J. A., Gutkind, G. (2005). Enteropathogenic Escherichia coli Strains Carrying Genes Encoding the PER-2 and TEM-116 Extended-Spectrum {beta}-Lactamases Isolated from Children with Diarrhea in Uruguay. J. Clin. Microbiol. 43: 2940-2943 [Abstract] [Full Text]  
  • Ho, P. L., Ho, A. Y. M., Chow, K. H., Wong, R. C. W., Duan, R. S., Ho, W. L., Mak, G. C., Tsang, K. W., Yam, W. C., Yuen, K. Y. (2005). Occurrence and molecular analysis of extended-spectrum {beta}-lactamase-producing Proteus mirabilis in Hong Kong, 1999-2002. J Antimicrob Chemother 55: 840-845 [Abstract] [Full Text]  
  • Poirel, L., Cabanne, L., Vahaboglu, H., Nordmann, P. (2005). Genetic Environment and Expression of the Extended-Spectrum {beta}-Lactamase blaPER-1 Gene in Gram-Negative Bacteria. Antimicrob. Agents Chemother. 49: 1708-1713 [Abstract] [Full Text]  
  • Perilli, M., Mugnaioli, C., Luzzaro, F., Fiore, M., Stefani, S., Rossolini, G. M., Amicosante, G. (2005). Novel TEM-Type Extended-Spectrum {beta}-Lactamase, TEM-134, in a Citrobacter koseri Clinical Isolate. Antimicrob. Agents Chemother. 49: 1564-1566 [Abstract] [Full Text]  
  • Welsh, K. J., Barlow, M., Tenover, F. C., Biddle, J. W., Rasheed, J. K., Clark, L. A., McGowan, J. E. Jr. (2005). Experimental Prediction of the Evolution of Ceftazidime Resistance in the CTX-M-2 Extended-Spectrum Beta-Lactamase. Antimicrob. Agents Chemother. 49: 1242-1244 [Abstract] [Full Text]  
  • Ho, P. L., Shek, R. H. L., Chow, K. H., Duan, R. S., Mak, G. C., Lai, E. L., Yam, W. C., Tsang, K. W., Lai, W. M. (2005). Detection and characterization of extended-spectrum {beta}-lactamases among bloodstream isolates of Enterobacter spp. in Hong Kong, 2000-2002. J Antimicrob Chemother 55: 326-332 [Abstract] [Full Text]  
  • Rodriguez, M. M., Power, P., Radice, M., Vay, C., Famiglietti, A., Galleni, M., Ayala, J. A., Gutkind, G. (2004). Chromosome-Encoded CTX-M-3 from Kluyvera ascorbata: a Possible Origin of Plasmid-Borne CTX-M-1-Derived Cefotaximases. Antimicrob. Agents Chemother. 48: 4895-4897 [Abstract] [Full Text]  
  • Munday, C. J., Whitehead, G. M., Todd, N. J., Campbell, M., Hawkey, P. M. (2004). Predominance and genetic diversity of community- and hospital-acquired CTX-M extended-spectrum {beta}-lactamases in York, UK. J Antimicrob Chemother 54: 628-633 [Abstract] [Full Text]  
  • Pai, H., Hong, J. Y., Byeon, J.-H., Kim, Y.-K., Lee, H.-J. (2004). High Prevalence of Extended-Spectrum {beta}-Lactamase-Producing Strains among Blood Isolates of Enterobacter spp. Collected in a Tertiary Hospital during an 8-Year Period and Their Antimicrobial Susceptibility Patterns. Antimicrob. Agents Chemother. 48: 3159-3161 [Abstract] [Full Text]  
  • Bantar, C., Vesco, E., Heft, C., Salamone, F., Krayeski, M., Gomez, H., Coassolo, M. A., Fiorillo, A., Franco, D., Arango, C., Duret, F., Oliva, M. E. (2004). Replacement of Broad-Spectrum Cephalosporins by Piperacillin-Tazobactam: Impact on Sustained High Rates of Bacterial Resistance. Antimicrob. Agents Chemother. 48: 392-395 [Abstract] [Full Text]  
  • Villegas, M. V., Correa, A., Perez, F., Zuluaga, T., Radice, M., Gutkind, G., Casellas, J. M., Ayala, J., Lolans, K., Quinn, J. P., the Colombian Nosocomial Resistance Study Group,, (2004). CTX-M-12 {beta}-Lactamase in a Klebsiella pneumoniae Clinical Isolate in Colombia. Antimicrob. Agents Chemother. 48: 629-631 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quinteros, M.
Right arrow Articles by Gutkind, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quinteros, M.
Right arrow Articles by Gutkind, G.