Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, December 2004, p. 4505-4512, Vol. 48, No. 12
0066-4804/04/$08.00+0 DOI: 10.1128/AAC.48.12.4505-4512.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
CaNdt80 Is Involved in Drug Resistance in Candida albicans by Regulating CDR1
Chia-Geun Chen,1,2
Yun-Liang Yang,3
Hsin-I Shih,3
Chia-Li Su,2 and
Hsiu-Jung Lo2*
Graduate Institute of Life Sciences, National Defense Medical Center,1
Division of Clinical Research, National Health Research Institutes, Taipei,2
Department of Biological Science and Technology, National Chiao Tung University, Hsinchu, Taiwan, Republic of China.3
Received 29 July 2004/
Returned for modification 18 August 2004/
Accepted 23 August 2004

ABSTRACT
Overexpression of
CDR1, an efflux pump, is one of the major
mechanisms contributing to drug resistance in
Candida albicans. CDR1 p-lacZ was constructed and transformed into a
Saccharomyces cerevisiae strain so that the
lacZ gene could be used as the
reporter to monitor the activity of the
CDR1 promoter. Overexpression
of
CaNDT80, the
C. albicans homolog of
S. cerevisiae NDT80,
increases the ß-galactosidase activity of the
CDR1 p-lacZ construct in
S. cerevisiae. Furthermore, mutations in
CaNDT80 abolish the induction of
CDR1 expression by antifungal
agents in
C. albicans. Consistently, the
Candt80/
Candt80 mutant
is also more susceptible to antifungal drugs than the wild-type
strain. Thus, the gene for CaNdt80 may be the first gene among
the regulatory factors involved in drug resistance in
C. albicans whose function has been identified.

INTRODUCTION
The prevalence of fungal infections has increased significantly
in the past few decades. Among the organisms causing these infections,
Candida albicans is the most frequently isolated fungal pathogen
in humans and has caused morbidity in seriously debilitated
and immunocompromised hosts (
6). Coincident with the increased
use of antifungal drugs, the incidences of drug resistance have
also increased (
24,
33,
36). The limited variety of antifungal
agents and emerging drug resistance highlight the need to identify
potential targets and elucidate the molecular mechanisms involved
in drug resistance for the development of new effective antifungal
agents.
Overexpression of efflux pumps, either major facilitators or ATP binding cassette (ABC) transporters, has been shown to be one of the major mechanisms of drug resistance in clinical isolates (9, 18, 19). The CDR1 gene, which encodes an ABC efflux pump, is identified by complementation of the pdr5 mutant, which is hypersensitive to cycloheximide, chloramphenicol, and azole drugs, in Saccharomyces cerevisiae (25). Mutations in CDR1 in C. albicans resulted in increased susceptibilities to azole drugs (29), which is consistent with the observation that overexpression of CDR1 contributes to the drug resistance of clinical isolates of C. albicans (17, 36). The AP-1 site and the drug-responsive element of the CDR1 promoter have been reported to be the cis-regulatory elements (5, 26). Furthermore, the existence of trans-regulatory factors of CDR1 has also been suggested (26). However, the molecular mechanism and the gene network regulating the expression of CDR1 and drug resistance are poorly understood.
In this study, as in previous studies (15, 16), we have successfully used S. cerevisiae as a model to study C. albicans, despite the differences between these two organisms. We have identified one predicted transcription factor, CaNdt80, the C. albicans homolog of S. cerevisiae Ndt80, which is a meiosis-specific transcription factor in S. cerevisiae (2, 3) and which is involved in drug resistance through the regulation of CDR1 in C. albicans.

MATERIALS AND METHODS
Strains and media.
The
S. cerevisiae strains,
C. albicans strains, and plasmids
used in this study are listed in Table
1, Table
2, and Table
3, respectively. Yeast peptone dextrose (YPD; 1% yeast extract,
2% peptone, and 2% dextrose) and synthetic dextrose (SD; 0.67%
yeast nitrogen base without amino acids and with 2% dextrose)
were prepared as described by Sherman (
30).
Construction of CDR1p-lacZ strain.
The
CDR1p-lacZ fusion plasmid was constructed by using a DNA
fragment generated by PCR from the promoter and the translation
initiation codon ATG of
CDR1 from
C. albicans SC5314. The PCR
fragment was generated with primers HJL21 (5'-dTTT
CCCGGGGGATCCTCGTTACTCAA)
and HJL22 (5'-dCCC
AAGCTTGCATAATTTTTTTCTTTTTGACCT), which introduced
5' XmaI and 3' HindIII sites (underlined), respectively, for
directional cloning into the XmaI and HindIII sites of plasmid
YIp363. Plasmid LOB42 contained the
CDR1p-lacZ in-frame fusion,
in which
lacZ is the reporter gene for monitoring the activity
of the
CDR1 promoter. Primers HJL44 (5'-TTTTCCCGGGCAGCAGTTTAGAAGCAAT)
and HJL45 (5'-CCCCCCCGGGTGATTTGTCTTAACATT) were used to amplify
the DNA fragment from the sequence 37 to 1648 bp downstream
of the translation initiation site of the
ADE3 gene. The fragment
of the
ADE3 gene was cloned in an antisense orientation into
the XmaI site of the
CDR1p-lacZ fusion of plasmid LOB42 to create
plasmid LOB43. The LOB43 construct (Fig.
1) was digested with
XhoI to linearize the DNA at position 337 bp downstream of the
translation initiation site of the
ADE3 gene and transformed
into
S. cerevisiae (10560-2B). The
CDR1p-lacZ fusion of plasmid
LOB43 was integrated into the
ADE3 locus through homologous
recombination to produce the Leu2
+ transformant, strain SLO1.
Screening for trans-regulators of CDR1 in S. cerevisiae.
A
C. albicans genomic library constructed in high-copy-number
S. cerevisiae plasmid 2µm-
URA3 has been prepared (
15)
and was transformed into SLO1 containing the
CDR1p-lacZ fusion.
The
lacZ gene was used as the reporter to monitor the activity
of the
CDR1 promoter. The ß-galactosidase (ß-Gal)
activity was determined by both a filter assay and a liquid
assay, as described previously (
21). The library of transformants
(approximately 500 colonies per 150-mm plate) was grown for
3 days before the transformants were replica plated onto filters
laid on top of agar medium. When a Ura
+ candidate strain containing
a library plasmid had elevated ß-Gal activity, as
shown by a darker blue color than the control strain with only
plasmid 2µm (
1) in the filter assay, it was considered
to harbor a candidate plasmid for the positive
trans-regulatory
factor of
CDR1. When this was the case, the ß-Gal
activity of the strain would be reduced to the basal level when
the plasmid was removed from the cells. Thus, the candidate
strains were grown on YPD liquid medium for 2 days to lose the
library plasmid. The ß-Gal activities of the candidate
plasmids and those of their counterparts which had lost the
library plasmids were determined by ß-Gal liquid assay.
Cloning of CaNDT80.
Primers HJL72 (5'-CGGGATCCTTGTGGCGATTTTCACTTTC) and HJL73 (5'-CCGGATCCTCAATGGGGGTGGATTGA) were used to amplify the genomic DNA containing the CaNDT80 gene of C. albicans from strain SC5314. The amplified DNA fragment starts from the position 578 bp upstream of the predicted start codon of the CaNDT80 gene to the position 479 bp downstream of the predicted stop codon (TAA) of CaNDT80. After digestion with BamHI, the DNA fragment was introduced into the pRS426 vector to generate plasmid LOB45.
Deletion of CaNDT80 in C. albicans.
A homozygous Candt80/Candt80 mutant was constructed on the basis of the gene disruption method described previously (7, 34, 35), as shown in Fig. 2. The region from the position 279 bp downstream of the translation initiation site to the position 359 bp downstream of the stop codon of the CaNDT80 gene was replaced by GFP-ARG4. A DNA fragment containing the GFP-ARG4 construct flanked by short homologous regions (70 bp) of CaNDT80 at the two extremities was transformed into C. albicans strain BWP17. The region from the position 101 bp downstream of the translation initiation site to the position 148 bp upstream of the stop codon of the second copy of CaNDT80 was replaced by the URA3-dpl200-based cassette. A PCR product containing the URA3-dpl200 sequence with the CaNDT80 short homologous regions (70 bp) at the two extremities was transformed into YLO131 (CaNDT80/Candt80::GFP-ARG4). AccI-digested pT7tetR-HIS1 was integrated into the ENO1 promoter of YLO132, the Candt80/Candt80 homozygous mutant, to create strain YLO133. A BamHI DNA fragment containing wild-type CaNDT80 from plasmid LOB44 was inserted into the pGEM-HIS1 vector to generate pGEM-HIS1-CaNDT80, referred to as plasmid LOB49. Plasmid LOB49 was digested with SpeI, located in the promoter of CaNDT80, and was transformed into YLO132 to generate strain YLO137 (Candt80/Candt80::CaNDT80).
Antifungal susceptibility tests.
The Etest (
23,
32) was used to determine the susceptibilities
of
S. cerevisiae strains containing either 2µm-
CaNDT80 or plasmid 2µm to antifungal agents. Fluconazole (0.016
to 256 µg/ml) and ketoconazole (0.002 to 32 µg/ml)
Etest strips (AB BIODISK, Solna, Sweden) were used. Homogenized
colonies isolated from an overnight SD plate were transferred
to 0.85% NaCl to achieve a density of 5
x 10
6 cells/ml. A sterile
swab was dipped into the inoculum suspension and was then used
to swab evenly the entire agar surface of an SD plate. The Etest
strips were applied to the plate when the excess moisture had
been absorbed completely. The agar dilution method was used
to determine the susceptibilities of the
C. albicans isolates
to antifungal agents. Fluconazole and voriconazole were prepared
to final concentrations of 25 and 1 µg/ml, respectively,
in dimethyl sulfoxide (DMSO). Cells grown on medium containing
an equal amount of DMSO in the absence of drug were used as
controls. Strains were diluted to an optical density at 600
nm of 2 (approximately 2
x 10
7 cells/ml), and approximately
0.5 µl per spot was spotted onto plates containing different
drugs with a replica plating device (Oxoid Inc., Nepean, Ontario,
Canada). The strains were also serially diluted 10-fold.
Quantitative analysis of mRNA level by real-time PCR.
The C. albicans cells were harvested after they were grown in 20 ml of SD liquid medium in the absence or presence of 100 µg of miconazole per ml at 30°C for 1 h (optical density at 600 nm, 0.7 to 1.0). A real-time hot-start PCR was performed with an LC FastStartDNA Master SYBR Green I kit in a LightCycler instrument (catalog no. 2239264; Roche, Mannheim, Germany) to determine the level of mRNA. The real-time PCR was performed according to the instructions of the manufacturer. The expression of HGT4 in each strain was used as a control. The relative quantitation used two standard curves for the comparisons, and the results are given as a ratio (11). For the miconazole induction assay, the level of RNA isolated from different strains that had not been treated with miconazole was defined as 100%. The relative level of mRNA isolated from different strains that had been treated with miconazole was normalized to the level of mRNA isolated from the same strain that had not been treated with miconazole. To determine the effects of mutations in CaNDT80 after miconazole induction, the level of RNA isolated from the wild-type cells was defined as 100%.

RESULTS
Screening the trans-regulators of CDR1.
A total of approximately 24,000 independent library transformant
colonies, which should cover about three times the
C. albicans genome size, were screened. Of the 74 candidates picked initially,
16 were confirmed by the second filter assay to have ß-Gal
activity. Among these 16 candidates, 5 had higher ß-Gal
activities than the rest of the candidates and were chosen for
further analysis. The higher ß-Gal activities of two
candidates resulted from mutations in a chromosome(s) in
S. cerevisiae, since the strains still had the same level of ß-Gal
activity after they lost the plasmid. In contrast, the ß-Gal
activities of the remaining three candidates were reduced to
the basal level when they lost the plasmid. Two of these three
candidates harbored the same plasmid, named LOB44.
Overexpression of CaNDT80 increases the expression of CDR1p-lacZ.
S. cerevisiae strain SLO3 containing plasmid LOB44 had approximately sixfold higher ß-Gal activity than strain SLO2 containing plasmid 2µm by the ß-Gal liquid assay. Plasmid LOB44 contains a genomic insert of approximately 5 kb. This DNA fragment contains two full-length open reading frames. One is CaNdt80 and the other is orf6.1265, a short hypothetical protein of 106 amino acids (aa). The genomic insert was used for subcloning to produce LOB45, which harbored a 2.8-kb fragment with only the full-length gene of CaNDT80 generated by PCR. The ß-Gal activity of parental strain SLO1 containing plasmid LOB45 (strain SLO5) was as high as that of the strain containing plasmid LOB44. These results demonstrate that the increased ß-Gal activity of CDR1p-lacZ in S. cerevisiae is dependent on the presence of the CaNDT80 sequence.
CaNdt80 in C. albicans and Ndt80 in S. cerevisiae share the same DNA binding domain.
The CaNDT80 gene encodes a putative transcription factor. The transcription factor is 592 aa in length and shares the DNA binding domain with Ndt80, a meiosis-specific protein in S. cerevisiae. A comparison of the CaNdt80 and Ndt80 sequences is shown in Fig. 3. Ndt80 in S. cerevisiae is 672 aa. The sequence from amino acids 1 to 330 has been shown to be important for DNA binding activity. Two different domains have been identified. The residues from amino acids 1 to 58 are needed for sequence-specific interactions, and the residues from amino acids 59 to 330 contain a DNA binding domain. The sequence from amino acids 223 to 572 of Candt80 and those from amino acids 3 to the 330 of Ndt80 share 37.6% identity and 57.9% similarity (Fig. 3A). There was no similarity between the N terminus of CaNdt80 and the C terminus of Ndt80 (Fig. 3A).
Overexpression of CaNDT80 decreases susceptibility to fluconazole and ketoconazole in S. cerevisiae.
Overexpression of
CaNDT80 increased the expression of
CDR1p-lacZ,
suggesting that CaNdt80 is an activator of
CDR1 involved in
drug resistance. According to the results of Etest, the overexpression
of
CaNDT80 decreased the susceptibility of
S. cerevisiae to
both fluconazole and ketoconazole (Fig.
4). The MIC of fluconazole
increased from 24 to 64 µg/ml when cells overexpressed
CaNDT80 (Fig.
4b). Consistently, the MIC of ketoconazole increased
from 6 µg/ml to greater than or equal to 32 µg/ml
when cells overexpressed
CaNDT80 (Fig.
4d). The strain containing
plasmid LOB45, which harbored
CaNDT80, had similar susceptibilities
to the two antifungal drugs. Thus, these data suggest that CaNdt80
of
C. albicans is capable of activating the gene involved in
drug resistance in
S. cerevisiae.
Mutations in CaNDT80 reduce the expression of CDR1 in C. albicans.
The
CaNDT80 gene was expressed during vegetative growth in
C. albicans (Fig.
5A, bar 7). The expression of
CaNDT80 was increased
by treating the cells with miconazole (Fig.
5A; compare bars
7 and 8). To elucidate the functions of CaNdt80 in
C. albicans,
we have constructed a
Candt80/
Candt80 homozygous mutant on the
basis of the rapid gene disruption method (Fig.
2). No
CaNDT80 mRNA was detected in the
Candt80/
Candt80 mutant, which therefore
verified the presence of a null mutation in
CaNDT80. As expected,
CDR1 expression was also induced by miconazole treatment (Fig.
5A; compare bars 5 and 6). Homozygous null mutations in
CaNDT80 abolished the induction of
CDR1 expression in the presence of
the drug (Fig.
5A; compare bars 1 and 2). This result is consistent
with the idea that CaNdt80 is an activator of
CDR1. However,
CDR1 expression was not completely abolished by the null mutation
in
CaNDT80. In the presence of drugs, the level of
CDR1 mRNA
in the
Candt80/
Candt80 mutant strain was reduced to 15%, not
0%, of that in the wild-type strain (Fig.
5B; compare bars 1
and 3).
Mutations in CaNDT80 increase susceptibilities to antifungal agents in C. albicans.
According to the results of the agar dilution assay, strains
with mutations in either
CDR1 or
CaNDT80 were more susceptible
to fluconazole and voriconazole (Fig.
6). Cells grew in all
spots in the absence of drugs (Fig.
6). The
Candt80/Candt80 mutant was more susceptible to drugs than the wild-type strain
or the rescued strain containing a copy of wild-type
CaNDT80.
Few
cdr1/
cdr1 cells grew on medium with drugs inoculated with
10
3 cells, while few
Candt80/
Candt80 cells grew on medium with
drugs inoculated with 10
2 cells (Fig.
6). Thus, the
cdr1/
cdr1 mutant was more susceptible to drugs than the
Candt80/
Candt80 mutant.

DISCUSSION
Potential targets of CaNdt80.
In the present study, we have found that CaNdt80 is involved
in drug resistance through regulation of the expression of
CDR1 in
C. albicans. This observation is consistent with the findings
from a previous report that the expression of
CaNDT80 in
C. albicans is increased approximately threefold by itraconazole
treatment (
4). Overexpression of a fusion protein containing
the potential
trans-activation domain of CaNdt80 (the sequence
from amino acids 1 to 216) and the DNA binding domain of Ndt80
(the sequence from amino acids 1 to 330) (
13,
20) induced the
expression of
CDR1p-lacZ in
S. cerevisiae (data not shown).
These data suggest that the DNA binding domains of Ndt80 and
CaNdt80 may recognize the same DNA sequence since the DNA binding
domain of Ndt80 can replace that of CaNdt80. Ndt80 is autoregulated
and activates its targets through the midsporulation element
(MSE) consensus site (gNCRCAAAA/T, where g indicates a probable
G, N indicates any nucleo-tide, and R indicates A or G) (
3).
One perfect MSE (gNCRCAAAA/T) is located 572 bp upstream of
the translation-initiating codon (ATG) of
CaNDT80; and three
potential MSEs (CRCAAA) are located 70, 122, and 461 bp upstream
of the translation initiation site. It will be interesting to
determine whether CaNdt80, like Ndt80 in
S. cerevisiae, also
regulates its own expression.
Null mutations in CaNDT80 abolish the induction of CDR1 expression by drugs. Consistently, the promoter of CDR1 contains three potential MSEs (CRCAAA) located 270, 438, and 835 bp upstream from the translation initiation site, respectively. The level of CDR1 mRNA in the rescued strain is lower than that in the wild-type strain. Furthermore, the rescued strain (Candt80/Candt80::CaNDT80) is also more susceptible to fluconazole than the wild-type strain. These data suggest a dosage effect (+/+ > +/ > /) of CaNDT80 in C. albicans, as has been documented in some other genes of C. albicans (12).
Overexpression of CaNDT80 in S. cerevisiae decreased the susceptibility of the organism to antifungal agents, suggesting that in S. cerevisiae CaNdt80 may activate the genes involved in drug susceptibility, including ERG11, PDR1, and TOP1, whose promoters have either perfect or potential MSEs
Transcription factors with the DNA binding domain of CaNdt80.
Ndt80 was identified as a meiosis-specific transcription factor required for S. cerevisiae to exit the pachytene stage (2, 3). Mutations in NDT80 in S. cerevisiae did not alter the susceptibility to antifungal agents (unpublished data), which is consistent with previous findings that Ndt80 is active in S. cerevisiae diploid cells only during meiosis. The Orf6.4742 gene was previously designated CaNDT80 because of the highly conserved region of the novel DNA binding domain between CaNdt80 and Ndt80.
In addition to CaNdt80 and Ndt80, several proteins from higher eukaryotes, including Neurospora crassa, Dictyostelium discoideum, Caenorhabditis elegans, Drosophila melanogaster, and humans, also contain sequences homologous to this novel DNA binding motif of CaNdt80 (20). Most metastatic tumors are more resistant to chemotherapeutic drugs than their primary counterparts, and many drug-resistant tumors are more invasive than nonresistant parental cells (14, 28). There seems to be a connection between the invasiveness (virulence) and the drug resistance of the tumor cells. Interestingly, C11orf9, a human transcription factor with a DNA binding domain similar to that of the novel DNA binding motif CaNdt80, is also highly expressed in invasive or metastatic tumor cells (10). Hence, this motif represents a new type of DNA binding domain and may consist of members with unique pathways.
The development of drug resistance and the limited variety of antifungal drugs available for clinical therapy are issues in treatments for infectious diseases. In the present study, we have shown that CaNdt80 regulates one of the drug resistance pathways of C. albicans. Hence, our findings may open a new doorway for the development and design of new effective agents for the treatment of microbial infections.

ACKNOWLEDGMENTS
We thank G. Fink, C. Gale, A. Mitchell, H. Nakayama, and D.
Sanglard for strains and plasmids. We also thank M. Y. Tsao
and J. S. Wang for technical assistance. We also thank E. M.
Ju for editing the manuscript.

FOOTNOTES
* Corresponding author. Mailing address: Division of Clinical Research, National Health Research Institutes, 128, Yen-Chiu-Yuan Rd., Section 2, Taipei 11529, Taiwan, Republic of China. Phone: 886-2-2652-4095. Fax: 886-2-2789-0254. E-mail:
hjlo{at}nhri.org.tw.


REFERENCES
1 - Christianson, T. W., R. S. Sikorski, M. Dante, J. H. Shero, and P. Hieter. 1992. Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122.[CrossRef][Medline]
2 - Chu, S., J. DeRisi, M. Eisen, J. Mulholland, D. Botstein, P. O. Brown, and I. Herskowitz. 1998. The transcriptional program of sporulation in budding yeast. Science 282:699-705.[Abstract/Free Full Text]
3 - Chu, S., and I. Herskowitz. 1998. Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol. Cell 1:685-696.[CrossRef][Medline]
4 - De Backer, M. D., T. Ilyina, X. J. Ma, S. Vandoninck, W. H. Luyten, and H. Vanden Bossche. 2001. Genomic profiling of the response of Candida albicans to itraconazole treatment using a DNA microarray. Antimicrob. Agents Chemother. 45:1660-1670.[Abstract/Free Full Text]
5 - de Micheli, M., J. Bille, C. Schueller, and D. Sanglard. 2002. A common drug-responsive element mediates the upregulation of the Candida albicans ABC transporters CDR1 and CDR2, two genes involved in antifungal drug resistance. Mol. Microbiol. 43:1197-1214.[CrossRef][Medline]
6 - Edwards, E. J. J. 1990. Candida species, p. 1943-1958. In G. L. Mandell, R. G. Douglas, and J. E. Bennett (ed.), Principles and practice of infectious diseases. Churchill Livingstone, New York, N.Y.
7 - Gerami-Nejad, M., J. Berman, and C. A. Gale. 2001. Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans. Yeast 18:859-864.[CrossRef][Medline]
8 - Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179-182.[CrossRef][Medline]
9 - Karababa, M., A. T. Coste, B. Rognon, J. Bille, and D. Sanglard. 2004. Comparison of gene expression profiles of Candida albicans azole-resistant clinical isolates and laboratory strains exposed to drugs inducing multidrug transporters. Antimicrob. Agents Chemother. 48:3064-3079.[Abstract/Free Full Text]
10 - Kiemer, A. K., K. Takeuchi, and M. P. Quinlan. 2001. Identification of genes involved in epithelial-mesenchymal transition and tumor progression. Oncogene 20:6679-6688.[CrossRef][Medline]
11 - Kofron, M., T. Demel, J. Xanthos, J. Lohr, B. Sun, H. Sive, S. Osada, C. Wright, C. Wylie, and J. Heasman. 1999. Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFbeta growth factors. Development 126:5759-5770.[Abstract]
12 - Kohler, J. R., and G. R. Fink. 1996. Candida albicans strains heterozygous and homozygous for mutations in mitogen-activated protein kinase signaling components have defects in hyphal development. Proc. Natl. Acad. Sci. USA 93:13223-13228.[Abstract/Free Full Text]
13 - Lamoureux, J. S., D. Stuart, R. Tsang, C. Wu, and J. N. Glover. 2002. Structure of the sporulation-specific transcription factor Ndt80 bound to DNA. EMBO J. 21:5721-5732.[CrossRef][Medline]
14 - Liang, Y., S. McDonnell, and M. Clynes. 2002. Examining the relationship between cancer invasion/metastasis and drug resistance. Curr. Cancer Drug Targets 2:257-277.[CrossRef][Medline]
15 - Liu, H., J. Kohler, and G. R. Fink. 1994. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266:1723-1726.[Abstract/Free Full Text]
16 - Lo, H. J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti, and G. R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949.[CrossRef][Medline]
17 - Lopez-Ribot, J. L., R. K. McAtee, L. N. Lee, W. R. Kirkpatrick, T. C. White, D. Sanglard, and T. F. Patterson. 1998. Distinct patterns of gene expression associated with development of fluconazole resistance in serial Candida albicans isolates from human immunodeficiency virus-infected patients with oropharyngeal candidiasis. Antimicrob. Agents Chemother. 42:2932-2937.[Abstract/Free Full Text]
18 - Marger, M. D., and M. H. Saier, Jr. 1993. A major superfamily of transmembrane facilitators that catalyse uniport, symport and antiport. Trends Biochem. Sci. 18:13-20.[CrossRef][Medline]
19 - Michaelis, S., and C. Berkower. 1995. Sequence comparison of yeast ATP-binding cassette proteins. Cold Spring Harbor Symp. Quant. Biol. 60:291-307.
20 - Montano, S. P., M. L. Cote, I. Fingerman, M. Pierce, A. K. Vershon, and M. M. Georgiadis. 2002. Crystal structure of the DNA-binding domain from Ndt80, a transcriptional activator required for meiosis in yeast. Proc. Natl. Acad. Sci. USA 99:14041-14046.[Abstract/Free Full Text]
21 - Mosch, H. U., R. L. Roberts, and G. R. Fink. 1996. Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 93:5352-5356.[Abstract/Free Full Text]
22 - Myers, A. M., A. Tzagoloff, D. M. Kinney, and C. J. Lusty. 1986. Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions. Gene 45:299-310.[CrossRef][Medline]
23 - Pfaller, M. A., D. J. Diekema, S. A. Messer, L. Boyken, and R. J. Hollis. 2003. Activities of fluconazole and voriconazole against 1,586 recent clinical isolates of Candida species determined by broth microdilution, disk diffusion, and Etest methods: report from the ARTEMIS Global Antifungal Susceptibility Program, 2001. J. Clin. Microbiol. 41:1440-1446.[Abstract/Free Full Text]
24 - Pfaller, M. A., R. N. Jones, G. V. Doern, H. S. Sader, S. A. Messer, A. Houston, S. Coffman, and R. J. Hollis. 2000. Bloodstream infections due to Candida species: SENTRY antimicrobial surveillance program in North America and Latin America, 1997-1998. Antimicrob. Agents Chemother. 44:747-751.[Abstract/Free Full Text]
25 - Prasad, R., P. De Wergifosse, A. Goffeau, and E. Balzi. 1995. Molecular cloning and characterization of a novel gene of Candida albicans, CDR1, conferring multiple resistance to drugs and antifungals. Curr. Genet. 27:320-329.[CrossRef][Medline]
26 - Puri, N., S. Krishnamurthy, S. Habib, S. E. Hasnain, S. K. Goswami, and R. Prasad. 1999. CDR1, a multidrug resistance gene from Candida albicans, contains multiple regulatory domains in its promoter and the distal AP-1 element mediates its induction by miconazole. FEMS Microbiol. Lett. 180:213-219.[CrossRef][Medline]
27 - Reynolds, A., V. Lundblad, D. Dorris, and M. Keaveney. 1997. Yeast vectors and assays for expression of cloned genes, p. 13.6.1-13.6.6. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, New York, N.Y.
28 - Sahin, A. A. 2000. Biologic and clinical significance of HER-2/neu (cerbB-2) in breast cancer. Adv. Anat. Pathol. 7:158-166.[Medline]
29 - Sanglard, D., F. Ischer, M. Monod, and J. Bille. 1996. Susceptibilities of Candida albicans multidrug transporter mutants to various antifungal agents and other metabolic inhibitors. Antimicrob. Agents Chemother. 40:2300-2305.[Abstract]
30 - Sherman, F. 2002. Getting started with yeast. Methods Enzymol. 350:3-41.[Medline]
31 - Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27.[Abstract/Free Full Text]
32 - Tapia, C., E. Leon, and E. Palavecino. 2003. Antifungal susceptibility of yeasts by Etest. Comparison of 3 media. Rev. Med. Chil. 131:299-302.[Medline]
33 - Vanden Bossche, H., D. W. Warnock, B. Dupont, D. Kerridge, G. S. Sen, L. Improvisi, P. Marichal, F. C. Odds, F. Provost, and O. Ronin. 1994. Mechanisms and clinical impact of antifungal drug resistance. J. Med. Vet. Mycol. 32(Suppl. 1):189-202.
34 - Wilson, R. B., D. Davis, B. M. Enloe, and A. P. Mitchell. 2000. A recyclable Candida albicans URA3 cassette for PCR product-directed gene disruptions. Yeast 16:65-70.[CrossRef][Medline]
35 - Wilson, R. B., D. Davis, and A. P. Mitchell. 1999. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181:1868-1874.[Abstract/Free Full Text]
36 - Yang, Y. L., and H.-J. Lo. 2001. Mechanisms of antifungal agent resistance. J. Microbiol. Immunol. Infect. 34:79-86.[Medline]
Antimicrobial Agents and Chemotherapy, December 2004, p. 4505-4512, Vol. 48, No. 12
0066-4804/04/$08.00+0 DOI: 10.1128/AAC.48.12.4505-4512.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Sellam, A., Tebbji, F., Nantel, A.
(2009). Role of Ndt80p in Sterol Metabolism Regulation and Azole Resistance in Candida albicans. Eukaryot Cell
8: 1174-1183
[Abstract]
[Full Text]
-
Manoharlal, R., Gaur, N. A., Panwar, S. L., Morschhauser, J., Prasad, R.
(2008). Transcriptional Activation and Increased mRNA Stability Contribute to Overexpression of CDR1 in Azole-Resistant Candida albicans. Antimicrob. Agents Chemother.
52: 1481-1492
[Abstract]
[Full Text]
-
Gulshan, K., Moye-Rowley, W. S.
(2007). Multidrug Resistance in Fungi. Eukaryot Cell
6: 1933-1942
[Full Text]
-
Coste, A., Selmecki, A., Forche, A., Diogo, D., Bougnoux, M.-E., d'Enfert, C., Berman, J., Sanglard, D.
(2007). Genotypic Evolution of Azole Resistance Mechanisms in Sequential Candida albicans Isolates. Eukaryot Cell
6: 1889-1904
[Abstract]
[Full Text]
-
Dementhon, K., Iyer, G., Glass, N. L.
(2006). VIB-1 Is Required for Expression of Genes Necessary for Programmed Cell Death in Neurospora crassa. Eukaryot Cell
5: 2161-2173
[Abstract]
[Full Text]
-
Wang, J.-S., Yang, Y.-L., Wu, C.-J., Ouyang, K. J., Tseng, K.-Y., Chen, C.-G., Wang, H., Lo, H.-J.
(2006). The DNA-binding domain of CaNdt80p is required to activate CDR1 involved in drug resistance in Candida albicans.. J Med Microbiol
55: 1403-1411
[Abstract]
[Full Text]
-
Uko, S., Soghier, L. M., Vega, M., Marsh, J., Reinersman, G. T., Herring, L., Dave, V. A., Nafday, S., Brion, L. P.
(2006). Targeted Short-Term Fluconazole Prophylaxis Among Very Low Birth Weight and Extremely Low Birth Weight Infants. Pediatrics
117: 1243-1252
[Abstract]
[Full Text]
-
Coste, A., Turner, V., Ischer, F., Morschhauser, J., Forche, A., Selmecki, A., Berman, J., Bille, J., Sanglard, D.
(2006). A Mutation in Tac1p, a Transcription Factor Regulating CDR1 and CDR2, Is Coupled With Loss of Heterozygosity at Chromosome 5 to Mediate Antifungal Resistance in Candida albicans. Genetics
172: 2139-2156
[Abstract]
[Full Text]