AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Depardieu, F.
Right arrow Articles by Courvalin, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Depardieu, F.
Right arrow Articles by Courvalin, P.
Antimicrobial Agents and Chemotherapy, October 2004, p. 3892-3904, Vol. 48, No. 10
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.10.3892-3904.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

VanD-Type Vancomycin-Resistant Enterococcus faecium and Enterococcus faecalis

Florence Depardieu,1 Mathias Kolbert,1,{dagger} Hendrik Pruul,2 Jan Bell,3 and Patrice Courvalin1*

Unité des Agents Antibactériens, Institut Pasteur, Paris, France,1 Flinders Medical Centre, Adelaide,2 Department of Infectious Diseases, Women's and Children's Hospital, North Adelaide, Australia3

Received 24 February 2004/ Returned for modification 19 April 2004/ Accepted 13 May 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Enterococcus faecium clinical isolates A902 and BM4538, which were resistant to relatively high levels of vancomycin (128 and 64 µg/ml, respectively) and to low levels of teicoplanin (4 µg/ml), and Enterococcus faecalis clinical isolates BM4539 and BM4540, which were resistant to moderate levels of vancomycin (16 µg/ml) and susceptible to teicoplanin (0.25 µg/ml), were studied. They were constitutively resistant by synthesis of peptidoglycan precursors ending with D-alanyl-D-lactate and harbored a chromosomal vanD gene cluster which was not transferable by conjugation to other enterococci. VanXD activity, which is not required in the absence of D-Ala-D-Ala, was low in the four strains, although none of the conserved residues was mutated; and the constitutive VanYD activity in the membrane fractions was inhibited by penicillin G. The mutations E13G in the region of D-alanine:D-alanine ligase (which is implicated in D-Ala1 binding in A902) and S319N of the serine involved in ATP binding in BM4538 and a 7-bp insertion at different locations in BM4539 and BM4540 (which led to putative truncated proteins) led to the production of an impaired enzyme and accounted for the lack of D-Ala-D-Ala-containing peptidoglycan precursors. The same 7-bp insertion in vanSD of BM4539 and BM4540 and a 1-bp deletion in vanSD of A902, which in each case led to a putative truncated and presumably nonfunctional protein, could account for the constitutive resistance. Strain BM4538, with a functional VanSD, had a G140E mutation in VanRD that could be responsible for constitutive glycopeptide resistance. This would represent the first example of constitutive van gene expression due to a mutation in the structural gene for a VanR transcriptional activator. Study of these four additional strains that could be distinguished on the basis of their various assortments of mutations confirmed that all VanD-type strains isolated so far have mutations in the ddl housekeeping gene and in the acquired vanSD or vanRD gene that lead to constitutive resistance to vancomycin.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prior to the late 1980s, Enterococcus faecium and Enterococcus faecalis were considered uniformly susceptible to vancomycin, which was often the only antibiotic effective against multiresistant strains. Therefore, reports of vancomycin resistance in enterococci from Europe in 1988 (32, 48) and subsequently from the United States raised considerable concern (19). Since then, vancomycin-resistant enterococci have become increasingly prevalent.

Glycopeptide resistance in enterococci results from the production of modified peptidoglycan precursors ending in D-Ala-D-Lac (VanA, VanB, and VanD) or D-Ala-D-Ser (VanC, VanE, and VanG), to which glycopeptides exhibit low binding affinities, and from the elimination of the high-affinity D-Ala-D-Ala-ending precursors synthesized by the host Ddl ligase (10, 20, 22, 44). Acquired resistance to glycopeptides in the three D-Ala-D-Lac types, VanA, VanB, and VanD, can be classified depending on the levels of resistance to vancomycin and susceptibility or resistance to teicoplanin (10, 22). VanA-type strains display high-level inducible resistance to both vancomycin and teicoplanin, whereas VanB-type strains have various levels of inducible resistance to vancomycin only, since teicoplanin is not an inducer (10). VanD-type strains are characterized by constitutive resistance to moderate levels of both glycopeptides (22).

The organizations of the vanA, vanB, and vanD operons are similar (10, 17). Synthesis of D-Ala-D-Lac requires the presence of a ligase (VanA, VanB, or VanD) of altered specificity compared to that of the host Ddl ligase and of a dehydrogenase (VanH, VanHB, or VanHD) that converts pyruvate to D-Lac (10). The interaction of a glycopeptide with its normal target is prevented by the removal of precursors terminating in D-Ala (43). Two enzymes are involved in this process: a cytoplasmic D,D-dipeptidase (VanX, VanXB, or VanXD) that hydrolyzes the dipeptide D-Ala-D-Ala synthesized by the host Ddl ligase and a membrane-bound D,D-carboxypeptidase (VanY, VanYB, or VanYD) that removes the C-terminal D-Ala residue of late peptidoglycan precursors when elimination of D-Ala-D-Ala by VanX is incomplete (4). The VanYD D,D-carboxypeptidase belongs to the penicillin-binding protein (PBP) family of catalytic serine enzymes, which are susceptible to benzylpenicillin (17), and is distinct from VanY and VanYB, which are penicillin insensitive Zn2+-dependent D,D-carboxypeptidases exhibiting a higher catalytic efficiency for hydrolysis of substrates ending in D-Ala-D-Ala (4). VanZ, which confers teicoplanin resistance by an unknown mechanism, and VanW, with an unknown function, are encoded by the vanA and vanB clusters, respectively, and do not have counterparts in the vanD cluster (7, 23).

Expression of VanA-, VanB-, and VanD-type resistance is regulated by the VanS-VanR two-component signal transduction system, composed of a membrane-bound histidine kinase (VanS, VanSB, or VanSD) and a cytoplasmic response regulator (VanR, VanRB, or VanRD), that acts as a transcriptional activator (9, 23). The genes encoding the two-component regulatory system (vanRS, vanRBSB, or vanRDSD) are present upstream from the structural genes for the resistance proteins (10, 17, 22). The regulatory and resistance genes are transcribed from distinct promoters, promoters PR, PRB, and PRD and promoters PH, PYB, and PYD, respectively, which are coordinately regulated (5, 6, 21, 23, 28).

Although all three types of resistance involve genes encoding related enzymatic functions, they can be distinguished by the locations of the genes and by the various modes of gene expression and regulation. The vanA and vanB operons are located on plasmids or in the chromosome, whereas the vanD operon is exclusively located in the chromosome. All VanD-type clinical isolates recovered until now have been E. faecium and are characterized by constitutively expressed resistance to moderate levels of vancomycin (MIC range, 16 to 256 µg/ml) and teicoplanin (MIC range, 4 to 64 µg/ml), despite the presence of the vanRD and vanSD genes expressed from the PRD promoter (18, 22, 41). In VanD-type strains, the susceptibility pathway is prevented by the absence of an active D-Ala:D-Ala ligase. Consequently, the strains should grow only in the presence of vancomycin since they rely on the inducible resistance pathway for peptidoglycan synthesis. However, this is not the case, since the vanD clusters are expressed constitutively due to mutations in the VanSD sensor (22).

We report on the organization of the vanD gene clusters in E. faecium BM4538 and A902 and in the first VanD-type E. faecalis strains, strains BM4539 and BM4540, and also on the regulation of expression of the resistance genes. We show that, following the occurrence of various mutations, the VanD-type strains have an impaired chromosomal ddl gene that accounts for the lack of precursors terminating in D-Ala-D-Ala. The strains express constitutive vancomycin resistance either because of an impaired VanSD sensor or because of a mutated VanRD regulator. To the best of our knowledge, this is the first example of constitutive glycopeptide resistance due to a mutation in the structural gene for a VanR transcriptional activator.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Strains, plasmids, and growth conditions. The origins and characteristics of the bacterial strains and plasmids used in this study are described in Table 1. E. faecium BM4538 (ddl [G956A] vanRD [G419A]) was isolated in 2001 from blood, and E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) were isolated from rectal swab specimens 2 months later from a patient in Adelaide, South Australia. E. faecium A902 (ddl [A38G] vanSD [{Delta}1bp657]) was isolated at the Beth Israel Deaconess Medical Center, Boston, Mass., in 1993 from the blood of a 61-year-old man with complicated ulcerative colitis (36). Escherichia coli Top10 (Invitrogen, Groningen, The Netherlands) was used as a host for recombinant plasmids. E. faecalis JH2-2 is a derivative of strain JH2 which is resistant to fusidic acid and rifampin (30). Kanamycin (50 µg/ml) was used as a selective agent for cloning of the PCR products into the pCR-Blunt vector (Invitrogen). Spectinomycin (60 µg/ml) or gentamicin (32 µg/ml) was added to the culture media to prevent the loss of plasmids derived from pAT79 (9) or pAT392 (8), respectively. Strains were grown in brain heart infusion (BHI) broth or agar (Difco Laboratories, Detroit, Mich.) at 37°C. The MICs of glycopeptides were determined by the method of Steers et al. (47) with 105 CFU per spot on BHI agar after 24 h of incubation at 37°C.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Strains and plasmids

 
Recombinant DNA techniques. Plasmid DNA isolation, digestion with restriction endonucleases (Amersham Pharmacia Biotech, Little Chalfont, England), amplification of DNA by PCR with Pfu DNA polymerase (Stratagene, La Jolla, Calif.), ligation of DNA fragments with T4 DNA ligase (Amersham Pharmacia Biotech), and transformation of E. coli Top10 with recombinant plasmid DNA were performed by standard methods (11). Total DNA from enterococci was prepared by the method of Le Bouguénec et al. (31).

Plasmid construction. The plasmids were constructed as follows.

(i) Plasmids pAT820 and pAT821. To construct pAT820 (P2 ddlE13G cat) from E. faecium A902 (ddl [A38G] vanSD [{Delta}1bp657]) and pAT821 (P2 ddlS319N cat) from E. faecium BM4538 (ddl [G956A] vanRD [G419A]), the chromosomal ddl gene with its ribosome binding site (RBS) was amplified from total DNA of the corresponding strain by PCR with oligodeoxynucleotides 4147-1 and 4147-2 (17). Primers 4147-1 and 4147-2 contain SacI and XbaI restriction sites, respectively, that allow directional cloning of the ddl gene under the control of the constitutive P2 promoter and upstream from the cat reporter gene of the pAT79 shuttle vector (9). The 1,135-bp insert of the resulting plasmids, pAT820 (P2 ddlE13G cat) and pAT821 (P2 ddlS319N cat), contained the mutated ddl gene with the single E13G mutation or the single S319N mutation, respectively, and their own RBS.

(ii) Plasmid pAT822. For construction of pAT822 [P2 vanSD aac(6')-aph(2'')], the vanSD gene of BM4538 (ddl [G956A] vanRD [G419A]) was amplified with primer pair SDNH2-SDCOOH and BM4538 (ddl [G956A] vanRD [G419A]) total DNA was used as the template (Fig. 1). Oligodeoxynucleotide SDNH2 (5'-GCACGAGCTCTTGAAAGGAGACAGGAGCATGAAAAATAGAAATAGAAATAAAACC) contained a SacI restriction site (italicized), an RBS (underlined), and 27 bases complementary to vanSD from BM4538 (ddl [G956A] vanRD [G419A]) including the ATG translation initiation codon (underlined). Oligodeoxynucleotide SDCOOH (5'-TAACTCTAGATTACGATTTTCCTACGA) harbored an XbaI restriction site (italicized), the stop codon (underlined), and 14 bases complementary to the 3'-end sequence of vanSD. The SacI and XbaI restriction sites allow directional cloning of vanSD upstream from the aac(6')-aph(2'') reporter gene of the shuttle vector pAT392 carrying the P2 promoter to generate pAT822 [P2 vanSD aac(6')-aph(2'')] (Fig. 1). The nucleotide sequences of the amplified fragments were redetermined.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. Schematic representation of the vanD gene cluster from E. faecium strain BM4538 (ddl [G956A] vanRD [G419A]) and a recombinant plasmid. Open arrows represent coding sequences and indicate the direction of transcription. The PCR fragment internal to the vanD gene used as a probe in the hybridization experiments is indicated above the corresponding region. Horizontal bars depict the PCR products corresponding to overlapping amplified fragments from strains A902 (ddl [A38G] vanSD [{Delta}1bp657]), BM4538 (ddl [G956A] vanRD [G419A]), BM4539 (ddl [::7bp870] vanSD [::7bp753]), and BM4540 (ddl [::7bp361] vanSD [::7bp753]). The positions of the 5' ends of the primers complementary to the sequence of reference VanD-type strain BM4339 (ddl [::5bp37] vanSD [C517A]) are in parentheses, with black arrowheads showing the direction of DNA synthesis. Numbering begins at the A residue of the ATG start codon of the vanRD gene from BM4339 (ddl [::5bp37] vanSD [C517A]). The sizes of the PCR products are indicated in boldface digits. The insert in plasmid pAT822 cloned under the control of the P2 promoter is represented by a dashed line, and the vector is indicated in parentheses. For the recombinant plasmid, arrowheads represent the locations and the orientations of the oligodeoxynucleotides used for amplification of the insert.

 
Strain constructions. E. faecium BM4563 and BM4564 were obtained by introduction of DNA from plasmids pAT820 (P2 ddlE13G cat) and pAT821 (P2 ddlS319N cat), respectively, into E. faecium BM4339 (ddl [::5bp37] vanSD [C517A]) (Table 1) by electrotransformation with selection on spectinomycin (120 µg/ml), and the transformants were screened for resistance to chloramphenicol. Plasmid pAT822 [P2 vanSD aac(6')-aph(2'')] DNA was introduced into BM4458 (vanSD [C517A]) or BM4459 (vanSD [C517A]) by electroporation, and transformants BM4565 and BM4566 (Table 1), respectively, were selected on agar containing gentamicin at 128 or 64 µg/ml. Plasmid DNA from chloramphenicol- or gentamicin-resistant clones was digested with EcoRI plus HindIII; and the restriction profiles were compared to those for plasmids pAT820 (P2 ddlE13G cat), pAT821 (P2 ddlS319N cat), and pAT822 [P2 vanSD aac(6')-aph(2'')] purified from E. coli Top10 to screen for DNA rearrangements.

DNA sequencing. Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, Wis.), and the PCR fragments were purified with the microspin columns of the PCR purification kit (Qiagen). Plasmid DNA or PCR products were labeled with a dye-labeled dideoxynucleoside triphosphate Terminator Cycle Sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

Computer analysis of sequence data. Determination of the degrees of identity and similarity with known proteins was carried out with the BLASTN, BLASTX, and BLASTP programs (3) and the FASTA program (39) from the Genetics Computer Group suite of programs.

Contour-clamped homogeneous electric field gel electrophoresis. Genomic DNA embedded in agarose plugs was digested overnight at 27°C with 25 U of SmaI or for 3 h at 37°C with 0.01 U of I-CeuI, an intron-encoded endonuclease specific for rRNA genes (33), and the products were separated on a 0.8% agarose gel with a CHEF-DRIII system (Bio-Rad Laboratories) under the conditions described previously (22). Fragments were hybridized successively as described previously (22) to an {alpha}-32P-labeled 16S rRNA (rrs) probe obtained by amplification of an internal portion of the rrs gene with primers RWO1 and DG74 (27) and to a vanD probe obtained by PCR with primers VanD1 (5'-TAAGGCGCTTGCATATACCG) and VanD2 (5'-TGCAGCCAAGTATCCGGTAA), whose sequences are specific for regions internal to the gene sequence, and with BM4538 (ddl [G956A] vanRD [G419A]) total DNA as the template (Fig. 1).

Analysis of peptidoglycan precursors. Extraction and analysis of peptidoglycan precursors were performed by high-performance liquid chromatography, as described previously (8). Enterococci were grown to the mid-exponential phase (A600 = 1) in BHI medium without or with vancomycin (4 µg/ml). Ramoplanin (3 µg/ml) was added to inhibit peptidoglycan synthesis, and incubation was continued for 15 min to allow accumulation of peptidoglycan precursors.

D,D-Dipeptidase (VanXD) and D,D-carboxypeptidase (VanYD) activities. The enzymatic activities in the supernatant and in the resuspended pellet fraction were assayed as described previously (8). Strains were grown until the optical density at 600 nm reached 0.7 in the absence or presence of vancomycin at 4 µg/ml for BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) or 8 µg/ml for BM4538 (ddl [G956A] vanRD [G419A]) and A902 (ddl [A38G] vanSD [{Delta}1bp657]) and with gentamicin (32 µg/ml) to counterselect for the loss of pAT392 derivatives. The supernatant (S100) and resuspended pellet (C100) were collected and assayed for D,D-peptidase (VanX or VanY) activities by measuring the D-Ala released by substrate hydrolysis (D-Ala-D-Ala [6.56 mM] or L-Ala-D-Glu-L-Lys-D-Ala-D-Ala [5 mM]), as described previously (8).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of E. faecium A902 and BM4538 and E. faecalis BM4539 and BM4540. E. faecium A902 (36) and BM4538 (ddl [G956A] vanRD [G419A]) were resistant to high levels of vancomycin (MICs, 128 and 64 µg/ml, respectively) and to a low level of teicoplanin (MIC, 4 µg/ml), whereas E. faecalis strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) were resistant to a moderate level of vancomycin (MIC, 16 µg/ml) but remained susceptible to teicoplanin (MIC, 0.25 µg/ml) (Table 2). The glycopeptide resistance genotypes of these strains were determined by PCR with primers specific for the vanA, vanB, vanC1, vanC2-vanC3, vanD, vanE, and vanG genes and was found to be vanD. The four strains could be distinguished from the VanD-type E. faecium strains (BM4339, BM4416, and 10/96A) studied previously by pulsed-field gel electrophoresis (PFGE) after digestion with SmaI (Fig. 2). However, the SmaI patterns of the two E. faecalis strains were indistinguishable. The vanD probe hybridized with a 20-kb fragment of strains BM4538 (ddl [G956A] vanRD [G419A]), BM4539 (ddl [::7bp870] vanSD [::7bp753]), and BM4540 (ddl [::7bp361] vanSD [::7bp753]) and with a 35-kb fragment of A902 (ddl [A38G] vanSD [{Delta}1bp657]). These sizes differ from those of the strains studied previously (Fig. 2). As for the other VanD-type strains, repeated attempts to transfer vancomycin resistance from E. faecium strains A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]) to E. faecalis JH2-2 or E. faecium BM4107 by filter mating were unsuccessful. The study of resistance transfer from E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) was not possible, since these strains were resistant to all the selective markers available (rifampin, fusidic acid, streptomycin, and spectinomycin).


View this table:
[in this window]
[in a new window]
 
TABLE 2. MICs of glycopeptides and cytoplasmic peptidoglycan precursors synthesized by VanD-type enterococci

 


View larger version (81K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of SmaI-digested genomic DNA of VanD-type clinical isolates by PFGE (left) and Southern hybridization (right) with a vanD-specific probe. Bacteriophage {lambda} concatemers (lanes {lambda}; Biolabs) were used as molecular size markers, and the sizes are indicated at the left. The sizes of the hybridizing fragments are indicated at the right.

 
Organization of vanD operons. PCR mapping with primers complementary to the vanD operon from E. faecium BM4339 (ddl [::5bp37] vanSD [C517A]) (17) gave fragments with the expected sizes (Table 3), indicating that all the genes constituting the vanD operon were present in the four strains and that their organization was identical to that in BM4339 (ddl [::5bp37] vanSD [C517A]), i.e., two adjacent clusters, one containing the regulatory genes vanRDSD and the other containing the vanYDHDDXD resistance genes (Fig. 1). No large insertions or deletions in the noncoding regions were detected.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Oligodeoxynucleotide used for PCR mapping

 
The deduced amino acid sequences of VanYD, VanD, and VanXD of PCR products obtained with primer pairs VDB-YD1COOH, VDA7-RTX, and VanD1-1-Xd11 (Table 3 and Fig. 1), respectively, from the four strains displayed 79 to 100% identity with the corresponding proteins from the VanD-type strains already described (Tables 4 and 5). The sequences of E. faecium BM4538 (ddl [G956A] vanRD [G419A]) and E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) were identical, although the strains were distinct by PFGE (Fig. 2). The genes for the VanHD dehydrogenase and the VanD D-Ala:D-Lac ligase from E. faecium A902 (ddl [A38G] vanSD [{Delta}1bp657]) have been characterized previously (36).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Percent identities of the proteins deduced from the vanD operon sequence of strain A902 with those deduced from the sequences of other vanD operons

 

View this table:
[in this window]
[in a new window]
 
TABLE 5. Percent identities of the proteins deduced from the vanD operon sequence of strains BM4538, BM4539, and BM4540 with those deduced from the sequences of other vanD operons

 
The structural similarities between the VanHD dehydrogenases, the VanD ligases, and the VanXD D,D-dipeptidases were high (between 83 and 100%). Thus, closely related counterparts of the three enzymes required for VanA- and VanB-type resistance are present in a similar organization in VanD-type strains. The VanXD protein displayed the amino acid motifs YA, DXXR, SXHXXGXAXD, DXM, and EXXH, corresponding to active-site residues that may be involved in Zn2+ binding and catalysis (data not shown) (35). Analysis of the translation product of the vanYD gene indicated that it contained the three motifs SXXK, SG(C/N), and KTG, characteristic of the penicillin-binding domains of PBPs (37) already noted in the other VanD-type strains (22). However, the VanYD D,D-carboxypeptidase of strain A902 (ddl [A38G] vanSD [{Delta}1bp657]) had a higher degree of identity (97%) with the VanYD D,D-carboxypeptidase of strain 10/96A (22) than with those of the other VanD-type strains (from 79 to 81%) (Table 4).

The deduced sequences from the vanRD and vanSD PCR products obtained with primer pairs RDNH2-S/R2 and RD4-1-Sd1 (Table 3), respectively, and from the total DNA of the VanD-type strains studied exhibited structural similarity with the VanRD response regulators and VanSD histidine protein kinases, respectively, of the strains characterized previously (15, 17, 22). The conserved aspartate and lysine residues (D10, D53, and K102) typical of response regulators in two-component systems from gram-positive bacteria were present in VanRD. The hydropathy profile of the N-terminal putative sensor domain of VanSD revealed the presence of two stretches of hydrophobic amino acids similar to those in VanS, VanSB, and EnvZ, suggesting similar topologies for these enzymes (data not shown).

The vanD gene cluster is chromosomally located. The location of the vanD gene cluster was determined by PFGE after digestion of genomic DNA with I-CeuI, an endonuclease specific for rRNA genes (33). The DNA fragments were transferred to a nitrocellulose membrane; and following two successive hybridizations with rrs (16S rRNA) and vanD probes, the vanD gene cluster was assigned to a chromosomal fragment of ca. 410 kb in strains A902 (ddl [A38G] vanSD [{Delta}1bp657]), BM4539 (ddl [::7bp870] vanSD [::7bp753]), and BM4540 (ddl [::7bp361] vanSD [::7bp753]) and 390 kb in BM4538 (ddl [G956A] vanRD [G419A]) (data not shown). This analysis also confirmed that the VanD-type isolates were distinct from the previously studied VanD-type strains (22). Although strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) were distinct (see below), they were indistinguishable following analysis by SmaI (Fig. 2) and I-CeuI digestion (data not shown).

Characterization of peptidoglycan precursors. To analyze the cytoplasmic peptidoglycan precursors, cultures in the absence or in the presence of vancomycin (4 µg/ml) were incubated with ramoplanin to inhibit cell wall synthesis after formation of the precursors. The results showed that, whether in the absence (Table 2) or in the presence of vancomycin, UDP-MurNAc-pentadepsipeptide (Lac) was the main precursor. In addition to the pentadepsipeptide, UDP-MurNAc-tetrapeptide was present (26 to 30% in the E. faecium strains and 3 to 4% in the E. faecalis strains) (Table 2). Since the D-Ala:D-Ala ligases of these strains are inactive (Fig. 3), little, if any, UDP-MurNAc-pentapeptide should be present; therefore, the tetrapeptide is likely to result from the removal of D-lactate from UDP-MurNAc-pentadepsipeptide. PBPs that function as D,D-carboxypeptidases hydrolyze esters, in addition to peptides (42). It is thus presumed that the VanYD enzymes which are PBPs and whose activities were inhibited by low concentrations of benzylpenicillin (data not shown) should hydrolyze UDP-MurNAc-pentadepsipeptide with the production of tetrapeptide. Taken together, these data indicate that the strains were constitutively resistant to vancomycin by the production of precursors ending in D-Ala-D-Lac and therefore exclusively used the resistance pathway. The small amount of pentapeptide could have been synthesized by the VanD ligase, as has already been shown for the VanA ligase (16). For E. faecalis strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]), the presence of tripeptide (Table 2) could mean that the VanD ligase is not active enough to synthesize D-Ala-D-Lac as rapidly as the tripeptide is produced.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. Schematic representation of the genes for D-Ala:D-Ala ligases of enterococci. The positions of the amino acids implicated in the binding of D-Ala1, D-Ala2, and ATP and conserved in E. faecium and E. faecalis are indicated by dotted, hatched, and black bars, respectively (25, 46). In E. faecium strains A902 (ddl [A38G] vanSD[{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]), the single-base differences relative to the sequence of ddl from E. faecium BM4147, which lead to a Glu-to-Gly substitution at position 13 and a Ser-to-Asn substitution at position 319, respectively, are indicated in italics. In E. faecalis strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]), a 7-bp insertion (italics) at the positions corresponding to amino acids 290 and 121, respectively, is responsible for a frameshift mutation that leads to the synthesis of 297- and 128-amino-acid peptides instead of the putative 348-amino acid Ddl.

 
VanD-type strains produce a nonfunctional D-Ala:D-Ala ligase. To elucidate the strategy adopted by the four strains to prevent the synthesis of peptidoglycan by the susceptible chromosomal pathway, the chromosomal ddl gene for the D-Ala:D-Ala ligase was amplified and three independent PCR products with the expected length of 1,154 bp for ddl of E. faecium or 1,063 bp for ddl of E. faecalis were sequenced. Comparative analysis revealed point mutations in codons 13 and 319 of A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]), respectively, relative to the ddl sequence of E. faecium BM4147 (26), resulting in a Glu-to-Gly or a Ser-to-Asn substitution located at positions involved in the binding of D-Ala1 and ATP, respectively, and presumably leading to a nonfunctional protein (Fig. 3). In BM4339 (ddl [::5bp37] vanSD [C517A]), a 5-bp insertion occurred precisely at the same position where strain A902 (ddl [A38G] vanSD [{Delta}1bp657]) had the E13G substitution. Strain BM4339 (ddl [::5bp37] vanSD [C517A]) has an impaired Ddl, and introduction of an intact ddl gene under the control of a constitutive promoter restores its susceptibility to glycopeptides (17). The decrease in glycopeptide resistance is due to production of the heterologous Ddl enzyme, since BM4339 (ddl [::5bp37] vanSD [C517A]) possesses only very weak VanX D,D-dipeptidase activity (41). To test if the E13G and S319N mutations were responsible for the impairment of Ddl, plasmid pAT820 containing the ddlE13G gene from A902 (ddl [A38G] vanSD [{Delta}1bp657]) and plasmid pAT821 containing the ddlS319N gene from BM4538 (ddl [G956A] vanRD [G419A]) and their RBSs cloned under the control of the constitutive P2 promoter were electrotransformed into BM4339 (ddl [::5bp37] vanSD [C517A]) (Table 1). The resulting transformants, BM4563 and BM4564, respectively, remained vancomycin resistant, confirming that the D-Ala:D-Ala ligase from A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]) were not functional.

E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) are also presumed to lack D-Ala:D-Ala ligase activity as the result of insertions at different loci in the chromosomal ddl gene, leading to putative truncated proteins of various sizes (Fig. 3) in comparison with that of 348 amino acids from E. faecalis V583 (24). In BM4539 (ddl [::7bp870] vanSD [::7bp753]), a 7-bp insertion (GAAGTGG) near the 3' end of the ddl gene is responsible for a frameshift mutation that leads to the synthesis of a 297-amino-acid putative truncated ligase, whereas in BM4540 (ddl [::7bp361] vanSD [::7bp753]), inactivation of the gene is due to a 7-bp insertion (GTGGGGC) toward the 5' end of the ddl gene, resulting in the synthesis of a 128-amino-acid protein (Fig. 3). Sequence analysis indicated that, in both cases, the insertion resulted from duplication of the previous 7 bp, leading to two tandemly arranged heptanucleotide direct repeats. Although their SmaI patterns were similar, strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) differed on the basis of their D-Ala:D-Ala ligase sequences. Thus, in the four VanD-type strains studied, as in the previously reported VanD-type strains, production of an impaired Ddl accounts for the lack of peptidoglycan precursors terminating in D-Ala-D-Ala (Table 2).

Mutations in VanSD sensors of strains A902, BM4539, and BM4540 and VanRD regulator of BM4538. Mutants with an impaired D-Ala:D-Ala ligase require vancomycin for growth since D-Ala-D-Lac is produced only under inducing conditions. However, this is not the case for the VanD-type strains studied previously, which express the vanD cluster constitutively. Alignment of the sequences of the VanSD sensors revealed in BM4339 (ddl [::5bp37] vanSD [C517A]) a point mutation (P173S) in a critical region near the putative autophosphorylation site of VanSD (22), in BM4416 a 1-bp deletion that resulted in a frameshift mutation (15), and in 10/96A insertion of ISEfa4 (22); these mutations result in constitutive expression of the resistance genes.

Comparison of the vanSD genes from BM4339 (ddl [::5bp37] vanSD [C517A]) (17) and A902 (ddl [A38G] vanSD [{Delta}1bp657]) revealed that the latter strain had a 1-bp deletion at position 660 which resulted in a frame shift that presumably led to a putative truncated and nonfunctional protein of 233 amino acids instead of 381 amino acids in BM4339 (ddl [::5bp37] vanSD [C517A]) (Fig. 4). In E. faecalis strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540(ddl [::7bp361] vanSD [::7bp753]), the same 7-bp duplication (CTGGCCG) in vanSD at position 753 resulted in a frame shift and, consequently, to a putative truncated protein of 258 amino acids (Fig. 4). In wild-type VanSD, five blocks (H, N, G1, F, and G2) of the kinase domain are highly conserved. The histidine residue of VanSD, which is the putative site of autophosphorylation of the sensor, in strains A902 (ddl [A38G] vanSD [{Delta}1bp657]), BM4538 (ddl [G956A] vanRD [G419A]), BM4539 (ddl [::7bp870] vanSD [::7bp753]), and BM4540 (ddl [::7bp361] vanSD [::7bp753]) was aligned with that at position 166 of the previously reported VanD-type strains (Fig. 4) (22). The H block is responsible for both autophosphorylation and kinase and phosphatase activities, and G1 and G2 correspond to ATP binding blocks. Only the H autophosphorylation site was present in A902 (ddl [A38G] vanSD [{Delta}1bp657]), BM4539 (ddl [::7bp870] vanSD [::7bp753]), and BM4540 (ddl [::7bp361] vanSD [::7bp753]) (Fig. 4). Production of VanSD putative truncated sensors in these three VanD-type strains may lead to a high steady-state level of phosphorylated VanRD and could thus account for the constitutive expression of the vanD operon in these strains.



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 4. Alignment of the deduced amino acid sequences of VanSD sensors. Numbers at the left refer to the first amino acid in the corresponding sequence. Numbers at the right refer to the last amino acid in the corresponding line. Identical amino acids are indicated by asterisks below the alignment, and the isofunctional amino acids are indicated by dots below the alignment. Conserved motifs H, N, G1, F, and G2 are indicated above the alignment with dashed lines (38). The histidine residue in boldface is the putative autophosphorylation site. The proline at position 173, putatively responsible for constitutive expression of resistance in BM4339, is indicated in italics and boldface. The truncated amino acid sequences of VanSD from A902 (ddl [A38G] vanSD [{Delta}1bp657]), BM4539 (ddl [::7bp870] vanSD [::7bp753]), and BM4540 (ddl [::7bp361] vanSD [::7bp753]) lack the four conserved blocks (N, G1, F, and G2).

 
The sequence of the vanSD gene of BM4538 (ddl [G956A] vanRD [G419A]) did not show any mutation, and the C-terminal portion of the enzyme contained the five blocks of conserved amino acids (H, N, G1, F, and G2) characteristic of transmitter modules in histidine protein kinases (Fig. 4). However, the vanRD sequence revealed a point mutation (G140E) in comparison with the sequences of the other Van-type strains, leading to a Gly-to-Glu substitution (Fig. 5). The conserved aspartate and lysine residues (D10, D53, and K102) typical of response regulators in two-component systems were present in BM4538 (ddl [G956A] vanRD [G419A]). Sequence analysis indicated that the G140E mutation occurred near the ß2 sheet of the effector domain of the regulator. The G amino acid, which is conserved in the VanR regulators, is adjacent to a residue involved in the hydrophobic core of VanR transcriptional activators as well as in the other regulators of the same family, such as PhoB and OmpR of E. coli (Fig. 5).



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 5. Alignment of the deduced amino acid sequences of the effector domains of various VanR-type regulators with those of E. coli PhoB and OmpR regulators. Numbering refers to the amino acid sequence of VanRD. PhoB consists of 229 residues in two functional domains: a 124-amino-acid N-terminal receiver domain and a 99-amino-acid C-terminal effector domain with DNA binding and transactivation functions (14). Fully conserved residues are highlighted in gray, and residues belonging to the PhoB hydrophobic core are underlined. PhoB residues implicated in DNA binding and protein-protein interaction are indicated by black circles and asterisks, respectively. The glycine (G) which is conserved in the VanR-type regulators and in the regulators of the same family, such as PhoB and OmpR of E. coli, is boxed. The glutamate (E) at position 140 (numbering of VanRD), indicated in boldface and italics, corresponds to the mutation in E. faecium BM4538 (ddl [G956A] vanRD [G419A]).

 
D,D-peptidase activities. Regulation of resistance gene expression was studied by analysis of the VanXD D,D-dipeptidase and the VanYD D,D-carboxypeptidase activities. These were assayed by determining the amount of D-Ala released from hydrolysis of the D-Ala-D-Ala dipeptide and the L-Ala-{gamma}-D-Glu-L-Lys-D-Ala-D-Ala pentapeptide, respectively (Table 6). Determination of the specific activity of D,D-dipeptidase provides a direct estimate of the capacity of a strain to hydrolyze D-Ala-D-Ala and also an indirect estimate of the synthesis of D-Ala-D-Lac because the resistance genes are coregulated at the transcriptional level (6, 8). The D,D-dipeptidase activity was measured in the supernatant of lysed bacteria, obtained by centrifugation at 100,000 x g, that had been grown in the absence or in the presence of 4 or 8 µg of vancomycin per ml as an inducer. As in BM4339 (ddl [::5bp37] vanSD [C517A]) (41) and 10/96A (22), weak D,D-dipeptidase activity (VanXD) was found in the cytoplasmic extracts from induced or uninduced E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) (Table 6). Since these strains do not produce D-Ala-D-Ala-containing peptidoglycan precursors following mutations in the chromosomal ddl gene, no D,D-dipeptidase activity is required for glycopeptide resistance in this genetic background. In A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]), the D,D-dipeptidase was constitutively synthesized at moderate levels, similar to those in BM4416 (40).


View this table:
[in this window]
[in a new window]
 
TABLE 6. D,D-Peptidase activities in extracts from E. faecium A902 and BM4538 and E. faecalis BM4539 and BM4540

 
In E. faecium A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]), the specific activities of the D,D-carboxypeptidase in cytoplasmic fractions were significantly lower than those in membrane extracts, whereas in the E. faecalis strains these activities were very low and were similar in the cytoplasmic and membrane fractions (Table 6). As in the VanD-type strains studied previously, D,D-carboxypeptidase activities were inhibited by low concentrations of benzylpenicillin (100 µg/ml), since VanYD belongs to the PBP family of catalytic serine enzymes, which are susceptible to benzylpenicillin.

Study of VanSD sensor functionality. To test if the vanSD gene of BM4538 (ddl [G956A] vanRD [G419A]) was functional, plasmid pAT822 [P2 vanSD aac(6')-aph(2'')] containing vanSD and an RBS cloned under the control of the constitutive P2 promoter (Fig. 1) was electrotransformed into E. faecium BM4458 (vanSD [C517A]) and BM4459 (vanSD [C517A]) (Table 1), both of which possess a functional Ddl at different locations in the chromosome but an impaired VanSD. The consequence of the presence of VanSD from BM4538 (ddl [G956A] vanRD [G419A]) in BM4565 [P2 vanSD aac(6')-aph(2'')] and BM4566 [P2 vanSD aac(6')-aph(2'')] on the metabolism of peptidoglycan precursors was analyzed by estimating the relative levels of the addition of D-Ala-D-Ala and D-Ala-D-Lac to UDP-MurNAc-L-Ala-{gamma}-D-Glu-L-Lys precursors (Fig. 6A). Regulation of expression of the resistance genes was also studied by determining the VanYD D,D-carboxypeptidase activity in membrane extracts from bacteria grown in the absence or the presence of vancomycin (Fig. 6B). Introduction of plasmid pAT392 [P2 aac(6')-aph(2'')] as a control into BM4458 (vanSD [C517A]) and BM4459 (vanSD [C517A]) did not modify the regulation of vanYD expression or the relative proportions of peptidoglycan precursors (Fig. 6). When E. faecium BM4565 [P2 vanSD aac(6')-aph(2'')] and BM4566 [P2 vanSD aac(6')-aph(2'')] (Table 1) were grown in the absence of vancomycin, UDP-MurNAc-pentapeptide was the major precursor synthesized, whereas after incubation with vancomycin (2 µg/ml), UDP-MurNAc-pentadepsipeptide became the major compound produced, to the detriment of UDP-MurNAc-pentapeptide (Fig. 6A). It therefore appears that production of VanSD from BM4538 (ddl [G956A] vanRD [G419A]) in BM4565 [P2 vanSD aac(6')-aph(2'')] and BM4566 [P2 vanSD aac(6')-aph(2'')] restored the inducible expression of the resistance genes, as indicated by the inducibility of D,D-carboxypeptidase activity (Fig. 6B), indicating that the VanSD sensor from BM4538 (ddl [G956A] vanRD [G419A]) was functional. Induction by vancomycin led to the transcription of vanYD at a level similar to that in wild-type strain BM4339 (ddl [::5bp37] vanSD [C517A]) in the absence or in the presence of vancomycin (Fig. 6B). Thus, VanSD of BM4538 (ddl [G956A] vanRD [G419A]) presumably acted as a phosphatase under noninducing conditions and as a kinase under inducing conditions.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 6. Proportions of late soluble cytoplasmic peptidoglycan precursors (A) and VanYD D,D-carboxypeptidase specific activity in membrane extracts (B) from BM4339 (ddl [::5bp37] vanSD [C517A]) and derivatives of BM4458 (vanSD [C517A]) and BM4459 (vanSD [C517A]). The strains studied and the pAT392 [P2 aac(6')-aph(2'')] and pAT822 [P2 vanSD aac(6')-aph(2'')] plasmids used for transformation are indicated at the bottoms of the charts. Induction was performed with 2 µg of vancomycin per ml. The levels of resistance to vancomycin (Vm) and teicoplanin (Te) are indicated under the panel displaying the peptidoglycan precursors. Specific activity was defined as the number of nanomoles of product formed at 37°C per minute per milligram of protein contained in the extracts.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
VanD-type resistance to glycopeptides is conferred on E. faecium A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]) and E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) by the chromosomal vanD gene cluster, which includes seven open reading frames (Fig. 1). As in the previously described VanD-type clinical isolates, the 5' portion of the operon contains the vanRD and vanSD genes, which encode a two-component regulatory system, and the 3' portions of the vanHD, vanD, and vanXD resistance genes, which encode a dehydrogenase, a D-Ala:D-Lac ligase, and a D,D-dipeptidase, respectively, that are homologous to the corresponding enzymes in VanA- and VanB-type strains (10). In contrast, the VanYD D,D-carboxypeptidase is related to PBPs and thus differs from VanY and VanYB, which are penicillin-insensitive Zn2+-dependent enzymes (4, 22). VanD-type strains share additional characteristics that distinguish them from other types of enterococci that are also resistant to glycopeptides by synthesis of late peptidoglycan precursors ending in D-Ala-D-Lac (10). In particular, resistance is expressed constitutively and is not transferable by conjugation.

When compared with the VanA- and VanB-type strains, the VanD-type isolates have negligible VanXD D,D-dipeptidase activities (Table 6), despite the presence in the enzymes of the critical residues implicated in the binding of Zn2+ and catalysis (35). A lack of VanXD activity should result in glycopeptide susceptibility, since removal of the quasitotality of peptidoglycan precursors ending in D-Ala-D-Ala, the target for glycopeptides, is required for resistance (8). However, following the occurrence of different mutations in the chromosomal ddl gene in all the strains studied (Fig. 3), the bacteria have an impaired D-Ala:D-Ala ligase, and thus, the majority of peptidoglycan precursors that they produce terminate in D-Lac (Table 2). Enterococci that have an impaired D-Ala:D-Ala ligase and that harbor a vancomycin resistance cluster can grow only in the presence of vancomycin, since this antibiotic is required for induction of the resistance genes, with the strains relying for growth entirely on the synthesis of peptidoglycan precursors containing D-Ala-D-Lac instead of D-Ala-D-Ala (5, 13, 45, 49). In the VanD-type strains studied, there were no quantitative differences between the peptidoglycan precursors (Table 2) and the VanXD and VanYD activities (Table 6) produced by uninduced or induced cells, indicating that the vanD clusters were expressed constitutively, thus bypassing the requirement for glycopeptides.

The VanS sensors act primarily as a phosphatase under noninducing conditions and as a kinase in the presence of glycopeptides, leading to phosphorylation of the response regulator and activation of the resistance genes (5, 6, 21, 29). A constitutive phenotype is associated with the loss of the phosphatase activity of the sensor, and expression of the resistance genes remains unaltered under noninducing or inducing conditions (2, 6, 13, 21, 50). Alignment of the deduced amino acid sequences of the VanSD sensors from E. faecium A902 (ddl [A38G] vanSD [{Delta}1bp657]) and BM4538 (ddl [G956A] vanRD [G419A]) and E. faecalis BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) with those of other VanD-type strains (22) revealed that various types of mutations are associated with constitutive expression of the resistance genes (Fig. 4). Strain A902 (ddl [A38G] vanSD [{Delta}1bp657]) had a 1-bp deletion that led to a putative truncated enzyme, and strains BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) contained an identical 7-bp tandem duplication that resulted in a frameshift mutation and the synthesis of a shorter protein that retained only the autophosphorylation site (H). In these three strains, the other blocks (N, G1, F, and G2) conserved in the kinase domain of the sensors were absent, strongly suggesting the loss of phosphatase activity. This is in agreement with reports indicating that the G2 block could play a role in the modulation of enzyme conformation (38) and that the G2 box of VanSB (21), as well as that of EnvZ and its surrounding residues (52), plays an important role in modulating phosphatase activity.

In tandem duplications, a stretch of DNA is converted into two contiguous copies (1). This was the case for the 7-bp insertions at different loci in the ddl gene of BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) (Fig. 3) and at the same locus in vanSD of both BM4539 (ddl [::7bp870] vanSD [::7bp753]) and BM4540 (ddl [::7bp361] vanSD [::7bp753]) (Fig. 4). Sometimes, a tandem repeat can be an approximate copy of a pattern of nucleotides, as observed in the case of the 7-bp insertion (GTGGGGC instead of GTGGGC) in the ddl gene of strain BM4540 (ddl [::7bp361] vanSD [::7bp753]) (Fig. 3). Processes such as an unequal crossing over during recombination and strand slippage during replication have been invoked as potential mechanisms both for the generation of these tandem arrays and for the variability that is sometimes associated with these sequences (1).

The VanR proteins belong to the family of OmpR regulators (9). By analogy with OmpR, VanR consists of an amino-terminal phosphorylation (receiver) domain and a carboxy-terminal DNA-binding (effector) domain which are joined by a flexible linker region that is relatively rich in glutamine, arginine, glutamate, serine, and proline residues (34). The role of this region is to allow functional interactions to occur. Phosphorylation of the receiver domain results in an increase in affinity for specific DNA regions, leading to the regulation of gene expression (29, 51). Mutation G140E in the VanRD regulator of BM4538 (ddl [G956A] vanRD [G419A]) occurred in the effector domain close to the linker region and next to an amino acid belonging to the hydrophobic core just before the ß2 sheet, according to the model of PhoB (Fig. 5) (14). Mutants in the linker region of OmpR differ in their phosphorylation and DNA-binding properties, leading to various phenotypes (34). Moreover, analysis of the crystal structure of NarL indicated that the glycine at position 126 belonging to the C-terminal domain is a candidate hinge site (51). Glycine 140 of VanRD could correspond to glycine 126 of NarL and thus could represent a crucial residue. Usually, the receiver domain appears to block the site of DNA binding in the nonphosphorylated state, whereas it has been proposed that phosphorylation disrupts this interaction, causing the effector domain to be released and to be free to bind to DNA (12). Consequently, the mutation in VanRD of BM4538 (ddl [G956A] vanRD [G419A]) could result in an effector domain in a state such that it always binds to DNA, leading to the constitutive resistance of this strain. Complementation of a VanD-type E. faecium strain with a functional Ddl and an impaired VanSD with the vanSD gene of BM4538 (ddl [G956A] vanRD [G419A]) conferred inducible vancomycin resistance to the host (Fig. 6), indicating that the sensor was functional. Thus, VanSD of BM4538 (ddl [G956A] vanRD [G419A]) acted as a phosphatase under noninducing conditions and prevented the activation of VanRD by a heterologous kinase. The negative control mediated by VanSD was suppressed by vancomycin, leading to induction by this antibiotic, compatible with the fact that VanSD may act as a kinase under inducing conditions.

An unusual feature of the VanD-type strains is their only slightly diminished susceptibilities to teicoplanin (MIC = 4 µg/ml), despite the constitutive production of peptidoglycan precursors that terminate in D-Ala-D-Lac. As the D-Ala:D-Ala ligase is inactive, we would have expected only pentadepsipeptides to be made and a high level of resistance to teicoplanin to result, although the VanD ligase might be able to synthesize some pentapeptide. We do not have an explanation at present for the low degrees of resistance of E. faecium and E. faecalis to teicoplanin, despite the virtual absence of pentapeptides. It is possible that the action of teicoplanin is multifactorial, in view of its hydrophobic substituent, and that its activity is not simply dependent on binding to substrates containing the acyl-D-Ala-D-Ala moiety.

This study of four additional VanD-type strains confirmed that all VanD-type strains isolated so far share unusual characteristics. Following various combinations of mutations, all strains possess an impaired ddl gene that leads to the lack of D-Ala-D-Ala-containing peptidoglycan precursors and express constitutive vancomycin resistance secondary to an insertion or a deletion in the VanSD sensor or a point mutation in the VanRD regulator. To the best of our knowledge, this is the first report of a mutation in the structural gene for a VanR transcriptional activator that could be responsible for constitutive resistance. Taken together, these results suggest that the mutation in the sensor or in the regulator was acquired before that in the Ddl ligase since, otherwise, the strain would have been transiently glycopeptide dependent. This hypothesis is consistent with the observation that the two VanD-type E. faecalis strains studied harbor identical vanD operons but differ in the mutations in their D-Ala:D-Ala ligases. A selective pressure for such successive mutations could be the weakness of VanXD D,D-dipeptidase, an activity mandatory to achieve resistance. Bacteria that constantly activate the vanD operon by mutation in the two-component regulatory system and that eliminate the susceptible pathway by inactivation of the Ddl ligase do not require VanXD activity. Whatever the actual sequence of mutational events may be, VanD-type strains provide a remarkable example of tinkering with both intrinsic and acquired genes to achieve higher levels of antibiotic resistance.


    ACKNOWLEDGMENTS
 
We thank R. C. Moellering for the gift of strain A902 and P. Reynolds for helpful discussions.


    FOOTNOTES
 
* Corresponding author. Mailing address: Unité des Agents Antibactériens, Institut Pasteur, 25, rue du Docteur Roux, 75724 Paris Cedex 15, France. Phone: (33) (1) 45 68 83 21. Fax: (33) (1) 45 68 83 19. E-mail: pcourval{at}pasteur.fr. Back

{dagger} Present address: Mathias Kolbert, Bioscientia, 55218 Ingelheim, Germany. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Achaz, G., E. P. Rocha, P. Netter, and E. Coissac. 2002. Origin and fate of repeats in bacteria. Nucleic Acids Res. 30:2987-2994.[Abstract/Free Full Text]
  2. Aiba, H., F. Nakasai, S. Mizushima, and T. Mizuno. 1989. Evidence for the physiological importance of the phosphotransfer between the two regulatory components, EnvZ and OmpR, in osmoregulation in Escherichia coli. J. Biol. Chem. 264:14090-14094.[Abstract/Free Full Text]
  3. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  4. Arthur, M., F. Depardieu, L. Cabanié, P. Reynolds, and P. Courvalin. 1998. Requirement of the VanY and VanX D,D-peptidases for glycopeptide resistance in enterococci. Mol. Microbiol. 30:819-830.[CrossRef][Medline]
  5. Arthur, M., F. Depardieu, and P. Courvalin. 1999. Regulated interactions between partner and non partner sensors and responses regulators that control glycopeptide resistance gene expression in enterococci. Microbiology 145:1849-1858.[Abstract]
  6. Arthur, M., F. Depardieu, G. Gerbaud, M. Galimand, R. Leclercq, and P. Courvalin. 1997. The VanS sensor negatively controls VanR-mediated transcriptional activation of glycopeptide resistance genes of Tn1546 and related elements in the absence of induction. J. Bacteriol. 179:97-106.[Abstract/Free Full Text]
  7. Arthur, M., F. Depardieu, C. Molinas, P. Reynolds, and P. Courvalin. 1995. The vanZ gene of Tn1546 from Enterococcus faecium BM4147 confers resistance to teicoplanin. Gene 154:87-92.[CrossRef][Medline]
  8. Arthur, M., F. Depardieu, P. Reynolds, and P. Courvalin. 1996. Quantitative analysis of the metabolism of soluble cytoplasmic peptidoglycan precursors of glycopeptide-resistant enterococci. Mol. Microbiol. 21:33-44.[CrossRef][Medline]
  9. Arthur, M., C. Molinas, and P. Courvalin. 1992. The VanS-VanR two-component regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J. Bacteriol. 174:2582-2591.[Abstract/Free Full Text]
  10. Arthur, M., P. Reynolds, and P. Courvalin. 1996. Glycopeptide resistance in enterococci. Trends Microbiol. 4:401-407.[CrossRef][Medline]
  11. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
  12. Baikalov, I., I. Schroder, M. Kaczor-Grzeskowiak, K. Grzeskowiak, R. P. Gunsalus, and R. E. Dickerson. 1996. Structure of the Escherichia coli response regulator NarL. Biochemistry 35:11053-11061.[CrossRef][Medline]
  13. Baptista, M., F. Depardieu, P. Reynolds, P. Courvalin, and M. Arthur. 1997. Mutations leading to increased levels of resistance to glycopeptide antibiotics in VanB-type enterococci. Mol. Microbiol. 25:93-105.[CrossRef][Medline]
  14. Blanco, A. G., M. Sola, F. X. Gomis-Ruth, and M. Coll. 2002. Tandem DNA recognition by PhoB, a two-component signal transduction transcriptional activator. Structure (Cambridge) 10:701-713.
  15. Boyd, D. A., J. Conly, H. Dedier, G. Peters, L. Robertson, E. Slater, and M. R. Mulvey. 2000. Molecular characterization of the vanD gene cluster and a novel insertion element in a vancomycin-resistant enterococcus isolated in Canada. J. Clin. Microbiol. 38:2392-2394.[Abstract/Free Full Text]
  16. Bugg, T. D. H., G. D. Wright, S. Dutka-Malen, M. Arthur, P. Courvalin, and C. T. Walsh. 1991. Molecular basis for vancomycin resistance in Enterococcus faecium BM4147: biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance proteins VanH and VanA. Biochemistry 30:10408-10415.[CrossRef][Medline]
  17. Casadewall, B., and P. Courvalin. 1999. Characterization of the vanD glycopeptide resistance gene cluster from Enterococcus faecium BM4339. J. Bacteriol. 181:3644-3648.[Abstract/Free Full Text]
  18. Casadewall, B., P. E. Reynolds, and P. Courvalin. 2001. Regulation of expression of the vanD glycopeptide resistance gene cluster from Enterococcus faecium BM4339. J. Bacteriol. 183:3436-3446.[Abstract/Free Full Text]
  19. Centers for Disease Control and Prevention. 1993. Nosocomial enterococci resistant to vancomycin. United States. 1989-1993. Morb. Mortal. Wkly. Rep. 42:597-599.[Medline]
  20. Depardieu, F., M. G. Bonora, P. E. Reynolds, and P. Courvalin. 2003. The vanG glycopeptide resistance operon from Enterococcus faecalis revisited. Mol. Microbiol. 50:931-948.[CrossRef][Medline]
  21. Depardieu, F., P. Courvalin, and T. Msadek. 2003. A six amino acid deletion, partially overlapping the VanSB G2 ATP-binding motif, leads to constitutive glycopeptide resistance in VanB-type Enterococcus faecium. Mol. Microbiol. 50:1069-1083.[CrossRef][Medline]
  22. Depardieu, F., P. E. Reynolds, and P. Courvalin. 2003. VanD-type vancomycin-resistant Enterococcus faecium 10/96A. Antimicrob. Agents Chemother. 47:7-18.[Abstract/Free Full Text]
  23. Evers, S., and P. Courvalin. 1996. Regulation of VanB-type vancomycin resistance gene expression by the VanSB-VanRB two-component regulatory system in Enterococcus faecalis V583. J. Bacteriol. 178:1302-1309.[Abstract/Free Full Text]
  24. Evers, S., P. E. Reynolds, and P. Courvalin. 1994. Sequence of the vanB and ddl genes encoding D-alanine:D-lactate and D-alanine:D-alanine ligases in vancomycin-resistant Enterococcus faecalis V583. Gene 140:97-102.[CrossRef][Medline]
  25. Fan, C., P. C. Moews, C. T. Walsh, and J. R. Knox. 1994. Vancomycin resistance: structure of D-alanine:D-alanine ligase at 2.3 Å resolution. Science 266:439-443.[Abstract/Free Full Text]
  26. Gholizadeh, Y., M. Prevost, F. Van Bambeke, B. Casadewall, P. M. Tulkens, and P. Courvalin. 2001. Sequencing of the ddl gene and modeling of the mutated D-alanine:D-alanine ligase in glycopeptide-dependent strains of Enterococcus faecium. Protein Sci. 10:836-844.[Abstract/Free Full Text]
  27. Greisen, K., M. Loeffelholz, A. Purohit, and D. Leong. 1994. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J. Clin. Microbiol. 32:335-351.[Abstract/Free Full Text]
  28. Haldimann, A., S. L. Fisher, L. L. Daniels, C. T. Walsh, and B. L. Wanner. 1997. Transcriptional regulation of the Enterococcus faecium BM4147 vancomycin resistance gene cluster by the VanS-VanR two-component regulatory system in Escherichia coli K-12. J. Bacteriol. 179:5903-5913.[Abstract/Free Full Text]
  29. Holman, T. R., Z. Wu, B. L. Wanner, and C. T. Walsh. 1994. Identification of the DNA-binding site for the phosphorylated VanR protein required for vancomycin resistance in Enterococcus faecium. Biochemistry 33:4625-4631.[CrossRef][Medline]
  30. Jacob, A. E., and S. J. Hobbs. 1974. Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J. Bacteriol. 117:360-372.[Abstract/Free Full Text]
  31. Le Bouguénec, C., G. de Cespédès, and T. Horaud. 1990. Presence of chromosomal elements resembling the composite structure Tn3701 in streptococci. J. Bacteriol. 172:727-734.[Abstract/Free Full Text]
  32. Leclercq, R., E. Derlot, J. Duval, and P. Courvalin. 1988. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N. Engl. J. Med. 319:157-161.[Medline]
  33. Liu, S. L., A. Hessel, and K. E. Sanderson. 1993. Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc. Natl. Acad. Sci. USA 90:6874-6878.[Abstract/Free Full Text]
  34. Mattison, K., R. Oropeza, and L. J. Kenney. 2002. The linker region plays an important role in the interdomain communication of the response regulator OmpR. J. Biol. Chem. 277:32714-32721.[Abstract/Free Full Text]
  35. McCafferty, D. G., I. A. Lessard, and C. T. Walsh. 1997. Mutational analysis of potential zinc-binding residues in the active site of the enterococcal D-Ala-D-Ala dipeptidase VanX. Biochemistry 36:10498-10505.[CrossRef][Medline]
  36. Ostrowsky, B. E., N. C. Clark, C. Thauvin-Eliopoulos, L. Venkataraman, M. H. Samore, F. C. Tenover, G. M. Eliopoulos, R. C. Moellering, Jr., and H. S. Gold. 1999. A cluster of VanD vancomycin-resistant Enterococcus faecium: molecular characterization and clinical epidemiology. J. Infect. Dis. 180:1177-1185.