This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ubukata, K.
Right arrow Articles by Sunakawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ubukata, K.
Right arrow Articles by Sunakawa, K.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, May 2004, p. 1488-1494, Vol. 48, No. 5
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.5.1488-1494.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Antibiotic Susceptibility in Relation to Penicillin-Binding Protein Genes and Serotype Distribution of Streptococcus pneumoniae Strains Responsible for Meningitis in Japan, 1999 to 2002

Kimiko Ubukata,1* Naoko Chiba,1 Keiko Hasegawa,1 Reiko Kobayashi,2 Satoshi Iwata,3 and Keisuke Sunakawa1

Kitasato Institute for Life Sciences and Graduate School of Infection Control Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku,1 Department of Pediatrics, Tokyo National Medical Center, Higashigaoka, Meguro-ku, Tokyo,3 Pharmaceutical Center, Meiji Seika Kaihsha, Morookacho, Kohoku-ku, Yokohama, Japan2

Received 5 September 2003/ Returned for modification 30 November 2003/ Accepted 31 January 2004


arrow
ABSTRACT
 
The antibiotic susceptibilities, genotypes of penicillin (PEN)-binding protein genes (pbp), and serotype distributions of Streptococcus pneumoniae isolates from meningitis patients were investigated by a nationwide surveillance group in Japan between 1999 and 2002. We analyzed 146 isolates from children (<=17 years old) and 73 from adults (>=18 years old). Isolates with or without abnormal pbp1a, pbp2x, or pbp2b genes identified by PCR were classified into six genotype patterns and 90% MIC (MIC90) values for PEN: (i) strains with three normal genes (17.2% of isolates; MIC90, 0.031 µg/ml); (ii) strains with abnormal pbp2x (22.1%, 0.063 µg/ml); (iii) strains with abnormal pbp2b (1.0%, 0.125 µg/ml); (iv) strains with abnormal pbp2x and pbp2b (7.4%, 0.25 µg/ml); (v) strains with abnormal pbp1a and pbp2x (12.7%, 0.25 µg/ml); and (vi) strains with three abnormal PBP genes (39.7%, 4 µg/ml), which are termed genotypic PEN-resistant S. pneumoniae (gPRSP). Panipenem, a carbapenem, showed an excellent MIC90 (0.125 µg/ml) against gPRSP, followed by meropenem and vancomycin (0.5 µg/ml), cefotaxime and ceftriaxone (1 µg/ml), and ampicillin (4 µg/ml). Strains of gPRSP were significantly more prevalent in children (45.2%) than in adults (27.4%). The most frequent serotypes were 6B, 19F, 23F, 6A, and 14 in children and 23F, 22, 3, 10, 6B, and 19F in adults. Serotypes 6B, 6A, 19F, 23F, and 14 predominated among gPRSP. In children, 7- and 11-valent pneumococcal conjugate vaccines would cover 76.2 and 81.3% of isolates, respectively, although coverage would be lower in adults (43.9 and 56.0%, respectively). These findings suggest the need for early introduction of pneumococcal conjugate vaccines and continuous bacteriological surveillance for meningitis.


arrow
INTRODUCTION
 
Streptococcus pneumoniae is a common etiologic agent of serious invasive infections, with high morbidity and mortality in children and adults, such as meningitis, septicemia, and pneumonia (23, 29). The evolution of strains of S. pneumoniae resistant to penicillin G (PEN) and broad-spectrum cephalosporin antibiotics has created difficulties worldwide in selecting an appropriate chemotherapeutic agent (2).

Surveillance studies of antibiotic susceptibility, serotype distribution of causative strains, and mortality rate in meningitis have been carried out nationwide in many countries (8, 11, 15, 20, 21, 28, 33, 36, 39, 43).

In Japan, prevalence of PEN-resistant S. pneumoniae (PRSP) among clinical isolates from acute otitis media and respiratory tract infections (RTIs) has been increasing rapidly, especially in younger children (40, 41). In parallel with overall increases in incidence of PRSP, meningitis caused by PRSP is being reported increasingly throughout Japan (4). As investigators in that country, we felt that nationwide surveillance had become crucial given increasing isolation of resistant strains that could cause meningitis, including PRSP, as well as ampicillin (AMP)- and cephalosporin-resistant strains of Haemophilus influenzae type b, the most frequent etiologic agent of bacterial meningitis. In addition, accurate up-to-date data are critical to help decision making for introduction of new conjugate antipneumococcal vaccines appropriate to the country and its population in consideration of serotype distributions among people and geographic areas (19, 38).

Based on these considerations, we organized a study group, the Nationwide Surveillance for Bacterial Meningitis (NSBM), in 1999. One of the group's objectives was to characterize S. pneumoniae and H. influenzae isolates responsible for meningitis in terms of serotype and antimicrobial resistance according to gene alteration.

This is the first report in Japan describing susceptibilities of isolates from pneumococcal meningitis to intravenous ß-lactam antibiotics and vancomycin, along with their genotypes of PEN-binding protein (PBP) genes and serotypes.


arrow
MATERIALS AND METHODS
 
Strains. The NSBM study was made possible by the participation of the bacteriology divisions of 226 medical institutions nationwide between 1999 and 2002. A total of 219 isolates of S. pneumoniae from patients with meningitis were collected in our laboratory (Kitasato Institute for Life Sciences, Kitasato University). Serotypes and antibiotic susceptibilities based on PCR results for PBP genes were determined promptly in our laboratory and then sent the same day to each bacteriology division by facsimile and e-mail. We also received cerebrospinal fluid (CSF) from 15 patients with meningitis. Direct PCR examination was used to identify S. pneumoniae in these samples (see below).

All clinical isolates were grown on sheep blood agar (Nippon Becton Dickinson, Tokyo, Japan) at 37°C in an atmosphere containing 5% CO2, and a single colony was isolated for storage in 10% skim milk (Difco Laboratories, Detroit, Mich.) at –80°C. Identification of isolates as S. pneumoniae was confirmed by PCR amplification of the autolysin (lytA) gene (18).

Susceptibility testing. MICs of ß-lactam antibiotics and vancomycin against S. pneumoniae were determined by an agar dilution method using Mueller-Hinton agar (MH; Difco Laboratories) supplemented with 5% defibrinized sheep blood (32). Bacterial inocula were prepared according to a previously reported method (40). Antibiotics used in the present study were PEN and AMP (Meiji Seika Kaisha, Tokyo, Japan); cefotaxime (CTX; Nippon Hoechst Marion Roussel, Tokyo, Japan), ceftriaxone (CRO; Nippon Roche, Tokyo, Japan), panipenem (PAM; Sankyo, Tokyo, Japan), meropenem (MEM; Sumitomo Pharmaceuticals, Tokyo, Japan), and vancomycin (VAN; Shionogi, Osaka, Japan). S. pneumoniae ATCC 49619 was used as a quality control strain for susceptibility testing.

Serotyping. Serotypes of all S. pneumoniae strains were determined by the Quellung reaction using antiserum purchased from the Statens Serum Institute (Copenhagen, Denmark).

PCR to identify three PBP genes and the lytA gene. To confirm that isolates were S. pneumoniae, the lytA gene (18) encoding the autolysin enzyme specific to S. pneumoniae was amplified simultaneously with the three PBP genes. Oligonucleotide primers for detection of the three PBP genes were designed to amplify proportions of the normal pbp1a (5, 27, 37), pbp2x (6, 26, 34), and pbp2b (14, 45) genes detected only in susceptible strains. Among the three sets of primers, the primers for the pbp1a gene were newly constructed based on current worldwide data (30): forward, 5'-2037AAACCGCGACTGGGGATCAAC2057-3'; and reverse, 5'-2275GGTTGAGTCCGACCTTGTTT2256-3'. Portions of each gene corresponding to the primers were positioned in blocks of highly divergent sequences within or near conserved amino acid motifs previously identified in the mosaic PBP genes of PEN-nonsusceptible S. pneumoniae. Primer mixture A contained primers for detecting the lytA and pbp1a genes, whereas primer mixture B contained primers for detecting the pbp2x and pbp2b genes.

Bacterial samples received from each institution were suspended into 2 ml of Mueller-Hinton broth, and then the 5 µl of the broth was added in a 0.5-ml microtube containing 30 µl of a lysis solution made up as previously reported (40). A CSF sample was added into a lysis solution after centrifugation at 4°C and 5,000 rpm for 5 min. The tubes were placed in a thermal cycler (Gene Amp PCR System 9600-R; Perkin-Elmer Cetus, Norwalk, Conn.), and bacterial cells were lysed for 20 min at 60°C and for 5 min at 94°C to obtain template DNA.

Next, 2 µl of template DNA solution was added to each of two tubes marked A and B. These tubes contained 30 µl of reaction mixture, consisting of (i) 600 ng of appropriate primer, (ii) 100 µl of a 25 mM deoxynucleoside triphosphate mixture, (iii) 40 U of Tth DNA polymerase (Toyobo, Tokyo, Japan), and (iv) 100 µl of 10x PCR buffer (pH 8.3) per ml of solution. PCR cycling conditions consisted of 35 cycles at 94°C for 15 s, 53°C for 15 s, and 72°C for 15 s. Amplified DNA fragments were analyzed by electrophoresis on a 3% agarose gel. Two DNA fragments of 319 and 239 bp in mixture A corresponded to the products of lytA and pbp1a genes, respectively. Similarly, DNA fragments of 197 and 147 bp in mixture B corresponded to the pbp2x and pbp2b genes, respectively.

When an isolate showed all three DNA fragments corresponding to pbp1a, pbp2x, and pbp2b, the PBP genes were regarded as having essentially the same sequences as in the R6 strain of PSSP. When any of these DNA bands was not detected or was detected in different sizes, the gene in question were regarded possessing different sequences.


arrow
RESULTS
 
Correlation of antimicrobial susceptibility and PCR results. To determine the presence or absence of abnormal pbp1a, pbp2x, and pbp2b genes, PCR was carried out for all S. pneumoniae isolates from the CSF of 204 meningitis cases, except for 15 cases where S. pneumoniae meningitis was diagnosed only by PCR of CSF.

Based on the PCR results, strains tested were classified into six groups according to genotype as follows: (i) strains with three normal pbp genes (n = 35, 17.2%); (ii) strains with an abnormal pbp2x gene (n = 45, 22.1%); (iii) strains with an abnormal pbp2b gene (n = 2, 1.0%); (iv) strains with abnormal pbp2x and pbp2b genes (n = 15, 7.4%); (v) strains with abnormal pbp1a and pbp2x genes (n = 26, 12.7%); and (vi) strains with three abnormal genes—pbp1a, pbp2x, and pbp2b (n = 81, 39.7%). In the present study, for convenience, genotypes i and vi were termed PSSP and gPRSP, respectively. The remaining genotypes ii to v were termed genotypic PEN-intermediately resistant S. pneumoniae (gPISP).

Table 1 shows the 50% MIC (MIC50), the MIC90, and the MIC range of seven intravenous antibiotics against the strains classified into the six genotype patterns. Figure 1 shows the MIC distribution for PEN, CTX, MEM, and PAM according to PCR results for comparison of the influence of each PBP alteration on MICs; this influence varied considerably depending on the category of the antibiotic. Two antibiotic types were evident among the six ß-lactam antibiotics. One was the PEN type, for which the strains with an abnormal pbp2x gene did not differ notably from PSSP. AMP, MEM, and PAM belonged to the PEN type. The other ß-lactam category was the CTX type, where strains with an abnormal pbp2x gene differed from PSSP in having an increased MIC 8 to 16 times greater than in PSSP; CTX and CRO belonged to this type. MICs of CTX-type agents were affected most by an abnormal pbp2x gene, while MICs of PEN-type agents were affected most by the pbp2b gene.


View this table:
[in this window]
[in a new window]
 
TABLE 1. MIC distribution and resistance genes identified by PCR in S. pneumoniae



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 1. Correlation between MICs of four ß-lactam antibiotics and abnormalities of three PBP genes in 204 S. pneumoniae isolates from meningitis patients.

The MIC90s of the seven antibiotics against the gPRSP were excellent; listed in descending order of susceptibility, these were PAM (0.125 µg/ml) > MEM (0.5 µg/ml) = VAN (0.5 µg/ml) > CTX (1 µg/ml) = CRO (1 µg/ml) > AMP (4 µg/ml) = PEN (4 µg/ml).

The PSSP strains showing CTX MICs of 0.063 to 0.125 µg/ml had amino acid substitutions located in the area of Lys-Ser-Gly (KSG) or Ser-Ser-Asn (SSN) conserved motifs that could not be detected with our pbp2x primers (data not shown here). In addition, strains with high CTX and CRO MICs of >=4 µg/ml had two amino acid substitutions changing a Ser-Thr-Met-Lys (STMK) conserved motif in the pbp2x gene to Ser-Ala-Phe-Lys (SAFK).

The MICs of VAN for all S. pneumoniae strains were distributed from 0.25 to 0.5 µg/ml, and no resistant strain was observed.

Resistance types of isolates and patient ages. Tables 2 and 3, respectively, show relationships between abnormal PBP genotypes of causative strains and patient age in children (<=17 years old) and in adults (>=18 years old). The 219 cases consist of 146 children and 73 adults. Among them 15 cases were identified the genotype of the causative agent in the CSF by using direct PCR.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Relationship between resistant isolates and patient age in children


View this table:
[in this window]
[in a new window]
 
TABLE 3. Relationship between resistant isolates and patient age in adults

Importantly, the gPRSP accounted for 45.2% of cases in children, followed by gPISP with an abnormal pbp2x gene for 17.8% and gPISP with abnormal pbp1a plus pbp2x genes for 14.4%, and relatively few cases showed remaining types. The PSSP accounted for only 15.1% of cases. Incidence of meningitis cases caused by S. pneumoniae in children peaked at age 1 year and younger (63.7%), decreasing gradually as age increased.

In adult cases compared to pediatric cases, prevalence of gPRSP was significantly lower at 27.4%, whereas those of gPISP with an abnormal pbp2x gene and PSSP were higher at 27.4 and 27.4%, respectively ({chi}2 = 12.0928, P = 0.0335). The highest adulthood incidence occurred in the sixth and seventh decades.

Year-by-year changes in resistant strains. Table 4 shows frequencies of identified resistance genotypes of isolates in each year. The gPRSP already had increased to 42.9% in 1999, remaining highly prevalent up to the present. The prevalence of gPISP strains such as those with an abnormal pbp2x and with abnormal pbp1a plus pbp2x genes has not changed so much.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Year-to-year changes in resistant S. pneumoniae strains isolated from meningitis patients

Serotypes. Tables 5 and 6 show relationships between serotype and resistance type in isolates from children and adults, respectively. Serotypes of isolates were significantly different between the two age groups ({chi}2 = 66.2876, P < 0.0001).


View this table:
[in this window]
[in a new window]
 
TABLE 5. Serotype distribution and resistance genes identified in S. pneumoniae isolates from children


View this table:
[in this window]
[in a new window]
 
TABLE 6. Serotype distributions and resistance genes identified in S. pneumoniae isolates from adults

The most common serotypes in young children were 6B (25.4%), 19F (16.7%), 23F (14.5%), 6A (10.1%), and 14 (8.7%), in contrast to adult cases where the most prevalent serotypes were 23F (16.7%), 22 (13.6%), 3 = 10 (9.1%), and 19F = 6B (7.6%).

Although a few resistant strains were identified as serotype 14, serotypes 6A, 6B, 19F, and 23F showed the greatest prevalence among gPRSP. All serotype 3 isolates were of the mucoid type and were gPISP having an abnormal pbp2x gene. The 7- and 11-valent pneumococcal conjugate vaccines covered serotypes of strains isolated from children in 76.1 and 81.2% of cases, respectively; the corresponding percentages in those from adults were 43.9 and 56.1%.


arrow
DISCUSSION
 
Since the first cases of invasive pneumococcal infections caused by PRSP were reported in 1977 (3), PEN-nonsusceptible strains have become a worldwide concern (23). Many studies have been reported concerning epidemiologic surveillance for these infections, including serologic, antibiotic susceptibility, and resistance mechanism data (29).

Since the early 1990s, isolations of PEN-nonsusceptible strains in RTI and acute otitis media have increased dramatically throughout Japan, particularly in young children (41). Currently, genotypically proven gPISP and gPRSP have been isolated in 2002 at rates of 33.0 and 54.9%, respectively. The prevalence of nonsusceptible strains in Japan now appears to be higher than in other countries (2).

The rapid increase in resistant strains has paralleled clinical introduction of new oral cephalosporins that have been greatly overprescribed for outpatients as a first-choice antibiotic. The prescription of antibiotics for pediatric outpatients in Japan differs fundamentally from patterns in other countries (12, 13, 22). The problem is reflected by the observation that many pneumococcal isolates (20%) possess an abnormal pbp2x gene, which decreases their susceptibility to cephalosporin antibiotics as opposed to PEN (6). In other countries, in which amoxicillin is prescribed more frequently for outpatients, the prevalence of strains possessing an abnormal pbp2x gene is lower (30).

The first case of meningitis caused by PRSP in Japan was reported in 1988 (4). We noted that PEN-nonsusceptible isolates appeared to increase gradually as a causative agent of meningitis in parallel with increases of such isolates in RTI. The prolonged low incidence of pneumococcal meningitis may reflect the Japanese nationwide insurance system, under which every one has access to antibiotic medication without financial barrier.

Before initiating the NSBM study, we established a rapid facsimile and e-mail reply system from our laboratory to local laboratory technicians and physicians, who received reports for their reference data. A predicted MIC for ß-lactam antibiotics could be calculated from PCR results for PBP genes within 2.5 h after we received an isolate. The predicted MIC was derived from a multiple regression analysis between MICs of ß-lactam antibiotics against S. pneumoniae and the presence of abnormal pbp1a, pbp2x, and pbp2b genes (40), with S. pneumoniae strains from RTI collected nationwide in Japan between 1998 and 2000. Subsequently, exact MICs of several intravenous antibiotics against the isolates were redetermined by standard biologic methods.

As described in Results, the antimicrobial activity of PAM (31, 41), a carbapenem, was quite impressive with an MIC90 of 0.125 µg/ml against gPRSP. PAM has also a strong bactericidal activity compared to other intravenous antibiotics. PAM is now establishing a reputation as an antibiotic of first choice for severe pneumococcal infections instead of cephalosporins. Concentrations of PAM in CSF were 6.84 µg/ml at the acute stage and 3.28 µg/ml at the recovering stage after a 1-h drip infusion at a dose of 27.5 mg/kg in pediatric patients with meningitis (17). Notable neurotoxicity or nephrotoxicity have not observed clinically in the pediatric patients thus far. In a rabbit model, neurotoxicity of PAM was approximately half that of imipenem (24). Unfortunately, PAM/betamipron is not available clinically in most countries except in Japan, Korea, and China. In Japan, VAN has not been approved for the treatment of pneumococcal meningitis. This is another reason to use PAM for pneumococcal meningitis to pediatric patients.

Meanwhile, various pneumococcal vaccines have been developed, ranging from a 23-polyvalent polysaccharide vaccine to conjugate vaccines, including 7-, 9-, or 11-polyvalency (7, 16, 47). Although all 90 recognized serotypes of S. pneumoniae appear to be pathogenic, how well a vaccine can cover serotypes representing invasive isolates is a key point. Predominant serotypes vary conspicuously between developing and industrialized countries (38), patient age groups, and disease types (8, 11). Some serotypes are more frequent in children for both carriage and infection, whereas others are rarely found in carriers but are frequent in patients with invasive disease.

As described in Results, isolates belonging to a serogroup associated with carriage were more frequent in meningitis in children no more than 17 years old than they were in adults, probably because younger children have not yet developed antibodies to these common serotypes. Since ß-lactam antibiotic resistance is found mainly in serotypes associated with carriage, the prevalence of resistant strains was significantly higher in the young children in meningitis.

If 7- and 11-valent vaccines were introduced into Japan, up to 76.2 and 81.3% of causative isolates from meningitis in children would be covered by the respective vaccines; for adults, these percentages would be lower (43.9 and 56.0%). The relatively high coverage rate for children in Japan compared to other countries could be explained by the limitation of prevalent resistant strains to serotypes 6B, 19F, 23A, and 14 (9, 10); these are included in the 7-valent vaccine. Since the 11-valent vaccine also provides cross-protection against serotype 6A, a further 10.1% of meningitis cases would be covered, bringing total coverage to 91.4%. However, cross-protection within a given serogroup is not fully assured (42). The added presence of serotypes 1, 3, 5, and 7F in the 11-valent vaccine increases the potential coverage rate in adults considerably.

In conclusion, to prevent severe infections with resistant microorganisms from increasing, vaccination against S. pneumoniae, which is not yet available in Japan, is vitally important (1, 44). In addition, to nationwide surveillance for antibiotic susceptibilities and serotypes of S. pneumoniae (25, 35, 46), postgraduate education for physicians also is necessary to ensure that selection of antibiotics is based on pharmacokinetic, pharmacodynamic, and biologic test data.


arrow
ACKNOWLEDGMENTS
 
We are extremely grateful to the bacteriologic laboratory technicians and physicians in the NSBM study group for providing us with pneumococcal isolates from meningitis patients.

This study was partially supported by a grant from the Ministry of Health, Labor, and Welfare of Japan (Research Project for Emerging and Reemerging Infectious Diseases).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Kitasato Institute for Life Sciences and Graduate School of Infection Control Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo, 108-8641, Japan. Phone: (813) 5791-6385. Fax: (813) 5791-6386. E-mail: ubukatak{at}lisci.kitasato-u.ac.jp. Back


arrow
REFERENCES
 
    1
  1. Advisory Committee on Immunization Practices. 2000. Preventing pneumococcal disease among infants and young children: recommendations of the Advisory Committee on Immunization Practices. Morb. Mortal. Wkly Rep. 49:1-35.[Medline]
  2. 2
  3. Appelbaum, P. C. 1992. Antimicrobial resistance in Streptococcus pneumoniae: an overview. Clin. Infect. Dis. 15:77-83.[Medline]
  4. 3
  5. Appelbaum, P. C., A. Bhamjee, J. N. Scragg, A. F. Hallett, A. J. Bowen, and R. C. Cooper. 1977. Streptococcus pneumoniae resistant to penicillin and chloramphenicol. Lancet 2:995-997.[CrossRef][Medline]
  6. 4
  7. Arimasu, O., H. Meguro, H. Shiraishi, K. Sugamata, and F. Hiruma. 1988. A case of pneumococcal meningitis resistant to beta-lactam antibiotic treatment. Kansenshogaku Zasshi. 62:682-683. (In Japanese.)[Medline]
  8. 5
  9. Asahi, Y., and K. Ubukata. 1998. Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:2267-2273.[Abstract/Free Full Text]
  10. 6
  11. Asahi, Y., Y. Takeuchi, and K. Ubukata. 1999. Diversity of substitutions within or adjacent to conserved amino acid motifs of penicillin-binding protein 2X in cephalosporin-resistant Streptococcus pneumoniae isolates. Antimicrob. Agents Chemother. 43:1252-1255.[Abstract/Free Full Text]
  12. 7
  13. Black, S., H. Shinefield, B. Fireman, E. Lewis, P. Ray, J. R. Hansen, L. Elvin, K. M. Ensor, J. Hackell, G. Siber, F. Malinoski, D. Madore, I. Chang, R. Kohberger, W. Watson, R. Austrian, and K. Edwards. 2000. Efficacy, safety and immunogenicity of heptavalent pneumococcal conjugate vaccine in children. Northern California Kaiser Permanente Vaccine Study Center Group. Pediatr. Infect. Dis. J. 19:187-195.[CrossRef][Medline]
  14. 8
  15. Brandileone, M. C., A. L. de Andrade, J. L. Di Fabio, M. L. Guerra, and R. Austrian. 2003. Appropriateness of a pneumococcal conjugate vaccine in Brazil: potential impact of age and clinical diagnosis, with emphasis on meningitis. J. Infect. Dis. 187:1206-1212.[CrossRef][Medline]
  16. 9
  17. Camou, T., R. Palacio, J. L. Di Fabio, and M. Hortal. 2003. Invasive pneumococcal diseases in Uruguayan children: comparison between serotype distribution and conjugate vaccine formulations. Vaccine 21:2102-2105.
  18. 10
  19. Dagan, R., and D. Fraser. 2000. Conjugate pneumococcal vaccine and antibiotic-resistant Streptococcus pneumoniae: herd immunity and reduction of otitis morbidity. Pediatr. Infect. Dis. J. 19:S79-S88.[CrossRef][Medline]
  20. 11
  21. Doit, C., C. Loukil, P. Geslin, and E. Bingen. 2002. Phenotypic and genetic diversity of invasive pneumococcal isolates recovered from French children. J. Clin. Microbiol. 40:2994-2998.[Abstract/Free Full Text]
  22. 12
  23. Dowell, S. F., J. C. Butler, G. S. Giebink, et al. 1999. Acute otitis media: management and surveillance in an era of pneumococcal resistance. Pediatr. Infect. Dis. J. 18:1-9.[CrossRef][Medline]
  24. 13
  25. Dowell, S. F., S. M. Marcy, W. R. Phillips, M. A. Gerber, and B. Schwartz. 1998. Otitis media: principles of judicious use of antimicrobial agents. Pediatr. Suppl. 101:165-171.
  26. 14
  27. Dowson, C. G., A. Hutchison, and B. G. Spratt. 1989. Nucleotide sequence of the penicillin-binding protein 2B gene of Streptococcus pneumoniae strain R6. Nucleic Acids Res. 17:7518.[Free Full Text]
  28. 15
  29. Eriksson, M., B. Henriques, and K. Ekdahl. 2000. Epidemiology of pneumococcal infections in Swedish children. Acta Paediatr. Suppl. 89:35-39.[CrossRef][Medline]
  30. 16
  31. Eskola, J., T. Kilpi, A. Palmu, J. Jokinen, J. Haapakoski, E. Herva, A. Takala, H. Kayhty, P. Karma, R. Kohberger, G. Siber, P. H. Makela, et al. 2001. Efficacy of a pneumococcal conjugate vaccine against acute otitis media. N. Engl. J. Med. 344:403-409.[Abstract/Free Full Text]
  32. 17
  33. Furukawa, S., and T. Okada. 1992. Clinical evaluation of panipenem/be-tamipron in pediatrics. Jpn. J. Antibiot. 45:424-429. (In Japanese.)[Medline]
  34. 18
  35. Garcia, P., J. L. Garcia, E. Garcia, and R. Lopez. 1986. Nucleotide sequence and expression of the pneumococcal autolysin gene from its own promotor in Escherichia coli. Gene 43:265-272.[CrossRef][Medline]
  36. 19
  37. Hausdorff, W. P., J. Bryant, P. R. Paradiso, and G. R. Siber. 2000. Which pneumococcal serogroups cause the most invasive disease: implications for conjugate vaccine formulation and use, part I. Clin. Infect. Dis. 30:100-121.[CrossRef][Medline]
  38. 20
  39. Huebner, R. E., A. D. Wasas, and K. P. Klugman. 2000. Trends in antimicrobial resistance and serotype distribution of blood and cerebrospinal fluid isolates of Streptococcus pneumoniae in South Africa, 1991-1998. Int. J. Infect. Dis. 4:214-218.[CrossRef][Medline]
  40. 21
  41. Kaltoft, M. S., N. Zeuthen, and H. B. Konradsen. 2000. Epidemiology of invasive pneumococcal infections in children aged 0-6 years in Denmark: a 19-year nationwide surveillance study. Acta Paediatr. Suppl. 89:3-10.[CrossRef][Medline]
  42. 22
  43. Klein, J. O. 1999. Review of consensus reports on management of acute otitis media. Pediatr. Infect. Dis. J. 18:1152-1155.[CrossRef][Medline]
  44. 23
  45. Klugman, K. P. 1990. Pneumococcal resistance to antibiotics. Clin. Microbiol. Rev. 3:171-196.[Abstract/Free Full Text]
  46. 24
  47. Kurihara, A., M. Hisaoka, N. Mikuni, and K. Kamoshida. 1992. Neutrotoxicity of panipenem/betamipron, a new carbapenem, in rabbits: correlation to concentration in central nervous system. J. Pharmacobiodyn. 15:325-332.[Medline]
  48. 25
  49. Kyaw, M. H., S. Clarke, I. G. Jones, and H. Campbell. 2002. Incidence of invasive pneumococcal disease in Scotland, 1988-99. Epidemiol. Infect. 128:139-147.[CrossRef][Medline]
  50. 26
  51. Laible, G., B. G. Spratt, and R. Hakenbeck. 1991. Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 5:1993-2002.[Medline]
  52. 27
  53. Martin, C., B. Thomas, and R. Hakenbeck. 1992. Nucleotide sequences of genes encoding penicillin-binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillin-binding proteins 1A and 1B. J. Bacteriol. 174:4517-4523.[Abstract/Free Full Text]
  54. 28
  55. Miller, E., P. Waight, A. Efstratiou, M. Brisson, A. Johnson, and R. George. 2000. Epidemiology of invasive and other pneumococcal disease in children in England and Wales 1996-1998. Acta Paediatr. Suppl. 89:11-16.[CrossRef][Medline]
  56. 29
  57. Musher, D. M., R. F. Breiman, and A. Tomasz. 2000. Streptococcus pneumoniae: at the threshold of the 21st century, p. 485-491. In A. Tomasz (ed.), Streptococcus pneumoniae: molecular biology and mechanisms of disease. Mary Ann Liebert, Inc., New York, N.Y.
  58. 30
  59. Nagai, K., Y. Shibasaki, K. Hasegawa, T. A. Davies, M. R. Jacobs, K. Ubukata, and P. C. Appelbaum. 2001. Evaluations of the primers for PCR to screen Streptococcus pneumoniae isolates, ß-lactam resistance and to detect common macrolide resistance determinants. J. Antimicrob. Chemother. 48:915-918.[Abstract/Free Full Text]
  60. 31
  61. Neu, H. C., N. X. Chin, G. Saha, and P. Labthavikul. 1986. In vitro activity against aerobic and anaerobic gram-positive and gram-negative bacteria and beta-lactamase stability of RS-533, a novel carbapenem. Antimicrob. Agents Chemother. 30:828-834.[Abstract/Free Full Text]
  62. 32
  63. National Committee for Clinical Laboratory Standards. 2000. Performance standards for antimicrobial susceptibility testing. Fifth informational supplement M100-S10. NCCLS, Wayne, Pa.
  64. 33
  65. Pantosti, A., F. D'Ambrosio, A. Tarasi, S. Recchia, G. Orefici, and P. Mastrantonio. 2000. Antibiotic susceptibility and serotype distribution of Streptococcus pneumoniae causing meningitis in Italy, 1997-1999. Clin. Infect. Dis. 31:1373-1379.[CrossRef][Medline]
  66. 34
  67. Pares, S., N. Mouz, Y. Petillot, R. Hakenbeck, and O. Dideberg. 1996. X-ray structure of Streptococcus pneumoniae PBP2x, a primary target enzyme. Nat. Struct. Biol. 3:284-289.[CrossRef][Medline]
  68. 35
  69. Pelton, S. I., R. Dagan, B. M. Gaines, K. P. Klugman, D. Laufer, K. O'Brien, and H. J. Schmitt. 2003. Pneumococcal conjugate vaccines: proceedings from an interactive symposium at the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy. Vaccine 21:1562-1571.[CrossRef][Medline]
  70. 36
  71. Skoczynska, A., and W. Hryniewicz. 2003. Genetic relatedness, antibiotic susceptibility, and serotype distribution of Streptococcus pneumoniae responsible for meningitis in Poland, 1997-2001. Microb. Drug Resist. 9:175-182.[CrossRef][Medline]
  72. 37
  73. Smith, A. M., and K. P. Klugman. 1998. Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:1329-1333.[Abstract/Free Full Text]
  74. 38
  75. Sniadack, D. H., B. Schwartz, H. Lipman, J. Bogaerts, J. C. Butler, R. Dagan, G. Echaniz-Aviles, N. Lloyd-Evans, A. Fenoll, N. I. Girgis, J. Henrichsen, K. Klugman, D. Lehmann, A. K. Takala, J. Vandepitte, S. Gove, and R. F. Breiman. 1995. Potential interventions for the prevention of childhood pneumonia: geographic and temporal differences in serotype and serogroup distribution of sterile site pneumococcal isolates from children: implications for vaccine strategies. Pediatr. Infect. Dis. J. 14:503-510.[Medline]
  76. 39
  77. Spanjaard, L., A. van der Ende, H. Rumke, J. Dankert, and L. van Alphen. 2000. Epidemiology of meningitis and bacteraemia due to Streptococcus pneumoniae in The Netherlands. Acta Paediatr. Suppl. 89:22-26.[Medline]
  78. 40
  79. Ubukata, K., T. Muraki, A. Igarashi, Y. Asahi, and M. Konno. 1997. Identification of penicillin and other ß-lactam resistance in Streptococcus pneumoniae by PCR. J. Infect. Chemother. 3:190-197.
  80. 41
  81. Ubukata, K., Y. Asahi, K. Okuzumi, and M. Konno. 1996. Incidence of penicillin-resistant Streptococcus pneumoniae in Japan, 1993-1995. J. Infect. Chemother. 1:177-184.
  82. 42
  83. Vakevainen, M., C. Eklund, J. Eskola, and H. Kayhty. 2001. Cross-reactivity of antibodies to type 6B and 6A polysaccharides of Streptococcus pneumoniae, evoked by pneumococcal conjugate vaccines, in infants. J. Infect. Dis. 184:789-793.[CrossRef][Medline]
  84. 43
  85. Verhaegen, J., S. J. Vandecasteele, J. Vandeven, N. Verbiest, K. Lagrou, and W. E. Peetermans. 2003. Antibiotic susceptibility and serotype distribution of 240 Streptococcus pneumoniae causing meningitis in Belgium 1997-2000. Acta Clin. Belg. 58:19-26.[Medline]
  86. 44
  87. Whitney, C. G., M. H. Farley, J. Hadler, L. H. Harrison, N. M. Bennett, R. Lynfield, A. Reingold, P. R. Cieslak, T. Pilishvili, D. Jackson, R. R. Facklam, J. H. Jorgensen, A. Schuchat, et al. 2003. Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N. Engl. J. Med. 348:1737-1746.[Abstract/Free Full Text]
  88. 45
  89. Yamane, A., H. Nakano, Y. Asahi, K. Ubukata, and M. Konno. 1996. Directly repeated insertion of 9-nucleotide sequence detected in penicillin-binding protein 2B gene of penicillin-resistant Streptococcus pneumoniae. Antimicrob. Agents Chemother. 40:1257-1259.[Abstract]
  90. 46
  91. Ziebold, C., R. von Kries, A. Siedler, and H. J. Schmitt. 2000. Epidemiology of pneumococcal disease in children in Germany. Acta Paediatr. Suppl. 89:17-21.
  92. 47
  93. Zielen, S., I. Buhring, N. Strnad, J. Reichenbach, and D. Hofmann. 2000. Immunogenicity and tolerance of a 7-valent pneumococcal conjugate vaccine in nonresponders to the 23-valent pneumococcal vaccine. Infect. Immun. 68:1435-1440.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, May 2004, p. 1488-1494, Vol. 48, No. 5
0066-4804/04/$08.00+0     DOI: 10.1128/AAC.48.5.1488-1494.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Murayama, S. Y., Seki, C., Sakata, H., Sunaoshi, K., Nakayama, E., Iwata, S., Sunakawa, K., Ubukata, K., and the Invasive Streptococcal Disease Working Gro, (2009). Capsular Type and Antibiotic Resistance in Streptococcus agalactiae Isolates from Patients, Ranging from Newborns to the Elderly, with Invasive Infections. Antimicrob. Agents Chemother. 53: 2650-2653 [Abstract] [Full Text]  
  • Hasegawa, K., Kobayashi, R., Takada, E., Ono, A., Chiba, N., Morozumi, M., Iwata, S., Sunakawa, K., Ubukata, K., on behalf of the Working Group of the Nationwide S, (2006). High prevalence of type b {beta}-lactamase-non-producing ampicillin-resistant Haemophilus influenzae in meningitis: the situation in Japan where Hib vaccine has not been introduced. J Antimicrob Chemother 57: 1077-1082 [Abstract] [Full Text]  
  • Chiba, N., Kobayashi, R., Hasegawa, K., Morozumi, M., Nakayama, E., Tajima, T., Iwata, S., Ubukata, K., on behalf of the Acute Respiratory Diseases Study, (2005). Antibiotic susceptibility according to genotype of penicillin-binding protein and macrolide resistance genes, and serotype of Streptococcus pneumoniae isolates from community-acquired pneumonia in children. J Antimicrob Chemother 56: 756-760 [Abstract] [Full Text]  
  • Tanaka, K., Mikamo, H., Ninomiya, M., Tamaya, T., Izumi, K., Ito, K., Yamaoka, K., Watanabe, K. (2005). Microbiology of Bartholin's Gland Abscess in Japan. J. Clin. Microbiol. 43: 4258-4261 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ubukata, K.
Right arrow Articles by Sunakawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ubukata, K.
Right arrow Articles by Sunakawa, K.