This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fehri, L. F.
Right arrow Articles by Blanchard, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fehri, L. F.
Right arrow Articles by Blanchard, A.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, October 2005, p. 4154-4165, Vol. 49, No. 10
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.10.4154-4165.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Resistance to Antimicrobial Peptides and Stress Response in Mycoplasma pulmonis

Lina Fassi Fehri,1,2 Pascal Sirand-Pugnet,1 Géraldine Gourgues,1 Gwenaël Jan,3 Henri Wróblewski,2 and Alain Blanchard1*

INRA Université de Bordeaux 2, UMR Génomique Développement Pouvoir Pathogène, 71 avenue Edouard Bourlaux, 33883 Villenave D'Ornon, France,1 Université de Rennes I, UMR CNRS 6026, Campus de Beaulieu, 35042 Rennes, France,2 UMR 1253 STLO, INRA Agrocampus, 65 rue de Saint-Brieuc, 35042 Rennes, France3

Received 18 March 2005/ Returned for modification 8 May 2005/ Accepted 18 July 2005


arrow
ABSTRACT
 
Antimicrobial peptides are widely distributed in nature, and in vertebrates, they play a key function in the innate immune defense system. It is generally agreed that these molecules may provide new antibiotics with therapeutic value. However, there are still many unsolved questions regarding the mechanisms underlying their antimicrobial activity as well as the mechanisms of resistance evolved by microorganisms against these molecules. The second point was addressed in this study. After determining the activity of 10 antimicrobial peptides against Mycoplasma pulmonis, a murine respiratory pathogen, the development of resistance was investigated. Following in vitro selection using subinhibitory concentrations of peptides, clones of this bacterium showing increased resistance to melittin or gramicidin D were obtained. For some of the clones, a cross-resistance was observed between these two peptides, in spite of their deep structural differences, and also with tetracycline. A proteomic analysis suggested that the stress response in these clones was constitutively activated, and this was confirmed by finding mutations in the hrcA gene; in mycoplasmas, bacteria which lack alternative sigma factors, the HrcA protein is supposed to play a key role as a negative regulator of heat shock proteins. By complementation of the hrcA mutants with the wild-type gene, the initial MICs of melittin and gramicidin D decreased to values close to the initial ones. This indicates that the resistance of M. pulmonis to these two antimicrobial peptides could result from a stress response involving HrcA-regulated genes.


arrow
INTRODUCTION
 
The innate immune system is the first host barrier against microbial infections in vertebrates. This system is of utmost importance for the protection of the host's epidermis and mucosal surfaces because of their direct exposure to the external environment. A failure in the integrity of these surfaces may allow pathogens to disseminate within their host by invading different tissues and organs and possibly the bloodstream. Production of antimicrobial peptides represents one of the most important arms of the innate defenses (for a review see reference 28); this is particularly true for the respiratory tract because it is permanently exposed to the bacteria which are inhaled (2, 21, 49). In the airways, antimicrobial peptides act additionally as regulators of acquired immunity (for a review see reference 2).

The finding that antimicrobial peptides are key factors in the fight against many pathogens, not only in humans but also in most animal species, suggests that they might be a source of novel antibiotics of therapeutic value. Some success has indeed already been obtained with a number of molecules, reaching the phases of clinical evaluation and even marketing (1, 9, 29). Antimicrobial peptides generally show a wide activity spectrum against bacteria, but they also exhibit some degree of toxicity for the host's cells. Although they are very diverse in structure, origin, and biosynthesis, they share a high affinity for biological membranes which are, for most of them, the main bacterial target. The disruption of membrane integrity often leads to a rapid death of bacteria because this action is faster than the setup of most resistance mechanisms (for a review see reference 27). Although antimicrobial peptides offer a strong barrier against infection, some bacteria have developed strategies to circumvent this line of defense. The molecular mechanisms underlying this resistance (for reviews see references 16 and 38) include the production of proteases (44) and efflux mechanisms (5, 50) and the modulation of the cell surface electrical charge by modifying envelope components, such as the lipopolysaccharides (19, 22, 26) or the capsule (11).

Several mycoplasmas, bacteria belonging to the class Mollicutes, are responsible for infections in animals and humans which are usually progressive and chronic (for reviews see references 8 and 20). Even after the clinical manifestations of the disease have receded, mycoplasmas have been shown to persist in their hosts for extended periods of time (25, 47). Mycoplasmas usually parasitize mucosal surfaces, such as the respiratory and urogenital tracts of their animal hosts, and consequently have to cope with the innate immune system, including the antimicrobial peptides. It has been shown that innate immunity provides an effective defense of the lungs against Mycoplasma pulmonis, the etiologic agent of murine respiratory infections (12, 57). In particular, the marked difference in susceptibility to M. pulmonis disease between C3H and C57BL/6 mice has been linked to the lesser ability of C3H mice to clear the mycoplasma in the early phase of infection, before the development of adaptive immunity (12).

We have chosen M. pulmonis as a model for studying the interaction between mycoplasmas and antibacterial peptides because (i) it is a natural respiratory pathogen, (ii) its genome has been sequenced (13), and (iii) it is amenable to genetic manipulation (15). The goal of this study was to determine whether this mycoplasma could develop a resistance to antimicrobial peptides and, if so, to elucidate the underlying molecular mechanism.

After determining the MICs of 10 antimicrobial peptides for M. pulmonis, clones of this mycoplasma showing increased resistance to melittin and gramicidin D were obtained after in vitro selection. The MIC of tetracycline for these clones was also increased. A proteomic analysis suggested that the stress response in these clones was constitutively activated. This activation resulted from mutations in the hrcA gene, which encodes a negative regulator of heat shock proteins; this was confirmed by complementation of the mutants with the wild-type hrcA gene.


arrow
MATERIALS AND METHODS
 
Antimicrobial peptides and antibiotics. The origin of the antimicrobial peptides used in this study is indicated in Table 1. Other antibiotics used in this study included tetracycline, doxycycline, chloramphenicol purchased from Sigma Aldrich, and enrofloxacin from Bayer.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Antimicrobial peptides used in this study

Bacterial strains and culture medium. The M. pulmonis MpUR1.1 clone was obtained by randomly picking a colony from a culture of the M. pulmonis UAB CTIP isolate (13). The mycoplasmas were grown in Hayflick medium containing 5% horse serum unless otherwise indicated. During serial passages, the inoculum was diluted 10 times with fresh medium. For agar plates, Noble agar (DIFCO) at a final concentration of 1% (wt/vol) was added.

For DNA cloning procedures, the Escherichia coli strain DH10B [F mcrA {Delta}(mrr-hsdRMS-mcrBC) {Phi}80dlacZ{Delta}M15 {Delta}lacX74 deoR recA1 endA1 araD139 {Delta}(ara leu)7697 galU galK rpsL nupG] (Life Technologies) was used. This strain was grown in LB medium, and when needed, the following antibiotics were added: ampicillin (100 µg/ml) and tetracycline (5 µg/ml).

Determination of MICs. The antimycoplasma activities of the antimicrobial peptides and other antibiotics were determined as described previously (6, 33). Briefly, mycoplasmas at an initial concentration of 106 CFU/ml were grown in 96-well plates in the presence of twofold serial dilutions of the antibiotics. A change in the color of the phenol red added to the medium as a pH indicator was used to monitor bacterial growth. The MIC was defined as the lowest antibiotic concentration that completely inhibited the growth of the mycoplasma after 48 h.

Selection of clones with increased resistance to antimicrobial peptides. The cultures were performed either in liquid medium or on agar plates. For the selection in broth medium, the first passage was performed with the peptide added at a concentration equal to half the MIC (MIC/2), and this concentration was serially increased by twofold in the next passages. Following this process of selection, individual clones were picked up after plating on agar plates which did not contain the selecting peptide. For the selection on agar plates, a Whatman disk (diameter, 5 mm) was laid at the surface of the medium, and the peptide (100 µl) was added directly to it at the concentration of MIC/2 for the first passage as detailed above.

Proteome analyses. Mycoplasmas were collected by centrifugation at the end of the exponential growth phase. Mycoplasma proteins were extracted by two different methods. In method A, the pelleted cells were directly lysed in a solution of 1x phosphate-buffered saline containing 0.5% sodium dodecyl sulfate, and the lysate was brought to 65°C for 15 min. After cooling, 4 volumes of cold acetone was added, and the proteins were recovered by centrifugation (12,000 x g, 15 min, 4°C). The pellet was air dried, and the proteins were solubilized in a cocktail buffer containing 7 M urea, 2 M thiourea, 2% (wt/vol) 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS), 1% (wt/vol) dithiothreitol, and 2% (vol/vol) Ampholytes (pH range, 3 to 10; Bio-Rad). In method B, the proteins were directly extracted from the mycoplasma cellular pellet in the same cocktail buffer, except that 2 mM protease inhibitor Pefabloc SC (Roche) was added. The subsequent analytical two-dimensional (2-D) gel electrophoreses were performed as described by others (41). Protein was determined using a modified Bradford assay (39). In the first dimension the isoelectric focusing (IEF) was performed using 24-cm ReadyStrip immobilized pH gradient strips with a nonlinear pH gradient of 3 to 10 (Bio-Rad). The proteins were separated by electrophoresis in the chamber of a PROTEAN IEF cell (Bio-Rad) for a total of 60 to 80 kVh. The second dimension was vertical sodium dodecyl sulfate gel electrophoresis using the buffer system of Laemmli in 12% polyacrylamide gels. After electrophoresis, the proteins were detected either by silver staining (34) or by Coomassie blue R-250 staining. Acquisition of gel images was performed using a GS-800 scanning densitometer and the dedicated PDQuest software (Bio-Rad).

Identification of proteins by mass spectroscopy. (i) In-gel protein digestion. Spots containing the proteins of interest were excised from the gel. When needed, silver-stained spots were destained using the PROTSIL2 Silver kit (Sigma Aldrich) according to the manufacturer's instructions. Spot-containing gel pieces were successively washed in H2O/methanol/acetic acid (47.5:47.5:5) and in acetonitrile (ACN), dried under a vacuum, rehydrated in 50 mM NH4HCO3 containing 10 ng µl–1 trypsin (Sigma Aldrich), and incubated for 5 h at 37°C. This first supernatant was collected and stored at –20°C. The peptides left in the gel pieces were extracted once with 50 mM NH4HCO3 and twice with a H2O/ACN/HCOOH (47.5:47.5:5) solution. These three supernatants were pooled to the first one, concentrated in a vacuum centrifuge to a final volume of 30 µl, acidified by adding 1.8 µl of acetic acid, and stored at –20°C. The peptide mixtures were analyzed either by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) or by high-performance liquid chromatography-nanospray ion trap tandem MS analyses (LC-MS/MS) (see below), as indicated.

(ii) MALDI-TOF. The MALDI-TOF analysis was performed using a spectrophometer from Applied Biosystems equipped with a nitrogen laser (337 nm, 20 Hz). The spectra of peptide masses were acquired in "reflectron" mode with a delay of extraction of 130 ns and a matrix of {alpha}-cyano-4-hydroxy cinnamic acid (CHCA). The data were collected by gating the masses from 500 to 5,000 Da. The resulting peptide fingerprints were compared to those deduced from the SWISS-PROT databank and from the M. pulmonis proteome predicted from its sequenced genome (13) using the MS-Fit tool of the Protein Prospector software (http://prospector.ucsf.edu/). The precision requirement was 30 ppm. The minimum number of peptides required for identification was four for each protein.

(iii) Online capillary LC-MS/MS. The peptide mixture resulting from trypsin digestion was analyzed by online capillary high-performance liquid chromatography (LC Packings) coupled to a nanospray LCQ ion trap mass spectrometer (ThermoFinnigan). Peptides were separated on a 75-µm (inner diameter) by 15-cm C18 PepMap column (LC Packings). The flow rate was 200 nl/min, and peptides were eluted using a 5 to 50% linear gradient of solvent B in solvent A; solvent A was 0.1% (vol/vol) formic acid in 5% ACN, and solvent B was 0.1% formic acid in 80% ACN. The mass spectrometer was operated in positive-ion mode at a 1.8-kV needle voltage and a 38-V capillary voltage. Data acquisition was performed in a data-dependent mode consisting of a full-scan MS over the range m/z 300 to 2,000, followed by three MS/MS on the three most intense ions in the survey scan in an exclusion dynamic mode. MS/MS data were acquired using a 2-m/z unit ion isolation window, 35% relative collision energy, and a 5-min dynamic exclusion duration. Data were searched against the theoretical proteome of M. pulmonis by using the SEQUEST software (ThermoFinnigan).

Recombinant DNA techniques. M. pulmonis genomic DNA was extracted using the Wizard genomic DNA purification kit (Promega) according to the supplier's recommendations. The hrcA gene (mnemonic Mypu_1420 [13]) from the different M. pulmonis clones was PCR amplified using the hrcAL (5'TTGGAAAATGGTTTTATTTATTTCTTCA3') and hrcAR (5'TCATCAAAGGCAGAGATGTCA3') primers. The PCR mixture was subjected to denaturation for 2 min at 94°C followed by 40 thermal cycles at 94°C (30 s), 68°C (30 s), and 72°C (2 min), followed by a final 5-min extension time at 72°C. The PCR products were sent to a commercial sequencing company (GENOME Express) for direct sequencing using the dideoxy chain termination method.

The pMPO5 plasmid (6,060 bp) which was previously described (15) harbors the oriC region of M. pulmonis and the tetM gene from the transposon Tn916. The full hrcA gene together with 280 nucleotides located upstream from its coding sequence was PCR amplified from the M. pulmonis MpUR1.1 genome using the hrcA1 (5'CCCACATGTATGGAGCAACATAGACCTTCA3') and hrcA2 (5'CCCACATGTTCATCAAAGGCAGAGATGTCA3') primers that include an AflIII site (underlined). The PCR product was digested with the restriction enzyme AflIII and inserted in the pMPO5 plasmid digested with the same enzyme to obtain the pHRCA plasmid. The integrity of the hrcA cloned gene was verified by sequencing. The MpUR1.1, G1, and M1 clones of M. pulmonis were transformed with the pHRCA plasmid in the presence of polyethylene glycol as previously described (15). The transformants were selected in liquid broth containing 5 µg/ml of tetracycline, and this concentration was increased to 20 µg/ml in the following passages.

Bioinformatics. The nucleotide and protein sequences were aligned using the ClustalW program (48). The CIRCE putative elements in the genome of M. pulmonis were searched using the SPAT program (search pattern annotation tool) available in the MolliGen database (4). The query sequence used was the following CIRCE consensus sequence (56): TTAGCACTC-N9-GAGTGCTAA, where N represents any nucleotide. A maximum of three substitutions was authorized.


arrow
RESULTS
 
Selection of a set of antimicrobial peptides with activity against M. pulmonis. We chose 10 antimicrobial peptides displaying activity against different bacteria, including mycoplasma species (6, 33). This set partially reflected the structural diversity found in nature for these molecules (Table 1). The susceptibility of M. pulmonis toward these peptides was assessed by measuring their growth inhibition activity. Collectively, the MICs ranged from 0.0015 to over 100 µM (Table 1). Specifically, the following order of decreasing efficacy was recorded: gramicidin D (0.0015 µM) > globomycin (0.8 µM) > melittin and gramicidin S (3.12 µM) > alamethicin (6.25 µM) > iturin A and surfactin (25 µM) > dermaseptin B5, polymyxin B, and polymyxin E (>100 µM). Owing to their inactivity toward M. pulmonis in the conditions of this experiment, dermaseptin B5 and the two polymyxins were excluded from the rest of the study. This lack of susceptibility to polymyxin B is shared by other mycoplasmas, including Mycoplasma gallisepticum and Mycoplasma genitalium (6).

Selection of M. pulmonis clones showing increased resistance to antimicrobial peptides. In order to obtain M. pulmonis clones showing increased resistance to at least some of these peptides, the mycoplasma was grown in the presence of increasing concentrations of peptide, starting with a concentration equal to half the MIC. These cultures were performed either in liquid medium or on agar plates.

Although repeated attempts were made, resistant clones were obtained with only melittin and gramicidin D, out of the seven peptides selected for these experiments. With melittin, four clones obtained from two independent rounds of selection in liquid medium (two clones from each round) and one clone obtained by selection on agar plates were kept for further study. With gramicidin D, eight clones obtained from two independent rounds of selection in liquid medium (four clones from each round) and two clones obtained by selection on agar plates were kept for further characterization (Table 2). The MICs of gramicidin D were increased from 16- to 128-fold for the gramicidin-resistant clones, and the MICs of melittin from 2.5- to 4-fold for the melittin-resistant clones. Once obtained, the level of resistance was quite stable without the need to maintain selection pressure (i.e., peptide added to the culture medium). Indeed, after 12 passages of the G1, G8, M1, and M2 clones in liquid medium without peptide, the MICs of melittin and gramicidin D were identical to those before passaging. This stability of the phenotype suggested that the resistance for the peptides was due to a mutation rather than to transient regulation of gene expression.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Increased antibiotic resistance of M. pulmonis clones selected in the presence of melittin and gramicidin Da

Cross-resistance of selected M. pulmonis clones with other antibiotics. To assess whether or not this resistance to a specific antimicrobial peptide was associated with increased resistance to other peptides, MICs for the resistant clones were determined (Table 2). The clones selected in the presence of melittin (M clones) showed an increased MIC (8- to 32-fold) of gramicidin D. Similarly, among the 10 clones selected in the presence of gramicidin D (G clones), 8 of them showed an increased MIC (4- to 16-fold) of melittin. It should be noted that this cross-resistance was not directly correlated to the level of resistance obtained with the peptide used in the selection procedure. As a matter of fact, two of the G clones, G1 and G3, showing the highest increased MIC of gramicidin D did not show an increased MIC of melittin. No cross-resistance was found for peptides other than melittin and gramicidin D.

The MICs of conventional antibiotics known to be active against M. pulmonis were also determined for the peptide-resistant clones and were compared with that for M. pulmonis MpUR1.1 (Table 2). Although the MICs of three antibiotics (enrofloxacin, chloramphenicol, and doxycycline) remained unchanged, a 4- to 32-fold increase in the MIC of tetracycline was measured for all the resistant clones (Table 2). This increase was not directly related to the level of resistance to the peptide, neither for gramicidin D nor for melittin.

The level of cross-resistance to gramicidin D, melittin, or tetracycline of the different clones was stable and was not affected by passages in a culture medium without selecting peptide added.

Comparative analyses of proteomes of M. pulmonis clones. In order to find the molecular mechanism underlying the antibiotic resistance detected in the G and M clones, we chose a global method of exploration. The proteomic technology was chosen since it was shown to be suitable to elucidate the cellular response of bacteria to antibiotics (3). The proteomes of M. pulmonis MpUR1.1 and of G and M clones were analyzed by 2-D gel electrophoresis. Cell proteins were resolved in more than 400 spots after silver staining (Fig. 1A). The proteomes of the G8 and M1 clones were highly similar to each other (Fig. 1B and C) and to the other G and M clones (data not shown). However, they contained several spots with higher intensity than in the reference MpUR1.1 clone (Fig. 1). To identify these upregulated proteins, the corresponding spots were excised from the gels and trypsin digested, and a peptide spectrum was generated by MALDI-TOF MS. The identification of the proteins was performed by peptide mass fingerprinting. The proteins that were upregulated in each of the G and M clones included the heat shock protein DnaK, elongation factor Tu (EF-Tu), enzyme I of the phosphoenolpyruvate transferase system, the pyruvate dehydrogenase alpha and beta subunits, the DNA-directed RNA polymerase alpha subunit, and subunit R3 of a restriction modification system. Although the stress response in M. pulmonis has not yet been studied, the upregulation of DnaK suggests that this response could be constitutively activated in the G and M clones. Although the other upregulated proteins are not considered heat shock proteins, some of them have been found upregulated in other bacteria responding to stress conditions. Indeed, in the gram-positive bacterium Listeria monocytogenes, there was increased production of elongation factor Tu, mannose-specific phosphotransferase system enzyme IIAB, and pyruvate dehydrogenase after a salt stress (18).



View larger version (81K):
[in this window]
[in a new window]
 
FIG. 1. Comparative proteomic analysis of M. pulmonis MpUR1.1 (A), the G8 clone (B), and the M1 clone (C). Proteins were extracted from mycoplasma cells using method A (see Materials and Methods). Panels D, E, and F are enlargements of selected regions from panels A, B, and C, respectively. Two-dimensional electrophoresis was performed using 24-cm strips with a nonlinear pH gradient of 3 to 10 in the first dimension and a 12% polyacrylamide gel in the second dimension. Proteins were detected by silver staining. Molecular masses are given in kDa. Seven upregulated proteins were identified by mass spectrometry (MALDI-TOF): DnaK (a), enzyme I of the phosphoenolpyruvate transferase system (b), subunit R3 of a restriction modification system (c), a pyruvate dehydrogenase beta subunit (d), EF-Tu (e), a pyruvate dehydrogenase alpha subunit (f), and a DNA-dependent RNA polymerase alpha subunit (g). (G) The corresponding gene (Mypu_no) is indicated according to the published nomenclature of the M. pulmonis gene complement (13). The identification of the polypeptides was performed by MALDI-TOF MS. The number of peptides matching the theoretical trypsin digest of the polypeptide (Matching) is compared to the total number of detected peptides (Total). The ratio between the cumulative length of the matching peptides and the length of the protein is expressed as the percentage of peptide sequence coverage.

Consequently, to try to discover the genetic mechanism which was responsible for the phenotype of the G and M clones, the elements which regulate the stress response in M. pulmonis were investigated.

HrcA and stress response in M. pulmonis. In most bacteria, the stress response is mediated by alternative sigma factors and specific regulators. In mycoplasmas, including M. pulmonis, genome analysis has revealed only one sigma factor (13), which is homologous to general sigma factor A (or sigma-43 factor) of Bacillus subtilis. Therefore, since this work and other reports (52) indicate that mycoplasmas are capable of developing a stress response leading to the upregulation of heat shock proteins, regulatory factors other than alternative sigma factors have to be implicated in the expression of these proteins. The repressor HrcA, which is a regulator of stress response found in numerous bacteria (32, 56), has been predicted to be encoded in all of the 11 mollicute genomes sequenced at this time, and we could confirm this by searching the database MolliGen, which is dedicated to the genomics of Mollicutes for HrcA homologues (4; http://cbi.labri.fr/outils/molligen/). Transcriptional studies of the heat shock response in Mycoplasma pneumoniae (52) and in silico prediction suggested that the CIRCE-HrcA system could play a role in the response of mycoplasmas to this stress. From these data, it was hypothesized that a mutation in the hrcA gene could have occurred in the genomes of the G and M clones.

Therefore, the hrcA genes from M. pulmonis MpUR1.1 and from eight selected clones (G1, G2, G4, G8, G9, M1, M2, and M5) were PCR amplified and sequenced. The coding and the adjacent intergenic sequences of the hrcA gene from M. pulmonis MpUR1.1 were identical to the corresponding region in the published genome sequence of the M. pulmonis UAB CTIP strain (Fig. 2). In contrast, in all the hrcA sequences from the other clones, mutations which would result in a truncated HrcA product were found. With the exception of the G4 and M2 clones, there were insertions localized within a stretch of 29 nucleotides between positions 692 and 721 in the hrcA coding sequences of all the clones (Fig. 2). The G1, G8, M1, and M5 clones, which were independently obtained, shared the same insertion (GT between nucleotides 716 and 717), but for each of the four other clones (G2, G4, G9, and M2), the sequence was unique. For six of the clones (G1, G2, G8, G9, M1, and M5) the mutation would result in a C-terminal truncation of 100 to 111 amino acids. For the G4 clone, a single insertion at position 778 would result in an HrcA product in which the 73 C-terminal amino acids were truncated. For the M2 clone, a substitution and a single nucleotide deletion would result in an even shorter HrcA truncation of only six C-terminal amino acids and a modified C terminus over the last eight residues. Interestingly, upstream from these mutations, all the hrcA sequences from M. pulmonis MpUR1.1 and the eight selected clones were identical over 700 nucleotides.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 2. hrcA gene sequence analysis in M. pulmonis MpUR1.1 (WT) and in eight other clones (G1, G2, G4, G8, G9, M1, M2, and M5). PCR products were obtained using primers hrcAL and hrcAR. (A) Sequencing by the same primers revealed insertions (Y), a deletion ({triangleup}), and a substitution (S) that produced new stop codons (black vertical bars). All mutations were found outside the helix-turn-helix motif (HTH) of the HrcA protein. The hatched rectangle indicates the region of the gene for which the alignment of the sequences is provided in panel B. (B) ClustalW alignment of the hrcA gene sequences at nucleotide positions 684 to 1041 (numbering from the wild-type sequence). Stop codons and mutated sites are underlined once and twice, respectively.

The mutations found in the G and M clones that were evaluated strongly supported that in these clones the truncated HrcA could not act as a negative regulator, and this would in turn constitutively activate the stress response in these cells. This response would possibly provide, by a yet undetermined mechanism, a certain level of resistance to melittin, gramicidin D, and tetracycline. It should also be noted that although isolates G1, G8, and M5 have identically mutated hrcA sequences, the three lineages have different MIC profiles for three antibiotics, suggesting that other differences must be present.

The genes which are regulated following a specific stress belong to a set that is partially overlapping a set of genes regulated during a different type of stress. With this in mind, we evaluated whether an experimentally induced heat stress response in M. pulmonis would be associated with decreased sensitivity towards antimicrobial peptides or other antibiotics.

Heat shock response in M. pulmonis and resistance to antimicrobial peptides. During a natural M. pulmonis infection, part of the host's response consists of an increased body temperature (i.e., fever), which represents a stress for the mycoplasma. We evaluated whether these conditions would lead to increased MICs of the antimicrobial peptides. M. pulmonis MpUR1.1 was passaged nine times under an incubation temperature kept at 40°C, with the hope that these conditions would mimic the temperature found in the rodent lung during an active M. pulmonis acute infection. After these passages at 40°C, the MICs of melittin, gramicidin D, and tetracycline were determined at 37°C; only the MIC of gramicidin D was found to be increased (eightfold increase) (Table 3). Interestingly, if the nine passages at 40°C were followed by two passages at 37°C before determination of the MIC, the MIC of gramicidin D was not found to be increased. This result clearly established that the passages at an increased temperature (40°C) resulted in changes in the cell metabolism that were associated with increased resistance to gramicidin D. However, this increased MIC was transient and returned to normal once the mycoplasma was grown at 37°C (Table 3).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Effect of M. pulmonis MpUR1.1 growth temperature on MICs of antimicrobial peptidesa

The proteome of M. pulmonis MpUR1.1 after growing at 40°C was analyzed by 2-D gel electrophoresis. As expected, a number of differences with the proteome of the mycoplasma cultivated at 37°C were found (Fig. 3). Several proteins that were upregulated at 40°C were identified by mass spectrometry (Fig. 3C). In the set of identified proteins, DnaK was the only polypeptide that was common to the proteins upregulated in the G and M clones (Fig. 1G and 3C). The other upregulated proteins included elongation factor TS (EF-TS), glyceraldehyde 3 phosphate dehydrogenase, thioredoxin reductase, and a protein of unknown function (Fig. 3C).



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 3. Proteomic analysis of M. pulmonis MpUR1.1 after culture at 37°C (A) or 40°C (B). Proteins were extracted from the mycoplasma cells by method B (see Materials and Methods). Two-dimensional electrophoresis was performed as indicated in the legend to Fig. 1. Proteins were stained with Coomassie blue. Six upregulated spots were analyzed by LC-MS/MS and identified as DnaK (spot a), EF-Ts (spot b), glyceraldehyde 3 phosphate dehydrogenase (spot c), thioredoxin reductase (spot d), and protein of unknown function (spots e and f). (C) The corresponding gene (Mypu_no) is indicated according to the published nomenclature of the M. pulmonis gene complement (13). The number of peptides identified by LC-MS/MS, the cumulative length of these peptides compared to the total length of the protein, and the corresponding percentage of peptide coverage are indicated.

Complementation of the hrcA mutation in M. pulmonis G1 and M1 clones. To evaluate whether the mutation found in the hrcA gene in the G and M clones was the cause of the increased MICs of gramicidin D and melittin, complementation of the mutation was attempted. The wild-type hrcA gene was cloned with its upstream putative promoter sequences into the AflIII site of the pMPO5 plasmid (15), resulting in the pHRCA plasmid. The G1 and M1 clones, once transformed with the pHRCA plasmid, were amplified in the presence of tetracycline without subcloning, and the obtained transformants were named CG1 and CM1, respectively. We first verified that the MICs of melittin and gramicidin D for MpUR1.1 transformed with vector pMPO5 were identical to those for MpUR1.1 without plasmid vector. The MICs of gramicidin D for CM1 and CG1 were decreased 4- to 8-fold and 64-fold compared to the MICs for M1 and G1, respectively. The MIC of melittin for CM1 was decreased two- to fourfold compared to the MIC of M1. The MICs of melittin for CG1 and G1 were the same. These findings indicate that there was a partial restoration of the wild-type phenotype by the complementation of the G1 and M1 mutants with the plasmid-borne hrcA gene. The proteome of the CM1 clone was analyzed; it was found to be almost identical to that of M. pulmonis MpUR1.1 (Fig. 4), with the disappearance of upregulated proteins shared by all the G and M clones. This result indicated that the upregulated proteins in the M1 clone, and possibly in the other M and G clones, were under the direct or indirect control of the HrcA repressor. The only difference between the proteomes of the CM1 clone and M. pulmonis MpUR1.1 was the upregulation of a mixture of EF-Tu (major component in spot h) and enzyme I of phosphoenolpyruvate protein phosphotranferase (minor component in spot h) (Fig. 4C). At this time, we have no explanation for this difference.



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 4. Proteomic analysis of the hrcA-complemented M. pulmonis M1 clone. Proteins were extracted from the cells of M. pulmonis MpUR1.1 (A), clone M1 (B), and transformant CM1 (C) by method B (see Materials and Methods). Two-dimensional electrophoresis was performed as indicated in the legend to Fig. 1. Proteins were detected using silver staining. The seven upregulated proteins (Fig. 1) that were identified by comparing the proteomes of M. pulmonis MpUR1.1 and clone M1 are indicated (spots a to g). Spot h corresponds to a mixture of two proteins that are upregulated in the CM1 transformant compared to the proteome of M. pulmonis MpUR1.1. (D) The number of peptides identified by LC-MS/MS, the cumulative length of these peptides compared to the total length of the protein, and the corresponding percentage of peptide coverage are indicated.

The stress response that is regulated by HrcA provides the mycoplasma with increased resistance to both gramicidin D and melittin. Until now, the only replicative plasmids available for M. pulmonis were based on the tetracycline selection brought by the tetM gene. Therefore, it was not possible to conclude about a possible association between the increased resistance for tetracycline in the G and M clones and the detected mutation in the hrcA gene.


arrow
DISCUSSION
 
In this study, we have shown that M. pulmonis can develop a resistance to melittin and gramicidin D. However, in spite of several attempts, resistant clones were only obtained for these two peptides out of seven that were evaluated. This result is, to some extent, in agreement with the previously described difficulty for bacteria to develop resistance to antimicrobial peptides (for a review see reference 17). The resistance of M. pulmonis to dermaseptin (a frog skin peptide) and polymyxins is in agreement with previously published data indicating that three other Mycoplasma species (M. gallisepticum, M. genitalium, and M. mycoides subsp. mycoides SC) are resistant to animal defense peptides and polymyxins (6).

The isolation of M. pulmonis clones with increased MICs to both melittin and gramicidin D but not to other antimicrobial peptides is surprising because these two molecules are structurally different although being both linear (Table 1). Melittin, a bee venom component, is a genetically encoded 26-residue peptide composed exclusively of amino acids identical to those found in proteins. In contrast, gramicidin D is a shorter peptide (15 residues), is nonribosomally synthesized by Bacillus brevis, and displays a sequence of alternating D- and L-amino acids. Furthermore, while melittin is mainly {alpha}-helical in lipid bilayers, gramicidin D is believed to form transmembrane, left-handed antiparallel ß-helices (10). The association between the increased MICs of these two peptides for the G and M clones and an increased MIC of tetracycline is of particular interest because this may represent a new mechanism of resistance to an antibiotic that is still widely used in the clinical setting (14).

Modifications observed in the expressed proteomes of resistant clones suggested that peptide resistance and stress response could be correlated in some way. An association between antibiotic resistance and stress response has already been reported in gram-negative bacteria (Gracilicutes) for which a response to osmotic stress was observed after nonbactericidal exposure to polymyxin B or cecropin (35, 36). In agreement with this hypothesis, in all the G and M clones, mutations were identified in the hrcA gene that has been shown to control stress response in many bacteria (32, 56) and proposed to play the same role in mycoplasmas (52, 56). The HrcA protein acts as a repressor of several genes encoding stress proteins, among them the chaperones DnaK and DnaJ and the protease Lon. The mutations in the hrcA gene in the G and M clones could result in constitutive activation of the stress response in cells. In agreement with this proposal, DnaK was identified among the proteins that were upregulated in the G and M clones, which supports the hypothesis that the dnaK gene is under the negative regulation of HrcA. Moreover, a computer search of HrcA-binding sequences (CIRCE elements) on the M. pulmonis genome revealed a potential CIRCE element upstream from the dnaK gene. Two other CIRCE elements, upstream from the lon and dnaJ genes, were predicted (Table 4). Although no definitive conclusion could be drawn for the regulation of these two genes because the corresponding proteins were not identified by 2-D gel electrophoresis, our results strongly suggest that resistance to melittin and gramicidin D could result, at least in part, from a derepression of HrcA-regulated genes. The partial restoration of peptide sensitivity after complementation with the wild-type hrcA gene is in agreement with this proposal.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Localization of CIRCE elements in the M. pulmonis genome

Drosocin, pyrrhocoricin and apidaecin, three proline-rich peptides produced by insects, act stereospecifically on the Escherichia coli heat shock protein DnaK but not on its human homolog (37). It is further known that pyrrhocoricin inhibits the ATPase activity of E. coli DnaK (30, 31). Although our observations do not prove that DnaK is also a target of melittin and gramicidin D, its upregulation in the mutants suggests that this protein could be involved directly or indirectly in the resistance mechanism. The presence of foreign hydrophobic molecules (here, melittin and gramicidin D) in the cytosol of M. pulmonis might indeed require increased amounts of the cytoplasmic chaperone DnaK, which is involved in cytoplasmic protein homeostasis.

The upregulation of enzymes involved in the energetic metabolism of M. pulmonis (phosphotransferase system enzymes involved in the uptake of sugars and pyruvate dehydrogenase which catalyzes the formation of acetyl-coenzyme A) may be necessary to cope with increased energy demand. Indeed, mycoplasmas use the proton motive force to activate secondary substrate transport systems. In fermentative bacteria, the proton motive force is generated by the ATPase F0F1 functioning as a proton pump activated by the ATP produced by substrate-level phosphorylation. Since in bacteria the cell energetic charge needs to be finely tuned, any loss of energy due, for example, to membrane permeabilization by amphipathic peptides should be compensated by an increased yield of energy.

The proteomic analysis of the G and M clones of M. pulmonis defined a set of proteins that were upregulated, plausibly as a consequence of the mutations in the hrcA gene. However, the proteins detected by 2-D gel electrophoresis are only a subset of the complete proteome and probably do not include very hydrophobic proteins and proteins with a high pI, a well-known limit of 2-D protein electrophoresis. Consequently, we cannot exclude the possibility that the expression of other proteins could be modified in the resistant clones. In fact, an analysis performed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that the variable surface antigens of M. pulmonis varied among the analyzed clones (data not shown). The analysis of these polypeptides that are known to vary at high frequency (51) did not reveal any correlation with resistance to antimicrobial peptides. This is in agreement with a recent report indicating that larger versions of variable surface antigens provide M. pulmonis with a shield protecting it from complement lysis but not the action of smaller molecules, such as gramicidin D (45).

The occurrence of mutations in the same region of the hrcA gene among M. pulmonis clones that were independently obtained is striking and raises the possibility that this region of the genome could be a hot spot for mutations. Although the exploration of such a hypothesis would require much more data, it is of interest to note that no other mutation was found in the 700 nucleotides upstream from the mutated region of hrcA. The lack of a system of methyl-directed mismatch repair in mycoplasmas led to the hypothesis that they could be considered constitutive mutators (46). If this were true, it would favor the development of antibiotic resistance as previously described for other bacteria (24). The genomes of mutator bacteria are characterized by a high frequency of mutations; in the case of mycoplasmas, this is supported at least partially by phylogenetic studies based on rRNA gene sequences which suggested that mycoplasmas have a high mutation rate and hence are in a state of rapid evolution (43, 53, 55). In the case of genome regions other than rRNA, there is a lack of experimental data to document a putative higher-than-normal frequency of mutation. However, it has been shown for many mycoplasma species that high-frequency point mutations at specific locations, such as microsatellites, is a strategy used by mycoplasmas to generate surface antigen diversity (40, 42). It was also found recently that reversible point mutations, located in a nonrepeated region of the chromosome, are responsible for the phase variation of the GapA cytadhesin in M. gallisepticum (54) and of the glucose phosphotransferase system permease (ptsG) in M. mycoides subsp. mycoides SC (23). In our study, the mutations in the hrcA gene occur in the same region of the gene where no statistically significant DNA repeats were found during a survey of the entire genome (42). It is possible that the stress due to the exposure to the antimicrobial peptides could favor the accumulation of mutations in particular regions of the genome. Recently, the stress associated with aging cells within a bacterial population was described as a factor influencing the mutation rate in E. coli (7). It remains to be determined whether the mutation in the hrcA gene is reversible, even at low frequency, as was documented for the mutation in the ptsG gene of M. mycoides subsp. mycoides SC, and whether such instability could be considered as an evolutionary strategy to escape peptide-mediated antimicrobial response during host-pathogen interaction.


arrow
ACKNOWLEDGMENTS
 
L.F.F. was supported by a fellowship from the Région Bretagne. This work was also supported by the Région Aquitaine and the Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires.

We acknowledge the help of Marc Bonneu and Stéphane Claverol from the Pôle Protéomique of the Plateforme Génomique Fonctionnelle de Bordeaux, who provided the expertise and technical assistance for the identification of proteins by mass spectrometry. We also acknowledge the gift of dermaseptin B5 from Pierre Nicolas (Institut Jacques Monod, Université de Paris 6).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: INRA Université de Bordeaux 2, UMR Génomique Développement Pouvoir Pathogène, 71 avenue Edouard Bourlaux, BP 81, 33883 Villenave D'Ornon, France. Phone: (33) 5 57 12 23 93. Fax: (33) 5 57 12 23 69. E-mail: ablancha{at}bordeaux.inra.fr. Back


arrow
REFERENCES
 
    1
  1. Andres, E., and J. L. Dimarcq. 2004. Cationic antimicrobial peptides: update of clinical development. J. Intern. Med. 255:519-520.[CrossRef][Medline]
  2. 2
  3. Bals, R., and P. S. Hiemstra. 2004. Innate immunity in the lung: how epithelial cells fight against respiratory pathogens. Eur. Respir. J. 23:327-333.[Abstract/Free Full Text]
  4. 3
  5. Bandow, J. E., H. Brotz, L. I. Leichert, H. Labischinski, and M. Hecker. 2003. Proteomic approach to understanding antibiotic action. Antimicrob. Agents Chemother. 47:948-955.[Abstract/Free Full Text]
  6. 4
  7. Barre, A., A. de Daruvar, and A. Blanchard. 2004. MolliGen, a database dedicated to the comparative genomics of Mollicutes. Nucleic Acids Res. 32(Database issue):D307-D310.[Abstract/Free Full Text]
  8. 5
  9. Bengoechea, J. A., and M. Skurnik. 2000. Temperature-regulated efflux pump/potassium antiporter system mediates resistance to cationic antimicrobial peptides in Yersinia. Mol. Microbiol. 37:67-80.[CrossRef][Medline]
  10. 6
  11. Béven, L., and H. Wróblewski. 1997. Effect of natural amphipathic peptides on viability, membrane potential, cell shape and motility of mollicutes. Res. Microbiol. 148:163-175.[Medline]
  12. 7
  13. Bjedov, I., O. Tenaillon, B. Gerard, V. Souza, E. Denamur, M. Radman, F. Taddei, and I. Matic. 2003. Stress-induced mutagenesis in bacteria. Science 300:1404-1409.[Abstract/Free Full Text]
  14. 8
  15. Blanchard, A., and C. M. Bébéar. 2002. Mycoplasmas of humans, p. 45-71. In S. Razin and R. Herrmann (ed.), Molecular biology and pathogenicity of mycoplasmas. Kluwer Academic/Plenum Publishers, New York, N.Y.
  16. 9
  17. Boman, H. G. 2003. Antibacterial peptides: basic facts and emerging concepts. J. Intern. Med. 254:197-215.[CrossRef][Medline]
  18. 10
  19. Burkhart, B. M., R. M. Gassman, D. A. Langs, W. A. Pangborn, and W. L. Duax. 1998. Heterodimer formation and crystal nucleation of gramicidin D. Biophys. J. 75:2135-2146.[Medline]
  20. 11
  21. Campos, M. A., M. A. Vargas, V. Regueiro, C. M. Llompart, S. Alberti, and J. A. Bengoechea. 2004. Capsule polysaccharide mediates bacterial resistance to antimicrobial peptides. Infect. Immun. 72:7107-7114.[Abstract/Free Full Text]
  22. 12
  23. Cartner, S. C., J. R. Lindsey, J. Gibbs-Erwin, G. H. Cassell, and J. W. Simecka. 1998. Roles of innate and adaptive immunity in respiratory mycoplasmosis. Infect. Immun. 66:3485-3491.[Abstract/Free Full Text]
  24. 13
  25. Chambaud, I., R. Heilig, S. Ferris, V. Barbe, D. Samson, F. Galisson, I. Moszer, K. Dybvig, H. Wróblewski, A. Viari, E. P. Rocha, and A. Blanchard. 2001. The complete genome sequence of the murine respiratory pathogen Mycoplasma pulmonis. Nucleic Acids Res. 29:2145-2153.[Abstract/Free Full Text]
  26. 14
  27. Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65:232-260.[Abstract/Free Full Text]
  28. 15
  29. Cordova, C. M., C. Lartigue, P. Sirand-Pugnet, J. Renaudin, R. A. Cunha, and A. Blanchard. 2002. Identification of the origin of replication of the Mycoplasma pulmonis chromosome and its use in oriC replicative plasmids. J. Bacteriol. 184:5426-5435.[Abstract/Free Full Text]
  30. 16
  31. Devine, D. A. 2003. Antimicrobial peptides in defence of the oral and respiratory tracts. Mol. Immunol. 40:431-443.[CrossRef][Medline]
  32. 17
  33. Devine, D. A., and R. E. Hancock. 2002. Cationic peptides: distribution and mechanisms of resistance. Curr. Pharm. Des. 8:703-714.[CrossRef][Medline]
  34. 18
  35. Duche, O., F. Tremoulet, P. Glaser, and J. Labadie. 2002. Salt stress proteins induced in Listeria monocytogenes. Appl. Environ. Microbiol. 68:1491-1498.[Abstract/Free Full Text]
  36. 19
  37. Ernst, R. K., E. C. Yi, L. Guo, K. B. Lim, J. L. Burns, M. Hackett, and S. I. Miller. 1999. Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa. Science 286:1561-1565.[Abstract/Free Full Text]
  38. 20
  39. Frey, J. 2002. Mycoplasmas of animals, p. 73-90. In S. Razin and R. Herrmann (ed.), Molecular biology and pathogenicity of mycoplasmas. Kluwer Academic/Plenum Publishers, New York, N.Y.
  40. 21
  41. Ganz, T. 2002. Antimicrobial polypeptides in host defense of the respiratory tract. J. Clin. Investig. 109:693-697.[CrossRef][Medline]
  42. 22
  43. Gatzeva-Topalova, P. Z., A. P. May, and M. C. Sousa. 2004. Crystal structure of Escherichia coli ArnA (PmrI) decarboxylase domain. A key enzyme for lipid A modification with 4-amino-4-deoxy-L-arabinose and polymyxin resistance. Biochemistry 43:13370-13379.[Medline]
  44. 23
  45. Gaurivaud, P., A. Persson, D. L. Grand, J. Westberg, M. Solsona, K. E. Johansson, and F. Poumarat. 2004. Variability of a glucose phosphotransferase system permease in Mycoplasma mycoides subsp. mycoides Small Colony. Microbiology 150:4009-4022.[Abstract/Free Full Text]
  46. 24
  47. Giraud, A., I. Matic, M. Radman, M. Fons, and F. Taddei. 2002. Mutator bacteria as a risk factor in treatment of infectious diseases. Antimicrob. Agents Chemother. 46:863-865.[Abstract/Free Full Text]
  48. 25
  49. Gnarpe, J., A. Lundback, B. Sundelof, and H. Gnarpe. 1992. Prevalence of Mycoplasma pneumoniae in subjectively healthy individuals. Scand. J. Infect. Dis. 24:161-164.[Medline]
  50. 26
  51. Guo, L., K. B. Lim, C. M. Poduje, M. Daniel, J. S. Gunn, M. Hackett, and S. I. Miller. 1998. Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides. Cell 95:189-198.[CrossRef][Medline]
  52. 27
  53. Hancock, R. E., and D. S. Chapple. 1999. Peptide antibiotics. Antimicrob. Agents Chemother. 43:1317-1323.[Free Full Text]
  54. 28
  55. Hancock, R. E., and G. Diamond. 2000. The role of cationic antimicrobial peptides in innate host defences. Trends Microbiol. 8:402-410.[CrossRef][Medline]
  56. 29
  57. Hancock, R. E., and R. Lehrer. 1998. Cationic peptides: a new source of antibiotics. Trends Biotechnol. 16:82-88.[CrossRef][Medline]
  58. 30
  59. Kragol, G., R. Hoffmann, M. A. Chattergoon, S. Lovas, M. Cudic, P. Bulet, B. A. Condie, K. J. Rosengren, L. J. Montaner, and L. Otvos, Jr. 2002. Identification of crucial residues for the antibacterial activity of the proline-rich peptide, pyrrhocoricin. Eur. J. Biochem. 269:4226-4237.[Medline]
  60. 31
  61. Kragol, G., S. Lovas, G. Varadi, B. A. Condie, R. Hoffmann, and L. Otvos, Jr. 2001. The antibacterial peptide pyrrhocoricin inhibits the ATPase actions of DnaK and prevents chaperone-assisted protein folding. Biochemistry 40:3016-3026.[CrossRef][Medline]
  62. 32
  63. Narberhaus, F. 1999. Negative regulation of bacterial heat shock genes. Mol. Microbiol. 31:1-8.[CrossRef][Medline]
  64. 33
  65. Nir-Paz, R., M. C. Prevost, P. Nicolas, A. Blanchard, and H. Wróblewski. 2002. Susceptibilities of Mycoplasma fermentans and Mycoplasma hyorhinis to membrane-active peptides and enrofloxacin in human tissue cell cultures. Antimicrob. Agents Chemother. 46:1218-1225.[Abstract/Free Full Text]
  66. 34
  67. O'Connell, K. L., and J. T. Stults. 1997. Identification of mouse liver proteins on two-dimensional electrophoresis gels by matrix-assisted laser desorption/ionization mass spectrometry of in situ enzymatic digests. Electrophoresis 18:349-359.[CrossRef][Medline]
  68. 35
  69. Oh, J. T., Y. Cajal, E. M. Skowronska, S. Belkin, J. Chen, T. K. Van Dyk, M. Sasser, and M. K. Jain. 2000. Cationic peptide antimicrobials induce selective transcription of micF and osmY in Escherichia coli. Biochim. Biophys. Acta 1463:43-54.[Medline]
  70. 36
  71. Oh, J. T., T. K. Van Dyk, Y. Cajal, P. S. Dhurjati, M. Sasser, and M. K. Jain. 1998. Osmotic stress in viable Escherichia coli as the basis for the antibiotic response by polymyxin B. Biochem. Biophys. Res. Commun. 246:619-623.[CrossRef][Medline]
  72. 37
  73. Otvos, L., Jr., I. O., M. E. Rogers, P. J. Consolvo, B. A. Condie, S. Lovas, P. Bulet, and M. Blaszczyk-Thurin. 2000. Interaction between heat shock proteins and antimicrobial peptides. Biochemistry 39:14150-14159.[CrossRef][Medline]
  74. 38
  75. Peschel, A. 2002. How do bacteria resist human antimicrobial peptides? Trends Microbiol. 10:179-186.[CrossRef][Medline]
  76. 39
  77. Ramagli, L. S. 1999. Quantifying protein in 2-D PAGE solubilization buffers. Methods Mol. Biol. 112:99-103.[Medline]
  78. 40
  79. Razin, S., D. Yogev, and Y. Naot. 1998. Molecular biology and pathogenicity of mycoplasmas. Microbiol. Mol. Biol. Rev. 62:1094-1156.[Abstract/Free Full Text]
  80. 41
  81. Regula, J. T., B. Ueberle, G. Boguth, A. Gorg, M. Schnolzer, R. Herrmann, and R. Frank. 2000. Towards a two-dimensional proteome map of Mycoplasma pneumoniae. Electrophoresis 21:3765-3780.[CrossRef][Medline]
  82. 42
  83. Rocha, E. P., and A. Blanchard. 2002. Genomic repeats, genome plasticity and the dynamics of Mycoplasma evolution. Nucleic Acids Res. 30:2031-2042.[Abstract/Free Full Text]
  84. 43
  85. Rogers, M. J., J. Simmons, R. T. Walker, W. G. Weisburg, C. R. Woese, R. S. Tanner, I. M. Robinson, D. A. Stahl, G. Olsen, R. H. Leach, et al. 1985. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data. Proc. Natl. Acad. Sci. USA 82:1160-1164.[Abstract/Free Full Text]
  86. 44
  87. Sieprawska-Lupa, M., P. Mydel, K. Krawczyk, K. Wojcik, M. Puklo, B. Lupa, P. Suder, J. Silberring, M. Reed, J. Pohl, W. Shafer, F. McAleese, T. Foster, J. Travis, and J. Potempa. 2004. Degradation of human antimicrobial peptide LL-37 by Staphylococcus aureus-derived proteinases. Antimicrob. Agents Chemother. 48:4673-4679.[Abstract/Free Full Text]
  88. 45
  89. Simmons, W. L., A. M. Denison, and K. Dybvig. 2004. Resistance of Mycoplasma pulmonis to complement lysis is dependent on the number of Vsa tandem repeats: shield hypothesis. Infect. Immun. 72:6846-6851.[Abstract/Free Full Text]
  90. 46
  91. Taddei, F., I. Matic, B. Godelle, and M. Radman. 1997. To be a mutator, or how pathogenic and commensal bacteria can evolve rapidly. Trends Microbiol. 5:427-428.[CrossRef][Medline]
  92. 47
  93. Taylor-Robinson, D., C. B. Gilroy, B. J. Thomas, and P. E. Hay. 2004. Mycoplasma genitalium in chronic non-gonococcal urethritis. Int. J. STD AIDS 15:21-25.[Abstract/Free Full Text]
  94. 48
  95. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  96. 49
  97. Travis, S. M., P. K. Singh, and M. J. Welsh. 2001. Antimicrobial peptides and proteins in the innate defense of the airway surface. Curr. Opin. Immunol. 13:89-95.[CrossRef][Medline]
  98. 50
  99. Tsuge, K., Y. Ohata, and M. Shoda. 2001. Gene yerP, involved in surfactin self-resistance in Bacillus subtilis. Antimicrob. Agents Chemother. 45:3566-3573.[Abstract/Free Full Text]
  100. 51
  101. Watson, H. L., L. S. McDaniel, D. K. Blalock, M. T. Fallon, and G. H. Cassell. 1988. Heterogeneity among strains and a high rate of variation within strains of a major surface antigen of Mycoplasma pulmonis. Infect. Immun. 56:1358-1363.[Abstract/Free Full Text]
  102. 52
  103. Weiner, J., III, C. U. Zimmerman, H. W. Gohlmann, and R. Herrmann. 2003. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res. 31:6306-6320.[Abstract/Free Full Text]
  104. 53
  105. Weisburg, W. G., J. G. Tully, D. L. Rose, J. P. Petzel, H. Oyaizu, D. Yang, L. Mandelco, J. Sechrest, T. G. Lawrence, J. Van Etten, J. Maniloff, and C. R. Woese. 1989. A phylogenetic analysis of the mycoplasmas: basis for their classification. J. Bacteriol. 171:6455-6467.[Abstract/Free Full Text]
  106. 54
  107. Winner, F., I. Markova, P. Much, A. Lugmair, K. Siebert-Gulle, G. Vogl, R. Rosengarten, and C. Citti. 2003. Phenotypic switching in Mycoplasma gallisepticum hemadsorption is governed by a high-frequency, reversible point mutation. Infect. Immun. 71:1265-1273.[Abstract/Free Full Text]
  108. 55
  109. Woese, C. R., E. Stackebrandt, and W. Ludwig. 1984. What are mycoplasmas: the relationship of tempo and mode in bacterial evolution. J. Mol. Evol. 21:305-316.[CrossRef][Medline]
  110. 56
  111. Wong, P., and W. A. Houry. 2004. Chaperone networks in bacteria: analysis of protein homeostasis in minimal cells. J. Struct. Biol. 146:79-89.[CrossRef][Medline]
  112. 57
  113. Woolard, M. D., L. M. Hodge, H. P. Jones, T. R. Schoeb, and J. W. Simecka. 2004. The upper and lower respiratory tracts differ in their requirement of IFN-gamma and IL-4 in controlling respiratory mycoplasma infection and disease. J. Immunol. 172:6875-6883.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, October 2005, p. 4154-4165, Vol. 49, No. 10
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.10.4154-4165.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Yoshida, N., Mita, T., Onda, M. (2008). Susceptibilities of Phospholipid Membranes Containing Cholesterol or Ergosterol to Gramicidin and its Derivative Incorporated in Lysophospholipid Micelles. J Biochem 144: 167-176 [Abstract] [Full Text]  
  • Simmons, W. L., Dybvig, K. (2007). Biofilms Protect Mycoplasma pulmonis Cells from Lytic Effects of Complement and Gramicidin. Infect. Immun. 75: 3696-3699 [Abstract] [Full Text]  
  • Fassi Fehri, L., Wroblewski, H., Blanchard, A. (2007). Activities of Antimicrobial Peptides and Synergy with Enrofloxacin against Mycoplasma pulmonis. Antimicrob. Agents Chemother. 51: 468-474 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fehri, L. F.
Right arrow Articles by Blanchard, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fehri, L. F.
Right arrow Articles by Blanchard, A.