This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Villegas, M. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Villegas, M. V.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, February 2004, p. 629-631, Vol. 48, No. 2
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.2.629-631.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

CTX-M-12 ß-Lactamase in a Klebsiella pneumoniae Clinical Isolate in Colombia

Maria Virginia Villegas,1 Adriana Correa,1 Federico Perez,1 Tania Zuluaga,1 Marcela Radice,2 Gabriel Gutkind,2 José María Casellas,3 Juan Ayala,4 Karen Lolans,5 John P. Quinn,5* and the Colombian Nosocomial Resistance Study Group1,{dagger}

Línea de Resistencia Bacteriana, Centro Internacional de Entrenamiento e Investigaciones Médicas (CIDEIM), Cali, Colombia,1 Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junín 954, 1113 Buenos Aires,2 División Microbiología Clínica, Centro de Investigaciones Biológicas y Clínicas (CIBIC), Rosario, Argentina,3 Centro de Biología Molecular "Severo Ochoa" (CSIC), Universidad Autónoma de Madrid, Campus de Cantoblanco, 28049 Madrid, Spain,4 Division of Infectious Diseases, Rush Medical School, Cook County Hospital, Chicago, Illinois 606125

Received 27 June 2003/ Returned for modification 23 October 2003/ Accepted 6 November 2003


arrow
ABSTRACT
 
We describe the detection of the CTX-M-12 ß-lactamase from a clinical isolate of Klebsiella pneumoniae in Colombia. Screening of nosocomial Klebsiella spp. and Escherichia coli isolates from a network of teaching hospitals revealed the presence of CTX-M enzymes in multiple cities. This is the first description of CTX-M in Colombia.


arrow
INTRODUCTION
 
Extended-spectrum ß-lactamases (ESBLs) appear to be more common than South America than in North America (19). In addition, the type of enzymes that are prevalent is different, because the CTX-M class appears to be the dominant class in some countries, notably Argentina (2, 10, 17). CTX-M class enzymes have not been reported previously in Colombia. The CTX-M enzymes are a new, rapidly growing family of Ambler class A (Bush group 2be) ESBLs that are plasmid mediated (1, 9) and have been reported worldwide. These enzymes may be even more common than current reports suggest due to inadequate detection, because some laboratories may not be screening correctly. CTX-M enzymes hydrolyze cefotaxime and ceftriaxone more efficiently than ceftazidime, so that screening with ceftazidime alone may easily miss these enzymes (10, 17). Nevertheless, the activity of these enzymes against ceftazidime is highly variable; some strains appear susceptible, while others are frankly resistant.

In 2002, we formed a network of nine teaching hospitals in three cities (Bogotá, Medellín, and Cali) in Colombia. During the first 6 months of 2002, all nosocomial isolates of Escherichia coli and Klebsiella spp. that showed an ESBL phenotype (resistance to any extended-spectrum cephalosporin or aztreonam) were sent to our central laboratory at the Centro Internacional de Entrenamiento e Investigaciones Médicas (CIDEIM). Bacterial identification was confirmed and antibiotic susceptibility testing was performed on each of the isolates received at CIDEIM by using the VITEK system (BioMerieux, Lyon, France) according to the manufacturer's instructions. Pure strains with no more than 24 h of growth were used. The oxidase test was performed, and a 1.0 McFarland suspension was prepared in 0.85% saline solution, which was used to inoculate the VITEK cards. GNI+ cards were used for identification, and GNS-121 and GNS-118 cards were used to determine susceptibility. The GNS-121 card contained an ESBL confirmatory test that uses ceftazidime and cefotaxime with and without clavulanic acid. A growth reduction of >=50% in the medium containing clavulanic acid confirms the production of ESBLs. E. coli ATCC 25922, and Klebsiella pneumoniae ATCC 700603 were used as internal quality control strains for MIC determinations and the ESBL confirmatory test, respectively.

ESBL characterization by isoelectric focusing (IEF) was done by the method described by Matthew et al. (13). Reference bacterial strains known to produce TEM-6, TEM-7, SHV-1, and TEM-9 were used as controls. Clinical isolates of ESBL-producing Klebsiella spp. and E. coli that were highly resistant to cefotaxime were subjected to IEF. Seven were found to have isoelectric points above 8, and those isolates were screened for CTX-M genes by a PCR method. Plasmid DNA was released from the cells by alkaline lysis (5). Five microliters of plasmid DNA was mixed with 2 µl (10 mM) of deoxynucleoside triphosphates (dNTPs) (Pharmacia Biotech, Peapack, N.J.), 16 µl of each primer, 10 µl of 10x reaction buffer, 44.5 µl of MilliQ sterile water, and 0.5 µl of Taq DNA polymerase 5 U/µl (Promega, Madison, Wis.). Primers derived from a representative enzyme of each group of cefotaximases were used. For the CTX-M-1 group (CTX-M-1, -3, -10, -11, -12, -15, and -22 and UOE-1), primers 5'CGCTTTGCGATGTGCAG 3' and 5'ACCGCGATATCGTTGGT3' were used. For the CTX-M-2 group (CTX-M-2, -4, -5, -6, and -7 and Toho-1), primers 5'TTAATGACTCAGAGCATTC3' and 5'GATACCTCGCTCCATTTATTG3' (Gibco BRL, Gaithersburg, Md.) were used. For the CTX-M-8 group (CTX-M-8 and -25), primers 5'TGAATACTTCAGCCACACG3' and 5'TAGAATTAATAACCGTCGGT3' were used. Finally, for the CTX-M-9 group (CTX-M-9, -13, -14, -15, -16, -17, -18, -19, and -21 Toho-2 and -3), primer 5'CGCTTTATGCGCAGACGA3' was used. A Mastercycler 5330 (Eppendorf, Hamburg, Germany) apparatus was used with the following parameters: DNA denaturation during 5 min at 95°C; 20 cycles of denaturation for 1 min at 95°C, annealing for 1 min at 55°C, and polymerization 1 min at 72°; and a final extension of 20 min at 72°C.

We used a clinical isolate of K. pneumoniae from a patient with a nosocomial surgical wound infection (our index isolate) for sequencing of CTX-M genes. The PCR product was cloned at the SmaI site of a pK19 vector (kanamycin resistance) and introduced by transformation into competent E. coli Top10 cells. Transformant clones were selected on Luria-Bertani agar plates, containing IPTG (isopropyl-ß-D-thiogalactopyranoside; 1 mM), X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-thiogalactopyranoside; 40 µg/ml), and kanamycin (30 µg /ml). Sequencing of this gene was performed on both DNA strands, and these results were reproducible. The same plasmid DNA was used as templates in PCRs for SHV genes and PER-2 genes by using specific primers as previously described (4). Pulsed-field gel electrophoresis (PFGE) of chromosomal DNA was done by the method of Matushek et al. (14).

Susceptibility testing (by VITEK) showed that the MICs of cefotaxime and ceftriaxone for all seven isolates were >32 µg/ml and that the isolates had variable susceptibility to cefepime (MICs, 4 to 32 µg/ml), as well as ceftazidime (MICs for three isolates >32, while four isolates remained susceptible), and all isolates were susceptible to imipenem and meropenem (MICs, 2 to 4 µg/ml). Antibiotic susceptibility testing of the index isolate of K. pneumoniae was repeated by broth microdilution with the following MICs: ceftazidime, 128 µg/ml; cefotaxime, 32 µg/ml; and ceftriaxone, 32 µg/ml. This isolate had an intermediate level of susceptibility to cefepime (MIC, 16 µg/ml) and was susceptible to imipenem and meropenem (MIC of 2 µg/ml for both). Furthermore, by broth macrodilution, the MICs for the related transformant E. coli pK19-1338 were as follows: ceftazidime, <8 µg/ml; cefotaxime, >128 µg/ml; and ceftriaxone, >256 µg/ml.

Screening with PCR probes specific for different CTX-M genes confirmed the presence of CTX-M group 1 in our seven isolates. These isolates were collected in three different hospitals from Bogotá, Medellín, and Cali. The CTX-M enzymes detected were harbored by strains of Klebsiella oxytoca, K. pneumoniae, and E. coli. Two of the CTX-M-producing K. pneumoniae isolates came from the same hospital. Sequence data were obtained for the CTX-M gene from a transformant E. coli isolate by using our index patient's K. pneumoniae isolate as a donor. The results indicated the presence of CTX-M-12 (GenBank accession no. AF305837), an enzyme reported only once previously from an isolate from Kenya (12). PCR-based screening for PER-2 and SHV genes was negative in all these strains. PFGE of the four CTX-M-harboring K. pneumoniae isolates proved that these strains were not clonal (data not shown).

First described at the beginning of the 1990s (3), the CTX-M class of enzymes are a fast-growing family that comprises 19 enzymes and the related enzymes Toho-1 and Toho-2. CTX-M isolates have been found in various species of the family Enterobacteriaceae from different geographic areas: mainly during nosocomial outbreaks that occurred in Japan (11); Europe (7, 8, 15); South America (3, 17); and, more recently, Africa (12), China (18), and Korea (16). A few isolates have recently been described in the United States (E. S. Moland, J. A. Black, A. Hossain, N. D. Hanson, and K. S. Thomson, Letter, Antimicrob. Agents Chemother. 47:2382-2383, 2003). The present study shows that CTX-M enzymes occur in Colombia as well.

It is very difficult to predict the origin of CTX-M enzymes because of the divergence in amino acid sequences among the subgroups (between 70 and 99% sequence identity) (6), as well as the geographical dispersion of the host strains. Efforts should be made to screen for them by always testing susceptibilities to cefotaxime, ceftriaxone, or cefepime on a routine basis, along with susceptibility to ceftazidime (17). Optimal therapy for organisms harboring these enzymes has not been defined. The carbapenems appear to be the most active compounds in vitro, and thus they may be the most reasonable agents until more clinical data are available.

In the present study, we report the first CTX-M-12 type ß-lactamase found in Colombia and also, to our knowledge, the first isolation of this enzyme outside of Kenya. The CTX-M-12 type was previously isolated from K. pneumoniae isolates from an outbreak among six newborn babies in Kenya at the National Hospital in Nairobi (12). It is noteworthy that in the Kenya study, both the clinical Klebsiella isolates and their E. coli transconjugants were resistant to cefotaxime (MIC, 24 µg/ml by E-test) but susceptible (MIC, 1 µg/ml) to ceftazidime. In our index case, the parent K. pneumoniae isolate was ceftazidime, cefotaxime, and ceftriaxone resistant, while its E. coli transformant was susceptible to ceftazidime but highly resistant to cefotaxime and ceftriaxone. Our index isolate presumably owes its high-grade resistance to ceftazidime to the presence of additional ESBLs of the TEM and/or SHV families. IEF studies of this isolate revealed multiple bands with pIs of 5.2, 7.3, 8.4, and 8.9. A more comprehensive review of the organisms from the network and further studies on the identity of the other CTX-M enzymes we detected will be the subject of subsequent reports.


arrow
ACKNOWLEDGMENTS
 
We thank the participating institutions of the Colombian Nosocomial Resistance Study Group: from Cali, CIDEIM (Sandra Reyes and Maria Consuelo Miranda), Hospital Universitario del Valle (Ernesto Martínez, Lena Barrera, Luz Marina Gallardo, and Alba Lucía Bohorquez), Fundación Valle del Lili (Juan Diego Velez, Maria del Pilar Crespo, Claudia Rocio Castañeda, Monica Recalde, and Alexandra Cossio), and Clínica de Occidente (Luz Angela Castro and Maria Luz Lucumi); from Bogotá, Hospital Militar Central (Carlos Perez, Matilde Mendez, Maria Elvira Martínez, and Lilia Fernanda Tovar), Clínica San Pedro Claver (Carlos Alquichire, Martha Ruiz, Julia Santos, Pilar Hurtado, Gladys Ceballos, and Maria Mercedes Muñoz), Hospital Central de la Policía (Henry Mendoza, Olga Pinilla, Alba Lucia Sanín, Janeth Hernandez, Nancy Botia, and Cristina Matiz), and Instituto Nacional de Cancerología (Sonia Cuervo, Ruth Quevedo, Patricia Arroyo, Diana Bermudez, and Carlos Revelo); and from Medellín, Hospital Pablo Tobón Uribe (Carlos Ignacio Gomez, Jaime Lopez, Monica Cuartas, Celina Gomez, and Ana Lucia Correa) and Clínica de las Américas (Julian Betancourth, Esteban Echavarria, Juan David Villa, and Ana Cristina Quiroga).

The conformation of the network of institutions from the Colombian Nosocomial Resistance Study Group and this study was made possible thanks to the support of Astra Zeneca, Bristol Myers Squibb, Glaxo SmithKline Beecham, Roche, Wyeth, and CIDEIM. We thank the Chicago Infectious Diseases Research Institute for financial support. We also thank the Argentinian Health Department and ANPCYTfor collaboration through financing the laboratory of G. Gutkind, who is a career research member of CONICET.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Infectious Diseases, Rush Medical School, Cook County Hospital, 1900 W Polk, Rm. 1258, Chicago, IL 60612. Phone: (312) 633-7955. E-mail: john_p_quinn{at}rush.edu. Back

{dagger} Contributing members of the Colombian Nosocomial Resistance Study Group are listed in the Acknowledgments. Back


arrow
REFERENCES
 
    1
  1. Ambler, R. P., F. W. Coulson, J. M. Frére, J. M. Ghuysen, B. Joris, M. Forsman, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard numbering scheme for the class A ß-lactamases. J. Biochem. 276:269-270.
  2. 2
  3. Bauernfeind, A., J. M. Casellas, M. Goldberg, R. Holley, R. Jungwirth, P. Mangold, T. Rohnisch, S. Schweirghart, and R. Wilhelm. 1992. A new plasmidic cefotaximase from patients infected with Salmonella typhimurium. Infection 20:158-163.[CrossRef][Medline]
  4. 3
  5. Bauernfeind, A., H. Grimm, and S. Schweighart. 1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection 18:294-298.[CrossRef][Medline]
  6. 4
  7. Bauernfeind, A., I. Stemplinger, R. Jungwirth, P. Mangold, S. Amann, E. Akalin, Ö. Ang, C. Bal, and J. M. Casellas. 1996. Characterization of ß-lactamase gene blaPER-2, which encodes an extended-spectrum class A ß-lactamase. Antimicrob. Agents Chemother. 40:616-620.[Abstract]
  8. 5
  9. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523.[Abstract/Free Full Text]
  10. 6
  11. Bonnet, R., C. Dutour, J. L. M. Sampaio, C. Chanal, D. Sirot, R. Labia, C. De Champs, and J. Sirot. 2001. Novel cefotaximase (CTX-M-16) with increased catalytic efficiency due to substitution Asp-240-> Gly. Antimicrob. Agents Chemother. 45:2269-2275.[Abstract/Free Full Text]
  12. 7
  13. Bou, G., M. Cartelle, M. Tomas, D. Canle, F. Molina, R. Moure, J. M. Eiros, and A. Guerrero. 2002. Identification and broad dissemination of the CTX-M-14 ß-lactamase in different Escherichia coli strains in the northwest area of Spain. J. Clin. Microbiol. 40:4030-4036.[Abstract/Free Full Text]
  14. 8
  15. Bradford, P. A., Y. Yang, D. Sahm, I. Grope, D. Gardovska, and G. Storch. 1998. CTX-M-5, a novel cefotaxime-hydrolyzing ß-lactamase from an outbreak of Salmonella typhimurium in Latvia. Antimicrob. Agents Chemother. 42:1980-1984.[Abstract/Free Full Text]
  16. 9
  17. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for ß-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233.[Medline]
  18. 10
  19. Casellas, J. M., G. Tomé, C. Bantar, P. Bertolini, N. Blázquez, N. Borda, E. Couto, N. Cudmani, J. Guerrera, M. J. Juárez, T. López, A. Littvik, E. Méndez, R. Notario, G. Ponce, M. Quinteros, F. Salamote, M. Sparo, E. Sutich, S. Vaylet, and L. Wolff. 2003. Argentinian collaborative multicenter study on the in vitro comparative activity of piperacillin-tazobactam against selected bacterial isolates recovered from hospitalized patients. Diagn. Microbiol. Infect. Dis. 47:527-537.[CrossRef][Medline]
  20. 11
  21. Ishii, Y., A. Ohno, H. Taguchi, S. Imajo, M. Ishiguro, and H. Matsuzawa. 1995. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A ß-lactamase isolated from Escherichia coli. Antimicrob. Agents Chemother. 39:2269-2275.[Abstract]
  22. 12
  23. Kariuki, S., J. E. Corkill, G. Revathi, R. Musoke, and C. A. Hart. 2001. Molecular characterization of a novel plasmid-encoded cefotaximase (CTX-M-12) found in clinical Klebsiella pneumoniae isolates from Kenya. Antimicrob. Agents Chemother. 45:2141-2143.[Abstract/Free Full Text]
  24. 13
  25. Matthew, M., A. M. Harris, M. J. Marshall, and G. W. Ross. 1975. The use of analytical isoelectric focusing for detection and identification of beta-lactamases. J. Gen. Microbiol. 88:169-178.[Medline]
  26. 14
  27. Matushek, M. G., M. J. M. Bonten, and M. K. Hayden. 1996. Rapid preparation of bacterial DNA for pulsed-field gel electrophoresis. J. Clin. Microbiol. 34:2598-2600.[Abstract]
  28. 15
  29. Pagani, L., E. Dell'Amico, R. Migliavacca, M. M. D'Andrea, E. Giacobone, G. Amicosante, E. Romero, and G. M. Rossolini. 2003. Multiple CTX-M-type extended-spectrum ß-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J. Clin. Microbiol. 41:4264-4269.[Abstract/Free Full Text]
  30. 16
  31. Pai, H., E.-H. Choi, H.-J. Lee, J. Y. Hong, and G. A. Jacoby. 2001. Identification of CTX-M-14 extended-spectrum ß-lactamase in clinical isolates of Shigella sonnei, Escherichia coli, and Klebsiella pneumoniae in Korea. J. Clin. Microbiol. 39:3747-3749.[Abstract/Free Full Text]
  32. 17
  33. Quinteros, M., M. Radice, N. Gardella, M. M. Rodríguez, N. Costa, D. Korbenfeld, E. Couto, G. Gutkind, and Microbiology Study Group. 2003. Extended-spectrum ß-lactamases in Enterobacteriaceae in Buenos Aires, Argentina, public hospitals. Antimicrob. Agents Chemother. 47:2864-2867.[Abstract/Free Full Text]
  34. 18
  35. Wang, H., S. Kelkar, W. Wu, M. Chen, and J. P. Quinn. 2003. Clinical isolates of Enterobacteriacae harboring extended-spectrum ß-lactamases: prevalence of CTX-M-3 at a hospital in China. Antimicrob. Agents Chemother. 47:790-793.[Abstract/Free Full Text]
  36. 19
  37. Winokur, P., R. Canton, J. M. Casellas, and N. Legakis. 2001. Variations in the prevalence of strains expressing an extended-spectrum beta-lactamase phenotype and characterization of isolates from Europe, the Americas, and the Western Pacific region. Clin. Infect. Dis. 32(Suppl. 2):S94-S103.


Antimicrobial Agents and Chemotherapy, February 2004, p. 629-631, Vol. 48, No. 2
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.2.629-631.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Bae, I. K., Lee, Y.-N., Hwang, H. Y., Jeong, S. H., Lee, S. J., Kwak, H.-S., Song, W., Kim, H. J., Youn, H. (2006). Emergence of CTX-M-12 extended-spectrum {beta}-lactamase-producing Escherichia coli in Korea. J Antimicrob Chemother 58: 1257-1259 [Abstract] [Full Text]  
  • Valenzuela de Silva, E. M., Mantilla Anaya, J. R., Reguero Reza, M. T., Gonzalez Mejia, E. B., Pulido Manrique, I. Y., Dario Llerena, I., Velandia, D. (2006). Detection of CTX-M-1, CTX-M-15, and CTX-M-2 in Clinical Isolates of Enterobacteriaceae in Bogota, Colombia.. J. Clin. Microbiol. 44: 1919-1920 [Full Text]  
  • Soge, O. O., Queenan, A. M., Ojo, K. K., Adeniyi, B. A., Roberts, M. C. (2006). CTX-M-15 extended-spectrum {beta}-lactamase from Nigerian Klebsiella pneumoniae. J Antimicrob Chemother 57: 24-30 [Abstract] [Full Text]  
  • Pallecchi, L., Malossi, M., Mantella, A., Gotuzzo, E., Trigoso, C., Bartoloni, A., Paradisi, F., Kronvall, G., Rossolini, G. M. (2004). Detection of CTX-M-Type {beta}-Lactamase Genes in Fecal Escherichia coli Isolates from Healthy Children in Bolivia and Peru. Antimicrob. Agents Chemother. 48: 4556-4561 [Abstract] [Full Text]  
  • Rodriguez, M. M., Power, P., Radice, M., Vay, C., Famiglietti, A., Galleni, M., Ayala, J. A., Gutkind, G. (2004). Chromosome-Encoded CTX-M-3 from Kluyvera ascorbata: a Possible Origin of Plasmid-Borne CTX-M-1-Derived Cefotaximases. Antimicrob. Agents Chemother. 48: 4895-4897 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Villegas, M. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Villegas, M. V.