Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, December 2004, p. 4886-4888, Vol. 48, No. 12
0066-4804/04/$08.00+0 DOI: 10.1128/AAC.48.12.4886-4888.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
PCR-Restriction Fragment Length Polymorphism Assay for Detection of gyrA Mutations Associated with Fluoroquinolone Resistance in Campylobacter coli
Rodrigo Alonso,
Estibaliz Mateo,
Cecilia Girbau,
Estibaliz Churruca,
Irati Martinez, and
Aurora Fernández-Astorga*
Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco (UPV-EHU), Vitoria-Gasteiz, Spain
Received 28 May 2004/
Returned for modification 20 July 2004/
Accepted 3 September 2004

ABSTRACT
A fragment of the
gyrA gene was sequenced from 34 isolates of
Campylobacter coli, including 23 isolates resistant to ciprofloxacin.
All ciprofloxacin-resistant isolates examined by DNA sequencing
carried a point mutation at position Thr-86 on the
gyrA gene
product, involving the replacement of Thr-86 by Ile. A combined
PCR-restriction fragment length polymorphism technique using
RsaI was developed to detect this mutation.

TEXT
The thermotolerant species of
Campylobacter are frequent causes
of acute bacterial gastroenteritis in humans worldwide. More
than 90% of these infections are caused by
C. jejuni, with
C. coli causing most of the remainder (
5,
8). Gastroenteritis caused
by
C. jejuni and
C. coli is normally self limiting. However,
early antibiotic therapy is recommended to reduce severity and
duration, mainly in severe cases with prolonged disease, in
immunocompromised patients or if the infection is extraintestinal
(
2). In such cases, macrolides and fluoroquinolones, particularly
ciprofloxacin, are the drugs of choice. Fluoroquinolones are
also frequently used as prophylaxes for traveler's diarrhea.
However, coinciding with the introduction of fluoroquinolones
in veterinary medicine was the increased emergence of quinolone-resistant
enteric bacteria strains (
3,
9,
13). Such strains can be transmitted
to humans. This is particularly important in
Campylobacter because
it is thought to be a food-borne pathogen. In fact, fluoroquinolone
resistance in
Campylobacter from food animals is now recognized
as an emerging public health problem (
4,
14).
The resistance of C. jejuni and C. coli to quinolones mainly depends on mutations in the quinolone resistance-determining region (QRDR) of the gyrA gene and occasionally on mutations of the parC gene. Mutations in gyrA contribute to confer decreased sensitivity of DNA gyrase to quinolone antibiotics and a corresponding increase in their MICs (7, 15). Point mutations in the gyrA gene product at position Thr-86 have been associated with high-level resistance to ciprofloxacin (17).
Although direct sequencing is the more accurate technique for the detection of nucleotide mutations, DNA sequencing cannot be used as a routine assay for diagnosis because sequencing protocols usually are expensive and time-consuming. Therefore, alternative protocols for the detection of single-nucleotide changes of genes have been developed that can be applied to diagnosis in a routine clinical laboratory or epidemiological studies (11, 18, 19). In Campylobacter, most of these alternative protocols are focused on C. jejuni, a major cause of Campylobacter infection in humans. However, C. coli is often isolated together with C. jejuni, and it is the second cause of campylobacteriosis in humans. Furthermore, C. coli appears to display higher rates of resistance to ciprofloxacin than C. jejuni at present (6, 16).
For these reasons it is of interest to us to develop a PCR-based restriction fragment length polymorphism (PCR-RFLP) assay allowing rapid and reproducible identification of major mutations mediating fluoroquinolone resistance in C. coli. This process involves the introduction of an artificial restriction enzyme cleavage site into the PCR product using a primer-specified restriction site modification method and restriction enzyme digestion of the PCR product. In this communication, we report the application of this nonculture method to the detection of mutants within the Thr-86 codon of the C. coli gene associated with decreased susceptibility to ciprofloxacin, gyrA.
In this study, 34 C. coli strains, 10 of human origin and 24 of food or animal origin, were first examined for ciprofloxacin susceptibility. MICs were determined by the agar dilution method on Mueller-Hinton agar (Oxoid) supplemented with 5% lysed horse blood (Oxoid), following the NCCLS recommendations (10), as there are no internationally accepted criteria for susceptibility testing for Campylobacter. The plates were incubated at 42°C under a microaerobic atmosphere (5% O2, 10% CO2, and 85% N2) for 24 h. The breakpoint for ciprofloxacin was considered to be a MIC of
4 µg/ml. The results of ciprofloxacin susceptibility testing for the 34 strains are shown in Table 1. Twenty-three of the 34 isolates were resistant to ciprofloxacin, all of them showing high-level resistance (MICs from 16 to 64 µg/ml). Among the 23 ciprofloxacin-resistant strains, one strain was resistant to amoxicillin, nine strains were resistant to tetracycline, six strains were coresistant to tetracycline and erythromycin, and four strains were coresistant to tetracycline and amoxicillin.
View this table:
[in this window]
[in a new window]
|
TABLE 1. C. coli strains tested in this study, PCR-RFLP results, and ciprofloxacin MICs for the corresponding strains
|
On the basis of the DNA sequence of the
gyrA gene of
C. coli (GenBank accession number
AF092101), we have designed an oligonucleotide
adjacent to the mutation sites within the Thr-86 codon nucleotide
sequence that differ from the gene sequence by one base (underlined)
to create an artificial RsaI leavage site. This nucleotide was
used in forward primer colgyrA (5'-AAATCTGCTCGTATAGTAGGGGATGT
TATCGGTAAGTATCATCCACATGGCG
GT-3'). The reverse primer was cjgyrA2
as previously described (
12). They were used to amplify a 179-bp
fragment containing the QRDR of the
gyrA gene of quinolone-resistant
and -susceptible
C. coli strains. Analysis of
gyrA was started
with the amplification of the 179-bp fragment by PCR using primers
colgyrA and cjgyrA2, as mentioned above. The PCR was carried
out in 25 µl of reaction mixture, containing 1
x PCR buffer
(10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl [pH 8.3]), 80 ng of
genomic DNA, 10 pmol of each primer, 0.2 mM deoxynucleotide,
and 1 U of
Taq polymerase (Invitrogen). An initial denaturation
step at 94°C for 5 min followed by 30 cycles of denaturation
at 94°C for 1 min, annealing at 55°C for 1 min, and
extension at 72°C for 45 s and a final extension at 72°C
for 7 min were performed in a Robocycler 96 thermal cycler (Stratagene).
Amplification products of the expected size (179 bp) were obtained
for all strains, whether they had been resistant or susceptible
to the ciprofloxacin. Finally, the PCR products were digested
with RsaI (Roche) to screen for mutations at position Thr-86.
Enzyme digestion was performed in a 10-µl mixture containing
7 µl of the PCR product and 10 U of enzyme. After digestion
with RsaI and separation on a 3% MS-6 agarose gel (Pronadisa),
two different profiles should be expected. As DNAs carrying
mutations at the position corresponding to Thr-86 are amplified,
the RsaI cleavage site is destroyed, and a 179-bp fragment identical
in size to that of the nondigested PCR product after the digestion
should be observed. As a wild-type
gyrA gene is amplified, the
PCR product should contain the artificial RsaI cleavage site.
Consequently, RsaI digests the amplified 179-bp PCR product
to produce two fragments of 54 and 125 bp, respectively. PCR-RFLP
results from the 34 strains are recorded in Table
1 and shown
in Fig.
1.
A complete correlation was observed between the PCR-RFLP results
and the MICs of ciprofloxacin for the corresponding strains.
Analysis of restriction patterns after digestion with RsaI showed
that all resistant strains had the same RFLP, the 179-bp fragment.
These strains were assumed to have mutations at Thr-86. The
susceptible strains had two fragments of 54 and 125 bp, respectively,
produced by RsaI digestion. These strains were assumed to have
no mutation at Thr-86.
In order to confirm the mutation associated with resistance, an extended 235-bp fragment of the QRDR of gyrA from all tested strains was amplified using primers clgyrA1 and cjgyrA2, as previously described (12). The PCR products were purified with a QIAquick PCR purification kit (QIAGEN) and sequenced by Sistemas Genómicos SA (Valencia, Spain). The nucleotide sequence of the 235-bp fragment was compared to that of the wild-type C. coli isolate in the GenBank (accession number AF092101). On the basis of this comparison, a point mutation at codon 86 (ACT
ATT), leading to the replacement of Thr by Ile, was identified in all ciprofloxacin-resistant strains but not in ciprofloxacin-sensitive strains. Despite all isolates having identical amino acid substitutions in the QRDR of the gyrA product, the ciprofloxacin MICs varied from 16 to 64 µg/ml, suggesting that other factors could contribute to the resistance phenotype. It is possible that mutations outside the QRDR or in other genes were responsible for the increased ciprofloxacin MICs (12). Additional silent mutations were found among isolates that were resistant or susceptible strains. Three isolates each had a silent mutation at the position corresponding to Gly-84 (GGC
GGT), and all but three isolates had one at the position corresponding to Phe-99 (TTT
TTC).
As in C. jejuni, fluoroquinolone resistance in C. coli is primarily associated with a single Thr-86-to-Ile mutation in GyrA in isolates from both humans and animals (1, 12, 17). Our results agree with this criterion, since the Thr-86-to-Ile mutation correlated with high-level resistance to ciprofloxacin in the C. coli isolates examined, whether isolated from humans, animals, or food. Thus, the validity of this assay for detection of point mutations in the C. coli gyrA gene associated with decreased susceptibilities to fluoroquinolones was confirmed. This molecular approach was therefore able to overcome technical problems of MIC determination and to detect high-level fluoroquinolone-resistant C. coli strains regardless of the MICs for them.
The PCR-RFLP methodology described here is a simple and rapid method (it can be performed within 6 h) for the detection of ciprofloxacin-resistant C. coli strains. It should serve as a portable alternative to methods such as sequence-specific oligonucleotide hybridization and nonradioisotopic single-strand conformation polymorphism, which have been previously described (11, 18, 19). The present study provides sufficient data suggesting that this rapid and simple assay proves useful for clinical diagnosis or epidemiological studies of C. coli isolates of different origins with decreased susceptibilities to ciprofloxacin.

ACKNOWLEDGMENTS
We thank Susan Barrow for her assistance in the English language.
This work was supported by the Dirección General de Investigación (MCyT) of the Spanish Government (AGL2002-04480-C03-02). R. Alonso is the recipient of a postdoctoral fellowship from the Basque Government.

FOOTNOTES
* Corresponding author. Mailing address: Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco (UPV-EHU), Paseo de la Universidad 7, 01006 Vitoria-Gasteiz, Spain. Phone: 34 945 013909. Fax: 34 945 013014. E-mail:
oipfeasa{at}vc.ehu.es.


REFERENCES
1 - Bachoual, R., S. Ouabdesselam, F. Mory, C. Lascols, C. J. Soussy, and J. Tankovic. 2001. Single or double mutational alterations of gyrA associated with fluoroquinolone resistance in Campylobacter jejuni and Campylobacter coli. Microb. Drug Resist. 7:257-261.[CrossRef][Medline]
2 - Blaser, M. J. 2000. Campylobacter jejuni and related species, p. 2276-2285. In G. L. Mandell, J. E. Bennett, and R. D. Dolin (ed.), Mandell, Douglas, and Bennett's principles and practice of infectious diseases, 5th ed. Churchill Livingstone, Philadelphia, Pa.
3 - Endtz, H. P., G. J. Ruijs, B. van Klingeren, W. H. Jansen, T. van der Reyden, and R. P. Mouton. 1991. Quinolone resistance in Campylobacter isolated from man and poultry following the introduction of fluoroquinolones in veterinary medicine. J. Antimicrob. Chemother. 27:199-208.[Abstract/Free Full Text]
4 - Engberg, J. F., M. Aarestrup, D. E. Taylor, P. Gerner-Smidt, and I. Nachamkin. 2001. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: resistance mechanisms and trends in human isolates. Emerg. Infect. Dis. 7:24-34.[Medline]
5 - Friedman, J., J. Neimann, H. C. Wegener, and R. V. Tauxe. 2000. Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations, p. 121-138. In I. Nachamkin and M. J. Blaser (ed.), Campylobacter, 2nd ed. American Society for Microbiology, Washington, D.C.
6 - Ge, B., D. G. White, P. F. McDermott, W. Girard, S. Zhao, S. Hubert, and J. Meng. 2003. Antimicrobial-resistant Campylobacter species from retail raw meats. Appl. Environ. Microbiol. 69:3005-3007.[Abstract/Free Full Text]
7 - Gootz, T. D., and B. A. Martin. 1991. Characterization of high-level quinolone resistance in Campylobacter jejuni. Antimicrob. Agents Chemother. 35:840-845.[Abstract/Free Full Text]
8 - Llovo, J., E. Mateo, A. Muñoz, M. Urquijo, S. L. W. On, and A. Fernandez-Astorga. 2003. Molecular typing of Campylobacter jejuni isolates involved in a neonatal outbreak indicates nosocomial transmission. J. Clin. Microbiol. 41:3926-3928.[Abstract/Free Full Text]
9 - Luber, P., J. Wagner, H. Hahn, and E. Bartelt. 2003. Antimicrobial resistance in Campylobacter jejuni and Campylobacter coli strains isolated in 1991 and 2001-2002 from poultry and humans in Berlin, Germany. Antimicrob. Agents Chemother. 47:3825-3830.[Abstract/Free Full Text]
10 - National Committee for Clinical Laboratory Standards. 2002. Performance standards for antimicrobial susceptibility testing. Twelfth informational supplement. Approved standard M7-A5. NCCLS document M100-S12, vol. 22, no. 1. National Committee for Clinical Laboratory Standards, Wayne, Pa.
11 - Niwa, H., T. Chuma, K. Okamoto, and K. Itoh. 2003. Simultaneous detection of mutations associated with resistance to macrolides and quinolones in Campylobacter jejuni and C. coli using a PCR-line probe assay. Int. J. Antimicrob. Agents 22:374-379.[CrossRef][Medline]
12 - Piddock, L. J. V., V. Ricci, L. Pumbwe, M. J. Everett, and D. J. Griggs. 2003. Fluoroquinolone resistance in Campylobacter species from man and animals: detection of mutations in topoisomerase genes. J. Antimicrob. Chemother. 51:19-26.[Abstract/Free Full Text]
13 - Saenz, Y., M. Zaraga, M. Lantero, M. J. Gastanares, F. Baquero, and C. Torres. 2000. Antibiotic resistance in Campylobacter strains isolated from animals, foods, and humans in Spain in 1997-1998. Antimicrob. Agents Chemother. 44:267-271.[Abstract/Free Full Text]
14 - Smith, K. E., J. M. Besser, C. W. Hedberg, F. T. Leano, J. B. Bender, J. H. Wicklund, B. P. Johnson, K. A. Moore, and M. T. Osterholm. 1999. Quinolone-resistant Campylobacter jejuni infections in Minnesota, 1992-1998. N. Engl. J. Med. 340:1525-1532.[Abstract/Free Full Text]
15 - Taylor, D. E., and P. Courvalin. 1988. Mechanisms of antibiotic resistance in Campylobacter species. Antimicrob. Agents Chemother. 32:1107-1112.[Free Full Text]
16 - Thwaites, R. T., and J. A. Frost. 1999. Drug resistance in Campylobacter jejuni, C. coli and C. lari isolated from humans in North West England and Wales, 1997. J. Clin. Pathol. 52:812-814.[Abstract]
17 - Wang, Y., W. M. Huang, and D. E. Taylor. 1993. Cloning and nucleotide sequence of the Campylobacter jejuni gyrA gene and characterization of quinolone resistance mutations. Antimicrob. Agents Chemother. 37:457-463.[Abstract/Free Full Text]
18 - Wilson, D. L., S. R. Abner, T. C. Newman, L. S. Mansfield, and J. E. Linz. 2000. Identification of ciprofloxacin-resistant Campylobacter jejuni by use of a fluorogenic PCR assay. J. Clin. Microbiol. 38:3971-3978.[Abstract/Free Full Text]
19 - Zirnstein, G., L. Helsel, Y. Li, B. Swaminathan, and J. Besser. 2000. Characterization of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli by DNA sequence analysis and MAMA PCR. FEMS Microbiol. Lett. 190:1-7.[CrossRef][Medline]
Antimicrobial Agents and Chemotherapy, December 2004, p. 4886-4888, Vol. 48, No. 12
0066-4804/04/$08.00+0 DOI: 10.1128/AAC.48.12.4886-4888.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Wardak, S., Szych, J., Zasada, A. A., Gierczynski, R.
(2007). Antibiotic Resistance of Campylobacter jejuni and Campylobacter coli Clinical Isolates from Poland. Antimicrob. Agents Chemother.
51: 1123-1125
[Abstract]
[Full Text]