| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, July 2004, p. 2712-2715, Vol. 48, No. 7
0066-4804/04/$08.00+0 DOI: 10.1128/AAC.48.7.2712-2715.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Federal Institute for Risk Assessment, National Salmonella Reference Laboratory, D-12277 Berlin, Germany
Received 1 December 2003/ Returned for modification 6 March 2004/ Accepted 28 March 2004
|
|
|---|
|
|
|---|
Recently, Perreten and Boerlin (13) described a new DHPS sulfonamide resistance gene, designated sul3 (GenBank accession number AJ459418), which has 50.4% amino acid identity to Salmonella enterica plasmid pHCM1, 40.6% amino acid identity to sul2 from E. coli plasmid RSF1010, and 40.9% amino acid identity to sul1 from E. coli plasmid R388 (GenBank accession number X12869). This sul3 gene was found in Swiss E. coli strains from pigs. For Salmonella, a gene named sul3 can be found in GenBank (accession number AY047357); however, this gene seems to be a defective sul1 gene. The objective of this work was to ascertain the presence and spread of the sul3 gene described for the Swiss E. coli isolates in non-typhoid Salmonella strains.
The study included 512 epidemiologically unrelated German sulfonamide-resistant Salmonella strains from the German National Salmonella Reference Laboratory (NRL-Salm; Berlin, Germany) strain collection. They were isolated in 2001 from livestock (100, 87, and 75 isolates from poultry, cattle, and swine, respectively), food products (236 isolates), and feed (14 isolates) in different laboratories in the 16 German states (Länder).
Several steps were used in the study. (i) Dot blotting was used to screen the isolates for the sul3 gene. For dot blotting, 5 µl (about 100 ng) of boiled DNA (11) was spotted onto nylon membranes (Roche Applied Sciences, Mannheim, Germany), cross-linked for 2 min, and hybridized by a nonradioactive method (Roche Applied Sciences) with a sul3-specific probe obtained from plasmid pVP440 (13). (ii) PCR amplification was then used to confirm the presence of sul3 in the suspected positive isolates. PCR was carried out as described previously (4) with primers sul3-F (GAGCAAGATTTTTGGAATCG) and sul3-B (CATCTGCAGCTAACCTAGGGCTTTGGA) and the conditions described elsewhere (13). (iii) The sequence of the sul3 gene found in one Salmonella-positive strain was then analyzed. First, only the PCR product obtained with the sul3-specific primers was sequenced, as described previously (4). Second, the 5' flanking region was also sequenced by using internal primers specific for the orf and sul3 genes (GenBank accession number AJ459418). (iv) Restriction fragment length polymorphism (RFLP) analysis of all the sul3 PCR products was then performed as described previously (4) with 5 U of HindIII or SphI endonuclease (Amersham Biosciences, Freiburg, Germany). (v) Molecular typing of the strains was performed by plasmid analysis (9) and pulsed-field gel electrophoresis (PFGE) with the XbaI endonuclease (11) and the run conditions recommended by the Salm-Net project (12). (vi) Finally, the location of the sul3 gene was determined by Southern blot hybridization (14) of the plasmid patterns with the sul3-specific probe.
Twenty-two of the 512 (4.3%) sulfonamide-resistant Salmonella strains (Table 1) hybridized with the sul3-specific probe. By PCR, all 22 strains gave amplification products of about 789 bp. The sequence of the PCR product generated by Salmonella strain NRL-01-02571 showed 100% identity with the sequence of the sul3 gene found in E. coli deposited in GenBank (accession number AJ459418). Restriction of all sul3 PCR products with the HindIII or the SphI endonuclease generated the same RFLP patterns generated for the control (fragments of 591 and 198 bp and fragments of 700 and 89 bp, respectively).
|
View this table: [in a new window] |
TABLE 1. Features of the Salmonella strains carrying the sul3 gene
|
The strains carrying sul3 belonged to different serotypes, most of them to S. enterica serotype Heidelberg (10 strains), and originated from 8 of the 16 German states, although most of them came from the Brandenburg region (12 strains). The strains were very heterogeneous, showing nine different antimicrobial resistance patterns (RPs), 15 plasmid profiles (PPs), and 15 XbaI PFGE patterns (PFP-X) (Table 1; Fig. 1 and 2). The predominant genomic group was represented by five Salmonella serotype Heidelberg strains and one rough strain, which showed PP3 and PFP-X1. Only one strain carried a second sulfonamide resistance gene (sul2).
![]() View larger version (54K): [in a new window] |
FIG. 1. Plasmid analysis of the Salmonella strains carrying the sul3 gene. (A) plasmid patterns; (B) hybridization of the plasmid DNA in panel A with a sul3-specific probe. Lanes: , bacteriophage DNA digested with PstI; S, plasmids R27, R1, and V157 used as size standards (170 to 1.9 kb); T, Salmonella serotype Typhimurium; He, Salmonella serotype Heidelberg; An, Salmonella serotype Anatum; Br, Salmonella serotype Brandenburg; Ag, Salmonella serotype Agona; Rgh, rough; Mo, monophasic. 1, the same plasmid profiles were shown by rough strains.
|
![]() View larger version (104K): [in a new window] |
FIG. 2. XbaI PFGE patterns of the Salmonella strains carrying the sul3 gene. Lanes: M1 and M2, Lambda Ladder and Low Range PFG-Markers (New England Biolabs, Schwalbach, Germany), respectively; XB, reference strain Salmonella serotype Braenderup H9812 (Centers for Disease Control and Prevention); T, Salmonella serotype Typhimurium; Mo, monophasic; He, Salmonella serotype Heidelberg; Rgh, rough; Br, Salmonella serotype Brandenburg; Ag, Salmonella serotype Agona; An, Salmonella serotype Anatum. 1, the size of the largest fragment of serotype Braenderup strain H9812.
|
The widespread resistance to sulfonamides is a good example of rapid adaptive evolution due to the horizontal transfer of resistance genes among mixed bacterial populations. Even though the use of sulfonamides in human medicine has decreased, selection pressures still exist in the veterinary, agriculture, and aquaculture fields in some countries (2, 7, 8, 18). Consequently, the genetic determinants for sulfonamide resistance are still very common in gram-negative bacterial plasmids. This persistence seems to be related to the incorporation of these determinants into very efficient vehicles for their spread: sul1 in class 1 integrons and sul2 in small multicopy plasmids or large transmissible multiresistance plasmids (1, 2, 5, 7, 17-19). The spread of the sul3 genes found in the Swiss E. coli isolates seems to be related to transposable elements (13; V. Perreten, personal communication).
The present work describes for the first time the presence of the sul3 gene in Salmonella strains. We have shown that sul3 can be found on different large plasmids and that it is not only spread among E. coli strains of different origins and from different countries (3, 6, 13). Sul3 can be detected in Salmonella strains of different origins, serotypes, and genomic groups. This study highlights the strong potential for the wide distribution of the sul3 resistance determinant in bacterial populations.
Nucleotide sequence accession number. The sul3 gene found in Salmonella strains has been submitted to GenBank and can be found under accession number AY316203.
This work was supported by grants from the German Ministry of Consumer Protection and Agriculture (BMVEL; grant AZ:1000-WK-17/00) and the Federal Institute for Risk Assessment (BfR [formerly BgVV]; grant F501-28/1322-136).
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»