The ybxI Gene of Bacillus subtilis 168 Encodes a Class D {beta}-Lactamase of Low Activity

The ybxI gene of Bacillus subtilis 168 encodes a preproteinof 267 amino acid residues, including a putative signal peptideof 23 residues. The YbxI primary structure exhibits high similarityscores with two members of the superfamily of the serine penicillin-recognizingenzymes: the class D ß-lactamases and the hydrophiliccarboxy-terminal domains of the BlaR and MecR penicillin receptors.To determine the function and the activity of this putativepenicillin-recognizing enzyme, we have subcloned the ybxI genein the pET-26b expression vector. Transformation of Escherichiacoli BL21(DE3) by the recombinant plasmid pCIP51 resulted inthe export of the mature YbxI in the periplasm as a water-solubleprotein. The recombinant protein was purified to 95% homogeneity.YbxI interacts with several ß-lactam antibiotics andcan hydrolyze some of them. YbxI is not inactivated by clavulanicacid. The YbxI function and its enzymatic activity in B. subtilisremain unknown. The acyl-enzyme obtained after incubation ofYbxI with a fluorescent derivative of ampicillin can be detectedby sodium dodecyl sulfate-polyacrylamide gel electrophoresis,confirming that YbxI can be acylated by ß-lactam antibiotics.YbxI does not hydrolyze some of the standard substrates of D-alanyl-D-alaninepeptidases, the targets of penicillin. YbxI belongs to the penicillin-recognizingenzyme family but has an activity intermediate between thoseof a penicillin-binding protein and a ß-lactamase.

INTRODUCTION

Top

Introduction

Two families of bacterial serine enzymes recognize penicillinand other ß-lactam antibiotics and form a superfamilyof evolutionarily related proteins named serine penicillin-recognizingenzymes (PREs) (21). The first family contains the D-alanyl-D-alaninepeptidases (DD-transpeptidases) involved in the biosynthesisor in the control of the cross-linking of the peptidoglycan,the main constituent of the bacterial cell wall. DD-peptidasesare inactivated by ß-lactam antibiotics, as a resultof the acylation of their active serine by the antibiotic, whichyields a very stable covalent adduct (Fig. 1). Because of theseproperties, these enzymes are also referred to as penicillin-bindingproteins (PBPs) (10). The members of the second family, theserine ß-lactamases are subdivided into three classes(A, C, and D) and efficiently hydrolyze the amide bond of theß-lactam nucleus, to yield products devoid of antibioticactivity (12, 31). For serine ß-lactamases, the catalyticpathway involves the formation of an acyl-enzyme similar tothat obtained in the interaction of the ß-lactam antibioticwith the DD-peptidases, but in the case of ß-lactamasesthe acyl-enzyme is very unstable. Although one might think thatthey would be very different, the two families of enzymes sharemany biochemical characteristics and very similar three-dimensional(3D) structures (17, 22, 33, 36). Along their primary structures,three conserved peptide sequences, important for recognitionof the substrate or catalysis, have been identified by comparisonof their 3D structures (Table 1). Sequence identities betweenthe class D and the class A and C enzymes are on average 16%(29). Nevertheless, these proteins are thought to have a commonevolutionary history (15, 21, 24).

View larger version (6K):
[in this window]
[in a new window]
FIG. 1. Interaction between the serine PREs with ß-lactam antibiotics. k₂/K and k₃ are the acylation and the deacylation rate constants, respectively. For ß-lactamases, k₃ is large ( $>=$ 1,000 s^-1 for good substrates), and for DD-peptidases and PBPs k₃ is low ( $<=$ 10^-3 s^-1).

View this table:
[in this window]
[in a new window]
TABLE 1. Conserved active-site elements of the serine penicillin-recognizing enzymes

By database comparison, three open reading frames, penP, ybbE,and ybxI, have been found in the B. subtilis 168 genome whichencode putative ß-lactamases. PenP has been overproducedand characterized as a class A ß-lactamase (J. M.van Dijl, unpublished data), whereas YbbE remains uncharacterized,and YbxI has been postulated to be a class D ß-lactamasebecause its primary structure exhibits a high similarity withthe members of this group of serine ß-lactamases.A phylogenetic tree was constructed by Barlow and Hall (3),in which the ybxI nucleotide sequence was referred to as B.subtilis z99105. No promoter sequence was identified upstreamof the coding sequences for these three genes, in agreementwith the fact that no ß-lactamase activity was detectedin growing B. subtilis 168 cells or in the supernatant. To determineif YbxI is a class D ß-lactamase, it was overproducedin the periplasm of Escherichia coli, purified to homogeneity,and analyzed for its capacity to hydrolyze ß-lactamantibiotics and DD-peptidase substrates. YbxI was shown to bea ß-lactamase of very low activity which is not inactivatedby clavulanic acid. Indeed, the recombinant protein interactswith several ß-lactam antibiotics and can hydrolyzesome of them but does not hydrolyze the peptides cleaved byDD-transpeptidases. In B. subtilis 168, the reverse transcription(RT)-PCR analysis does not detect the presence of mRNA encodingYbxI during the exponential phase of growth, in agreement withthe absence of a typical promoter.

MATERIALS AND METHODS

Top

Materials and Methods

Bacterial strains and plasmids. B. subtilis 168 was used as source of DNA for PCR amplificationof the ybxI gene. E. coli DH5 ${alpha}$ (Gibco BRL Life Technology) wasused for the subcloning experiments, and E. coli BL21(DE3) (Invitrogen)was used as host for YbxI overexpression. A mature YbxI proteinexpressed in the periplasm of E. coli BL21(DE3) was obtainedas follows. PCR was performed using primers 5'TAACCATGGATGCATCATCTGCTCATGAAAAAC3'(YbxI-up, sense primer) and 5'TAGGATCCTTAGGATGTAATCAGGCC3' (YbxI-rp,reverse primer) and the purified B. subtilis 168 chromosomeas a template. In this way, NcoI and BamHI restriction siteswere added at the 5' and 3' termini of the ybxI gene. The amplified754-bp fragment coding for a protein devoid of signal peptidewas then cloned in the pGEM-T Easy cloning vector (Promega).Automatic DNA sequencing (ALFexpress) confirmed the correctnucleotide sequence of the PCR product. In the final construct,pCIP 51 (a derivative of pET-26b expression vector [Novagen]),the mature ybxI gene is fused with the pullulanase-encodingsignal peptide sequence.

Culture and YbxI production. E. coli BL21(DE3) was grown in 1 liter of Luria-Bertani mediumsupplemented with kanamycin (50 µg/ml) at 37°C untilthe A₆₀₀ was approximately 0.8. The culture was then inducedby addition of IPTG (isopropyl-ß-D-thiogalactopyranoside)at a final concentration of 0.5 mM. The culture was centrifugedat 4,000 x g for 20 min, and the harvested cells were washedwith 30 mM Tris-HCl buffer (pH 8), centrifuged for 20 min at4,000 x g, and resuspended in the same buffer containing 27%(wt/vol) sucrose, 10 mM EDTA, and hen egg white lysozyme (0.2mg/ml). After 30-min of incubation at 4°C, addition of 0.1M CaCl₂, and centrifugation for 20 min at 18,000 x g, the supernatantcorresponding to the periplasmic fraction was stored overnightat 4°C.

YbxI purification. The periplasmic fraction (100 ml) was dialyzed against 50 mMTris-HCl buffer, pH 8.5, starting buffer, concentrated 10-foldby ultrafiltration on an Amicon membrane (M_r cutoff, 10,000),and deposited onto a Source 15Q column (20 ml) equilibratedwith the same buffer. The proteins were eluted with a linearNaCl gradient (0 to 1.0 M) over 100 ml. The enzyme activitywas detected by a ß-lactamase assay using nitrocefinas the substrate. The active fractions were pooled, dialyzedagainst 20 mM potassium acetate buffer (pH 5), concentratedto 10 ml, and applied to a Source 15S column (5 ml) equilibratedwith 25 ml of the same potassium acetate buffer. The proteinwas eluted with a linear NaCl gradient (0 to 1.0 M) over 25ml. The active fractions were pooled and dialyzed against 50mM phosphate buffer (pH 7). The fractions containing ß-lactamaseactivity were concentrated and then applied to a 100-ml SephacrylS100 HR column. The active fractions were pooled and concentrated.

SDS-PAGE. Samples were subjected to 15% polyacrylamide gel electrophoresis(PAGE) (27) in the presence of sodium dodecyl sulfate (SDS)(0.1%, wt/vol). After electrophoresis, the proteins were revealedby Coomassie blue R250 staining.

Penicillin binding assay. Three micrograms of purified YbxI and 0.5 nmol of fluoresceylampicillin (Ampi-flu) (28) were incubated for various timesat 37°C in a total volume of 20 µl. The reaction wasstopped by addition of 5 µl of SDS-PAGE loading buffer,and the reaction mixture was subjected to SDS-PAGE. As a controlprotein, 10 µg of the carboxy-terminal domain of the Bacilluslicheniformis BlaR penicillin receptor was used. The fluorescentcomplexes were visualized using a Molecular Imager FX (Bio-Rad).

Measurement of kinetic parameters. All the spectrophotometric measurements were performed withthe help of a UVIKON 860 (KONTRON instrument) or a Beckman DU500 spectrophotometer interfaced to microcomputers. The timecourses of the hydrolysis of the ß-lactam antibioticswere recorded at 482 nm for nitrocefin; 260 nm for other cephalosporins,oxacillin, and cloxacillin; 235 nm for other penicillin antibiotics;and 300 nm for imipenem. The kinetic parameters were determinedusing the Hanes linearization ([S]/v versus [S]) or the integratedform of Michaelis-Menten equation (4). The catalytic activityfor all the tested antibiotics was determined with a ß-lactamconcentration of 100 µM.

To test the possible carboxylation of YbxI Lys-82, a 200-µlportion of 17 µM protein solution was diluted in 2 mlof 6 mM acetic acid to obtain a final pH of 4.5. Buffer exchangewas performed by dialysis against degassed 50 mM phosphate buffer,pH 7, under an N₂ atmosphere. The kinetic measurements wereperformed with nitrocefin at 30°C in 50 mM sodium phosphatebuffer (pH 7.0) with and without addition of various sodiumbicarbonate concentration (0.15 to 50 mM).

The hydrolysis of benzoyl-glycyl-thioglycolate (S2a) was monitoredat 250 nm (1).

To probe for a possible DD-peptidase activity, the purifiedrecombinant YbxI was incubated with Ac₂-L-Lys-D-Ala-D-Ala (35mM) in 100 mM Tris-HCl buffer, pH 8. The release of D-Ala wasestimated by the D-amino acid oxidase method (11, 20).

The D-amino peptidase activity of YbxI was probed with the helpof the chromogenic substrate D-Ala paranitroanilide (39) (10mM in 20 mM Tris-HCl buffer, pH 8).

To test a possible inactivation or inhibition of YbxI by clavulanicacid, kinetic measurements were performed with 200 µMnitrocefin at 30°C in 50 mM sodium phosphate buffer (pH7.0), after preincubation of 0.34 µM YbxI with clavulanicacid concentrations ranging from 0 to 1 mM for 10 to 30 minat 37°C. The effect of NaCl was tested with nitrocefin concentrationsranging from 50 to 420 µM at 30°C in 50 mM sodiumphosphate buffer (pH 7.0) supplemented with 50 mM NaCl.

Interaction and hydrolysis of peptidoglycan. An 8-µg sample of purified YbxI protein was incubatedwith a suspension of Bacillus megaterium peptidoglycan (1.62mg per ml of 50 mM Tris-HCl buffer, pH 7.5, at 37°C) fordifferent times (30 min or 1, 2, 3, or 20 h). The variationof absorbance was monitored at 450 nm. Hen egg white lysozyme(4 µg in 50 mM Tris-HCl buffer, pH 7.5) was used as apositive control, under the same conditions.

Study of protein expression by RT-PCR. The isolation of the mRNA produced by B. subtilis 168 cellsin the exponential growth phase was carried out by using theSV Total RNA Isolation System kit (Promega). The presence ofybxI mRNA was probed by RT-PCR with the help of the Access RT-PCRSystem kit (Promega). The PCR fragments, amplified using theYbxI-up and YbxI-rp primers, were subjected to electrophoresisin a 1% agarose gel followed by ethidium bromide staining. Thepositive control was the B. subtilis yjbJ protein, which isa putative autolysin, using the primers 5'ATAGGATCCTTCGCGTAATAAACTGAAG3'(BSSLTBH1) and 5'ATACATATGCTGAACAGCGCGAATACAACA3' (BSSLNDEI1271).The same conditions were used for YbxI.

Sequence comparison. Comparison of YbxI amino acid sequence (accession number p54427)with the nonredundant EMBL-GenBank-SWISSPROT protein database(http://www.expasy.ch) was performed by using the Blast software.The multiple sequence alignment was made with the help of theMultalin software (5).

RESULTS AND DISCUSSION

Top

Results and Discussion

Comparison of YbxI with serine PREs. The polypeptide deduced from the nucleotide sequence of ybxIconsists of 268 amino acids, as shown in the sequence alignmentpresented in Fig. 2. The N-terminal region of the ybxI geneproduct contains a characteristic prokaryotic signal peptide;the mature protein would begin at Ala-24. According to thisfeature the ybxI gene product of B. subtilis 168 is expectedto be exported outside the cell.

View larger version (80K):
[in this window]
[in a new window]
FIG.2. Sequence alignment of class D ß-lactamases and C-terminal domains of penicillin receptors. Alignment of amino acid sequences of the YbxI protein; class D ß-lactamases OXA-20 (30), OXA-2 (7), OXA-15 (8), OXA-3 (37), PSE2 (19), OXA-11 (16), OXA-7 (38), OXA-5 (6), LCR1 (6), OXA-1 (32), OXA-18 (34), and OXA-9 (40); and the CTDs of penicillin receptors involved in the induction of ß-lactamases (B. licheniformis [B.li] BlaR [26] and S. aureus [S.au] BlaR [35] or methicillin-resistant S. aureus PBP [S. aureus MecR] [18]). The underlined sequence in YbxI corresponds to the signal peptide. In the consensus sequence, residues in uppercase letters are strictly conserved in all aligned sequences. The residues in lowercase letters are those conserved in more than 50% of the sequences. The other consensus symbols are as follows: ! is either I or V; $ is L or M; % is F or Y; and # is N, D, Q, or E. The residues involved in the active-site signatures of serine-PREs are underlined. Dots indicate deletions. Amino acid sequence alignments were performed with the Multalin program of the ExPAsy server (http://us.expasy.org/tools/#align) (5).

Blast results revealed 33.7% amino acid identity with the OXA-2class D ß-lactamase and 33% identities with the C-terminaldomains of the BlaR penicillin receptors of Bacillus licheniformisand Staphylococcus aureus (Fig. 2). No significant similaritieswere found with class A or class C ß-lactamases andDD-peptidases.

Heterologous expression of YbxI in E. coli and purification of the recombinant protein. To confirm the biocomputing results that indicated a putativemember of the class D ß-lactamases, the B. subtilisybxI gene was expressed in E. coli as described in Materialsand Methods. E. coli BL21 cells harboring pCIP 51 were inducedwith IPTG, and the recombinant mature YbxI protein was producedas a water-soluble periplasmic protein (Fig. 3, lanes 1 to 3),with two additional amino acids, Met-Asp, due to the PelB peptidesequence. The production of the mature YbxI was performed inLuria-Bertani medium (1 liter), and induction was carried outduring 4 h by addition of 0.5 mM IPTG when the culture densityreached an A₆₀₀ value of 0.8. After centrifugation and resuspensionof the cells in an isotonic buffer, the periplasmic proteinswere released by protoplasting the cells with the help of lysozyme.After centrifugation, the supernatant corresponding to the periplasmicextract contained most of the mature YbxI protein. The proteinwas purified to 95% homogeneity in a three-step procedure (Fig.3, lanes 4 to 6). At pH 8.5 in 50 mM Tris-HCl buffer, matureYbxI bound to the Source Q ion exchanger and was eluted at 500mM NaCl in the linear gradient. After dialysis against 20 mMpotassium acetate buffer, pH 5, and concentration by ultrafiltration,YbxI was purified by chromatography on a Source S column (elutionat 500 mM NaCl) followed by gel filtration on a Sephacryl S100column. The final yield of YbxI production was 10 mg/liter.Edman degradation of the purified protein yielded the MDASSAsequence. The mass spectrometer analysis showed a main peak(mean ± standard deviation) at 28,420 ± 5 Da (theoreticalmass: 28,419.15 Da).

View larger version (80K):
[in this window]
[in a new window]
FIG. 3. SDS-PAGE analysis of crude cellular extracts and at different stages of YbxI purification. Lanes 1 and 2, crude cellular extracts of noninduced and induced (0.5 mM IPTG) E. coli/pCIP 51, respectively; lane 3, periplasmic fraction after cell lysis; lanes 4 to 6, YbxI after Source 15Q, Source 15S, and Sephacryl S100 chromatography steps, respectively; MM, molecular mass markers. The arrow indicates the YbxI position.

Kinetic properties of purified YbxI. (i) ß-Lactamase activity. Table 2 summarizes the kinetic parameters for the hydrolysisof nine compounds representing the main families of ß-lactamantibiotics. With nitrocefin, initial rates were determinedat concentrations ranging from 65 to 600 µM, and the k_catand K_m values were obtained with the help of the Hanes linearizationmethod. Similar values were obtained by using complete timecourses and the integrated form of the Henri-Michaelis-Mentenequation. Incubation of YbxI with increasing concentrationsof clavulanic acid did not inactivate the enzyme. With oxacillin,a biphasic reaction was observed, a typical feature of turnoverkinetics by a number of class D ß-lactamases. Steady-staterates were determined for the second phase at substrate concentrationsranging from 100 to 1,000 µM, and the k_cat and K_m valueswere obtained with the help of the Hanes linearization method.The k_cat/K_m value for cephaloridine was determined on the basisof first-order time courses, with concentrations ranging from25 to 200 µM. With benzylpenicillin, substrate inhibitionwas observed. Golemi et al. (13) have shown that the class DOXA-10 ß-lactamase activity depends critically onan unusual carboxylation of lysine 70 for both the acylationand deacylation catalytic steps. The carboxylated Lys-70 wouldact as a general base to activate the serine hydroxyl in theacylation step. The same carboxylated lysine should also bein a suitable position to activate the incoming hydrolytic waterfor the deacylation event. So the carboxylation of this lysineis necessary for the activity of the OXA-10 class D ß-lactamase.To assay the putative activation of the mature YbxI by carboxylationof the active site-lysine residue (Lys-82, corresponding tothe class D Lys-70), its activity was assayed without supplementedbicarbonate, under degassed conditions, and in the presenceof various bicarbonate concentrations in 50 mM phosphate buffer,pH 7. Initial rates were determined for concentrations of nitrocefinranging from 40 to 500 µM using 0.07 µM enzyme.As shown in Fig. 4, an activation of the mature YbxI by bicarbonatewas recorded.

View this table:
[in this window]
[in a new window]
TABLE 2. Kinetic parameters for interaction between YbxI and various ß-lactam antibiotics^c

View larger version (29K):
[in this window]
[in a new window]
FIG. 4. Effect of bicarbonate on the rate of nitrocefin hydrolysis. The experiments were carried out in phosphate buffer (pH 7.0) that was degassed ( ${circ}$ ) or not degassed ( ${square}$ ), with addition of 0.150 ( ${triangleup}$ ), 3 (•), 6 ( ${diamond}$ ), 25 (x), and 50 ( ${diamondsuit}$ ) mM bicarbonate and with addition of 50 mM NaCl ( ${blacksquare}$ ). Initial rate (v₀) values were determined with 0.07 µM YbxI in a total volume of 500 µl. Error bars, standard deviations.

At pH 7.0 and high nitrocefin concentration, the presence of6 mM HCO₃^- ions increases the activity versus nitrocefin byabout four- to fivefold, and further addition of HCO₃^- has littleor a somewhat-inhibitory influence. By contrast at low substrateconcentrations (<K_m) the effect of HCO₃^- is much less significant.This suggests that HCO₃^- increases both k_cat and K_m but doesnot strongly influence k_cat/K_m. The presence of 50 mM NaCl doesnot significantly affect the kinetic parameters of nitrocefinhydrolysis (Fig. 4). The presence of 50 mM bicarbonate doesnot modify the biphasic kinetics observed with oxacillin.

(ii) Trapping of an acyl-enzyme. The catalytic pathway of the hydrolysis of a ß-lactamantibiotic by a serine ß-lactamase involves the formationof an acyl-enzyme between the active serine and the carbonylof the opened ß-lactam ring (Fig. 1). To demonstrateacylation of the mature YbxI by a ß-lactam, a timecourse experiment was carried out by incubating the purifiedenzyme with a fluorescent derivative of ampicillin (Ampi-flu)(28). In each sample, the reaction was stopped by addition ofSDS-PAGE loading buffer, the protein was denatured by heating,and the acyl-enzyme was separated from the excess of antibioticby electrophoresis. As shown in Fig. 5, a fluorescent band of28.4 kDa, corresponding to the molecular mass of mature YbxI,was detected, which confirmed the formation of an acyl-enzyme.The B. licheniformis BlaR carboxy-terminal domain (BlaR-CTD)was used as a positive control and molecular mass marker andgave a fluorescent band at 25 kDa.

View larger version (24K):
[in this window]
[in a new window]
FIG. 5. Time course analysis of YbxI acylation by fluorescent ampicillin (Ampi-flu). SDS-PAGE and fluorography of YbxI (85 pmol) after incubation (0, 10, 20, 40, 60, and 80 min) with Ampi-flu (500 pmol). BlaR-CTD (25 kDa) (400 pmol) was used as a positive control and was incubated with Ampi-flu for 15 min.

When YbxI was incubated with Ampi-flu for 90 min, added withthe TEM1 ß-lactamase, and further incubated, no degradationof the fluorescent complex was observed after 24 h (data notshown).

DD-Peptidase and D-aminopeptidase activities. The DD-carboxypeptidase activity was assayed by incubating matureYbxI (0.2 µM) with Ac₂-Lys-D-Ala-D-Ala (18) and S2a thioester(1) substrates. No hydrolysis of these compounds was observed.Similarly, no peptidoglycan hydrolyzing activity was found.The same negative result was obtained with D-Ala-paranitroanilide(39), a substrate used for the kinetic study of the Ochrobacteriumanthropi D-aminopeptidase (2), another member of the serinePRE family.

RT-PCR analysis. The expression of the ybxI gene was analyzed by RT-PCR. TotalmRNAs were isolated from B. subtilis cells in exponential growth,and attempts to amplify the mRNA were made with the help ofYbxI-up and YbxI-rp primers. After amplification and electrophoresison agarose gel, no YbxI transcript could be detected in theabsence or presence of ß-lactam stress (cephalosporinC, 2.5 µg/ml) (Fig. 6). As a positive control the yjbJgene was used, which codes for a putative autolysin constitutivelyexpressed by the strain.

View larger version (49K):
[in this window]
[in a new window]
FIG. 6. RT-PCR analysis of ybxI transcripts in B. subtilis. RT-PCR analysis by agarose gel electrophoresis of ybxI transcripts in B. subtilis in the presence or in absence of a ß-lactam stress compound. Abbreviations: NS, nonstressed cells; S, cells stressed by the presence of 2.5 µg of cephalosporin C; MM,: molecular mass marker. Lanes 1 to 4, yjbJ control; lane 1, RT-PCR NS; lane 2, PCR NS; lane 3, RT-PCR S; lane 4, PCR S; Lanes 5 to 8, ybxI; lane 5, RT-PCR NS; lane 6, PCR NS; lane 7, RT PCR S; lane 8, PCR S; Lanes 9 and 10 correspond to the PCR products of ybxI and yjbJ, respectively, obtained with the genomic DNA of B. subtilis 168.

Sequence alignments. Figure 2 shows the comparison of sequences of YbxI, the BlaR-CTDdomain of B. licheniformis (26), the BlaR and MecR equivalentdomains of Staphylococcus aureus (18, 35), and several classD ß-lactamases: OXA-2 (7) and PSE-2 (OXA-10) (19)of Salmonella enterica serovar Typhimurium; OXA-11 (16), OXA-5(6), OXA-3 (37), OXA-15 (8), OXA-18 (34), OXA-20 (30), and LCR-1(6) of Pseudomonas aeruginosa; OXA-7 (38) and OXA-1 (32) ofE. coli; and OXA-9 (40) of Klebsiella pneumoniae. The majordifferences between these proteins result from either deletionsor insertions. The consensus shows several conserved residues,including the amino acids forming the active-site elements.

Conclusion. This study describes the production in E. coli, the purification,and the kinetic study of the putative ß-lactamaseencoded by the B. subtilis 168 ybxI gene. The predicted sequenceof the encoded protein contains an N-terminal signal peptide,and the mature protein shows a high degree of identity to classD ß-lactamases and the C-terminal domain of penicillinreceptors. In addition, multiple alignments of these sequencesconfirmed that mature YbxI possesses all the conserved sequencemotifs of the serine PRE family. This feature was well highlightedby the ability of YbxI to form an acyl-enzyme with Ampi-flu.The kinetic survey shows that the ybxI gene, previously thoughtto encode a class D ß-lactamase, does not encode areal ß-lactamase and is devoid of DD-peptidase andD-aminopeptidase activities, at least with the tested substratesassayed. Indeed, from the kinetic parameters presented in Table2, YbxI seems to be a PBP with low ß-lactamase activityon a few compounds. The rate of hydrolysis of either cephalosporinC, cloxacillin or cefoxitin is very low. The highest valueswere obtained with nitrocefin, for which the k_cat/K_m value was $~$ 8,054 M^-1 s^-1. If we compare these values with those of theclass D ß-lactamase OXA10 (PSE2) from S. entericaserovar Typhimurium and PBP5 of Enterococcus hirae ATCC 9790,which exhibit k_cat/K_m values of $~$ 6.6 x 10⁶ and $~$ 20 M^-1 s^-1, respectively,YbxI has an activity intermediate between those of a PBP anda ß-lactamase.

The BlaR and MecR C-terminal domains are penicillin receptorswhose sequences are related to those of class D enzymes, butthey form stable adducts with ß-lactams and do nothydrolyze depsipeptides (9). The activity of several class Denzymes has been shown to significantly increase upon carboxylationof the active-site Lys-70 side chain. For the BlaR receptors,contradictory results have been obtained (14, 23). In the presenceof HCO₃^- ions, the rate of acylation of S. aureus BlaR proteinby ß-lactams seems to increase at pH 7.0, but underthe same conditions that of B. licheniformis BlaR does not appearsensitive to the presence of HCO₃^- ions and the X-ray structureclearly highlights a normal Lys residue. The results obtainedhere with YbxI remain ambiguous. The influence of HCO₃^- on theactivity of YbxI versus nitrocefin might be due to carboxylationof Lys-82, but this remains to be established by determiningthe 3D structure of the protein in the absence and presenceof HCO₃^-. One major difference between the class D ß-lactamase,YbxI, and BlaR-CTD is the nature of the third residue of thesecond element, Ile for YbxI, Val for class D enzymes, and apolar residue (Thr or Asn) for the BlaR/MecR group of penicillinsensor proteins. It has been suggested that the class D Valresidue might contribute to the substrate specificity of theclass D enzymes by providing interactions with the isoxazoylmoiety of oxacillins. However, the efficient hydrolysis of penicillinscatalyzed by the class D ß-lactamases would rest onthe carboxylation of the Lys residue of the active-site serineelement. One can tentatively explain the poor activity of YbxIby the fact that in the second element the bulkier Ile residuewould interfere with an efficient binding of the antibioticside chain. However, despite these considerations it is stilldifficult at this stage to determine with certainty why YbxIand BlaR-CTD are not ß-lactamases. The determinationof their 3D structures acylated by, or complexed with, a ß-lactamantibiotic may answer this question. The physiological roleof YbxI in B. subtilis 168 remains unknown. The RT-PCR experimentsshowed that the mRNA corresponding to a ybxI transcript is notdetectable in the bacterial cell in the exponential growth phase,simultaneously confirming the absence of a promoter upstreamof ybxI and that the product of this gene is not essential forcell growth and sporulation (25). The members of the serinePRE superfamily show a great diversity in their catalytic activities.However, they share a common feature: the chemical bond hydrolyzedis always linked to a chiral D center. For this reason, it canbe hypothesized that YbxI might catalyze a reaction involvinga D center.

ACKNOWLEDGMENTS

This work was supported by the Belgian Program of InteruniversityPoles of Attraction initiated by the Federal office for Scientific,Technical and Cultural Affaires (PAI no. P5/33) and the FondNational de la Recherche Scientifique (FNRS), créditaux chercheurs no. 1.5201.02 and FRFC no. 2.4508.01.

B.J. is an FNRS associate researcher. M.-L.C., S.H., S.L.B.,and C.B. are fellows of the Fonds pour la Formation àla Recherche dans l'Industrie et l'Agriculture (FRIA, Brussels,Belgium).

FOOTNOTES

* Corresponding author. Mailing address: Centre d'Ingénierie des Protéines, Institut de Chimie B6a, Université de Liège, Sart Tilman, B-4000 Liège, Belgium. Phone: (32) 4 366 29 54. Fax: (32) 4 366 33 64. E-mail: bjoris{at}ulg.ac.be.

REFERENCES

Top