This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kosowska, K.
Right arrow Articles by Appelbaum, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kosowska, K.
Right arrow Articles by Appelbaum, P. C.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, October 2004, p. 4020-4022, Vol. 48, No. 10
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.10.4020-4022.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Alterations of Penicillin-Binding Proteins 1A, 2X, and 2B in Streptococcus pneumoniae Isolates for Which Amoxicillin MICs Are Higher than Penicillin MICs

K. Kosowska,1 M. R. Jacobs,2 S. Bajaksouzian,2 L. Koeth,3* and P. C. Appelbaum1

Hershey Medical Center, Hershey, Pennsylvania,1 Case Western Reserve University, Cleveland,2 Laboratory Specialists, Inc., Westlake, Ohio3

Received 10 February 2004/ Returned for modification 7 May 2004/ Accepted 20 June 2004


arrow
ABSTRACT
 
Penicillin-binding proteins (PBPs) of 15 selected penicillin- and amoxicillin-resistant Streptococcus pneumoniae isolates (MICs of 2 to 8 and 8 to 16 µg/ml, respectively) were studied. In addition to typical changes in PBPs 1A and 2X, these strains had 10 unique changes in PBP 2B, including a 618A-G substitution, which may be the key alteration associated with amoxicillin resistance.


arrow
TEXT
 
The efficacy of ß-lactam antibiotics has been compromised by rapid increases in the prevalence of penicillin-nonsusceptible Streptococcus pneumoniae strains (1). This is the result of altered penicillin-binding proteins (PBPs) with decreased antibiotic affinities (2-4, 12, 15, 17). Pneumococci have, however, generally remained susceptible to amoxicillin as a result of the favorable pharmacokinetic properties of this agent (6, 13, 14). A few reports have documented isolates that are resistant to both amoxicillin and penicillin, with, in some instances, the unusual feature of amoxicillin MICs (4 to 16 µg/ml) being higher than penicillin MICs (2 to 8 µg/ml) (9, 10, 15). The purpose of this study was to characterize the nucleotide sequences of regions encoding the penicillin-binding domains of pbp1a, pbp2b, and pbp2x from representative strains with this unusual pattern.

To accomplish this purpose, 15 such isolates of S. pneumoniae were selected from the 1998 to 2000 Alexander Network and Augmentin XR 2000 surveillance studies and the MICs for these isolates were confirmed by broth microdilution (Trek Diagnostic Systems, Inc., Cleveland, Ohio) (16). Ten other penicillin-resistant but amoxicillin-susceptible strains were also selected for comparative purposes.

Analysis of nucleotide and deduced amino acid sequences encoding penicillin-binding domains of PBPs was performed by PCR using a standard protocol (15), with the addition of primers to amplify an additional fragment of the pbp1a gene, 1AAMPF (5' ACCTACTCACAACTGGGATGGATG) and 1AAMPR (5' TGGTTGTGCTGGTTGAGGATTCTG), which correspond to positions 869 and 892 and are complementary to positions 2134 and 2157, respectively. The PCR products produced were a 1.2-kb fragment of the pbp1a gene, a 2-kb segment of the pbp2x gene, and a 1.4-kb segment of the pbp2b gene. PCR products were purified from primers and excess nucleotides with a QIAquick PCR purification kit (QIAGEN, Valencia, Calif.) and directly sequenced with a CEQ8000 genetic analysis system (Beckman Coulter, Fullerton, Calif.). DNA sequences were aligned with ClustalW (18) and compared to nucleotide and deduced amino acid sequences from penicillin-susceptible S. pneumoniae R6. Mutants with nucleotide changes in a particular gene were sequenced twice forward and twice in the reverse direction on PCR products amplified in independent reactions. Strains were also serotyped with pneumococcal antisera (Statens Serum Institute, Copenhagen, Denmark), and DNA fingerprinting was determined by pulsed-field gel electrophoresis (PFGE) after digestion of DNA with SmaI (8).

The surveillance studies from which the strains were selected included 16,141 isolates of S. pneumoniae from 29 countries. The results for penicillin/amoxicillin susceptibility were 64.9/93.6% susceptible, 13.9/3.2% intermediate, and 21.1/3.2% resistant. The amoxicillin MICs for a total of 483 isolates (3.0%) of 8 to 16 µg/ml that were 1 or more dilutions higher than penicillin MICs were predominantly from the United States (381 of 4,928 isolates; 7.7%), Spain (29 of 537 isolates; 5.4%), and France (19 of 821 isolates; 2.3%).

Penicillin and amoxicillin MICs for 23 of the 25 isolates were confirmed to be within 1 doubling dilution of initial MICs, while the amoxicillin MICs for two strains were 2 doubling dilutions lower. The origins, serotypes, and susceptibility patterns of the 15 penicillin- and amoxicillin-resistant isolates are shown in Table 1. PFGE profiles showed 14 unique patterns, with isolates 8 and 31 sharing a common profile.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Origins, serotypes, overall susceptibility patterns (initial MICs), and PFGE profiles of 15 S. pneumoniae isolates with 10 common substitutions in PBP 2B (grouped according to strains with similar MIC patterns)a

PBP analyses showed that all but two of the 25 strains had T371A or S substitutions in the STMK motif of PBP 1A. There were 14 strains with a T371S substitution in PBP 1A, the penicillin MICs for 12 of which were lower than the amoxicillin MICs. Within the 337STMK340 motif of PBP 2X, there were six strains with an M339F substitution, the penicillin MICs for all of which were lower than the amoxicillin MICs. Another substitution within the 337STMK340 motif of PBP 2X was T338S or A, which occurred in all but one of the strains tested. All 25 strains had a T445A substitution in the 442SSNT445 motif of PBP 2B (Table 2).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Amino acid alterations of the three conserved motifs of PBP 1A, 2X, and 2B in S. pneumoniae R6 and 25 study strains

Based on reports that the 590- to 641-amino-acid region of PBP 2B, which surrounds the 614KTG616 drug binding site motif, is associated with amoxicillin resistance (10, 12), all of our strains were also analyzed for alterations in this region. Strains were categorized based on the number of amino acid substitutions surrounding the 614KTG616 motif of PBP 2B. In addition to changes present in amoxicillin-susceptible, penicillin-resistant, strains, a pattern of 10 substitutions (A591S, G596P, N605D, L608T, A618G, D624G, Q627E, T629N, S639T, and D640E) was found to be unique to the 15 amoxicillin-resistant isolates, with 6 substitutions being specific for this group: G596P, N605D, L608T, A618G, S639T, and D640E. One of these unique alterations, A618G, is in close proximity to the active 614KTG616 motif.

Although the 15 amoxicillin-resistant isolates shared this unique set of PBP 2B substitutions, they were not clonal, belonging to 5 serotypes (6B, 14, 19A, 19F, and 23F) and 14 PFGE patterns, as well as having variable susceptibility to macrolides, clindamycin, and tetracycline (Table 1).

Most of the PBP changes found in the 25-strain studies were typical of those previously described, such as single or double substitutions in the 337STMK340 motif of PBP 2X, M339F substitution in PBP 2X, and T338S or T338A substitution in PBP 2X. These substitutions have been described as predominating in strains with intermediate penicillin resistance (2, 5, 15). However, changes in the region 590 to 641 of PBP 2B were unique to the 15 amoxicillin-resistant strains, and transformation experiments have shown that amoxicillin-resistant transformants had acquired multiple PBP changes and that acquisition of these 10 substitutions in PBP 2B by transformants was the key factor associated with amoxicillin resistance (10).

While amoxicillin-resistant strains are currently rare, accounting for only 3.0% of isolates from recent worldwide surveillance studies, and their clinical significance is not clear, the prevalence of these isolates should continue to be monitored. Current formulations of amoxicillin and amoxicillin/clavulanate are active against pneumococci for which amoxicillin MICs are ≤2 µg/ml, and newer formulations, such as amoxicillin/clavulanate suspension (90/6.4 mg/kg of body weight/day) and pharmacokinetically enhanced amoxicillin/clavulanate (2,000/125 mg twice a day) have been developed to address isolates for which amoxicillin MICs are ≤4 µg/ml (7, 11). Further increases in amoxicillin dosing regimens may be required to overcome the resistance described in this report should the prevalence of these strains increase.


arrow
ACKNOWLEDGMENTS
 
This work was supported by a grant from GlaxoSmithKline.

We are grateful for the excellent technical assistance provided by Anne Windau.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Laboratory Specialists, Inc., 1651 A Crossings Parkway, Westlake, OH 44145. Phone: (440) 835-4458. Fax: (440) 835-5786. E-mail: amdlmk{at}aol.com. Back


arrow
REFERENCES
 
    1
  1. Appelbaum, P. C. 1992. Antimicrobial resistance in Streptococcus pneumoniae: an overview. Clin. Infect. Dis. 15:77-83.[Medline]
    2. 2
  2. Asahi, Y., and K. Ubukata. 1998. Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:2267-2273.[Abstract/Free Full Text]
    3. 3
  3. Asahi, Y., Y. Takeuchi, and K. Ubukata. 1999. Diversity of substitutions within or adjacent to conserved amino acid motifs of penicillin-binding protein 2X in cephalosporin-resistant Streptococcus pneumoniae isolates. Antimicrob. Agents Chemother. 43:1252-1255.[Abstract/Free Full Text]
    4. 4
  4. Barcus, V. A., K. Ghanekar, M. Yeo, T. J. Coffey, and C. G. Dowson. 1995. Genetics of high level penicillin resistance in clinical isolates of Streptococcus pneumoniae. FEMS Microbiol. Lett. 126:299-303.[CrossRef][Medline]
    5. 5
  5. Coffey, T. J., M. Daniels, L. K. McDougal, C. G. Dowson, F. C. Tenover, and B. G. Spratt. 1995. Genetic analysis of clinical isolates of Streptococcus pneumoniae with high-level resistance to expanded-spectrum cephalosporins. Antimicrob. Agents Chemother. 39:1306-1313.[Abstract]
    6. 6
  6. Critchley, I. A., J. A. Karlowsky, D. C. Draghi, M. E. Jones, C. Thornsberry, K. Murfitt, and D. F. Sahm. 2002. Activities of faropenem, an oral ß-lactam against recent U.S. isolates of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis. Antimicrob. Agents Chemother. 46:550-555.[Abstract/Free Full Text]
    7. 7
  7. Dagan, R., A. Hoberman, C. Johnson, E. L. Leibovitz, A. Arquedas, F. V. Rose, B. R. Wynne, and M. R. Jacobs. 2001. Bacteriologic and clinical efficacy of high dose amoxicillin/clavulanate in children with acute otitis media. Pediatr. Infect. Dis. J. 20:829-837.[CrossRef][Medline]
    8. 8
  8. Davies, T., R. V. Goering, M. Lovgren, J. A. Talbot, M. R. Jacobs, and P. C. Appelbaum. 1999. Molecular epidemiological survey of penicillin-resistant Streptococcus pneumoniae from Asia, Europe, and North America. Diagn. Microbiol. Infect. Dis. 34:7-12.[CrossRef][Medline]
    9. 9
  9. Doit, C., C. Loukil, F. Fitoussi, P. Geslin, and E. Bingen. 1999. Emergence in France of multiple clones of clinical Streptococcus pneumoniae isolates with high-level resistance to amoxicillin. Antimicrob. Agents Chemother. 43:1480-1483.[Abstract/Free Full Text]
    10. 10
  10. du Plessis, M., E. Bingen, and K. P. Klugman. 2002. Analysis of penicillin-binding protein genes of clinical isolates of Streptococcus pneumoniae with reduced susceptibility to amoxicillin. Antimicrob. Agents Chemother. 46:2349-2357.[Abstract/Free Full Text]
    11. 11
  11. Garau, J., M. Twynholm, E. Garcia-Mendez, B. Siquier, A. Rivero, and the 557 Clinical Study Group. 2003. Oral pharmacokinetically enhanced co-amox/clav 2000/125 mg, twice daily, compared with co-amox/clav 875/125 mg, three times daily, in the treatment of community-acquired pneumonia in European adults. J. Antimicrob. Chemother. 52:826-836.[Abstract/Free Full Text]
    12. 12
  12. Hakenbeck, R., A. König, I. Kern, M. van der Linden, W. Keck, D. Billot-Klein, R. Legrand, B. Schoot, and L. Gutmann. 1998. Acquisition of five high-Mr penicillin-binding protein variants during transfer of high-level ß-lactam resistance from Streptococcus mitis to Streptococcus pneumoniae. J. Bacteriol. 180:1831-1840.[Abstract/Free Full Text]
    13. 13
  13. Jacobs, M. R., S. Bajaksouzian, A. Zilles, G. Lin, G. A. Pankuch, and P. C. Appelbaum. 1999. Susceptibilities of Streptococcus pneumoniae and Haemophilus influenzae to 10 oral antimicrobial agents based on pharmacodynamic parameters: 1997 US surveillance study. Antimicrob. Agents Chemother. 43:1901-1908.[Abstract/Free Full Text]
    14. 14
  14. Jacobs, M. R., D. Flemingham, P. C. Appelbaum, and R. N. Gruneberg. 2003. The Alexander Project 1998-2000: Susceptibility of pathogens isolated from community-acquired respiratory tract infection to commonly used antimicrobial agents. J. Antimicrob. Chemother. 52:229-246.[Abstract/Free Full Text]
    15. 15
  15. Nagai, K., T. A. Davies, M. R. Jacobs, and P. C. Appelbaum. 2002. Effects of amino acid alterations in penicillin-binding proteins (PBPs) 1a, 2b, and 2x on PBP affinities of penicillin, ampicillin, amoxicillin, cefditoren, cefuroxime, cefprozil, and cefaclor in 18 clinical isolates of penicillin-susceptible, -intermediate, and -resistant pneumococci. Antimicrob. Agents Chemother. 46:1273-1280.[Abstract/Free Full Text]
    16. 16
  16. National Committee for Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A6. Wayne, Pa.
    17. 17
  17. Smith, A. M., and K. P. Klugman. 1998. Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:1329-1333.[Abstract/Free Full Text]
    18. 18
  18. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]

Antimicrobial Agents and Chemotherapy, October 2004, p. 4020-4022, Vol. 48, No. 10
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.10.4020-4022.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Kosowska-Shick, K., Ednie, L. M., McGhee, P., Appelbaum, P. C. (2009). Comparative Antipneumococcal Activities of Sulopenem and Other Drugs. Antimicrob. Agents Chemother. 53: 2239-2247 [Abstract] [Full Text]  
  • Kosowska-Shick, K., McGhee, P., Appelbaum, P. C. (2009). Binding of Faropenem and Other {beta}-Lactam Agents to Penicillin-Binding Proteins of Pneumococci with Various {beta}-Lactam Susceptibilities. Antimicrob. Agents Chemother. 53: 2176-2180 [Abstract] [Full Text]  
  • McGee, L., Biek, D., Ge, Y., Klugman, M., du Plessis, M., Smith, A. M., Beall, B., Whitney, C. G., Klugman, K. P. (2009). In Vitro Evaluation of the Antimicrobial Activity of Ceftaroline against Cephalosporin-Resistant Isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 53: 552-556 [Abstract] [Full Text]  
  • Cafini, F., del Campo, R., Alou, L., Sevillano, D., Morosini, M. I., Baquero, F., Prieto, J., on behalf of the Spanish Pneumococcal Network (G03, (2006). Alterations of the penicillin-binding proteins and murM alleles of clinical Streptococcus pneumoniae isolates with high-level resistance to amoxicillin in Spain. J Antimicrob Chemother 57: 224-229 [Abstract] [Full Text]  
  • Chiba, N., Kobayashi, R., Hasegawa, K., Morozumi, M., Nakayama, E., Tajima, T., Iwata, S., Ubukata, K., on behalf of the Acute Respiratory Diseases Study, (2005). Antibiotic susceptibility according to genotype of penicillin-binding protein and macrolide resistance genes, and serotype of Streptococcus pneumoniae isolates from community-acquired pneumonia in children. J Antimicrob Chemother 56: 756-760 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kosowska, K.
Right arrow Articles by Appelbaum, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kosowska, K.
Right arrow Articles by Appelbaum, P. C.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»