Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, October 2005, p. 4154-4165, Vol. 49, No. 10
0066-4804/05/$08.00+0 doi:10.1128/AAC.49.10.4154-4165.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
INRA Université de Bordeaux 2, UMR Génomique Développement Pouvoir Pathogène, 71 avenue Edouard Bourlaux, 33883 Villenave D'Ornon, France,1 Université de Rennes I, UMR CNRS 6026, Campus de Beaulieu, 35042 Rennes, France,2 UMR 1253 STLO, INRA Agrocampus, 65 rue de Saint-Brieuc, 35042 Rennes, France3
Received 18 March 2005/ Returned for modification 8 May 2005/ Accepted 18 July 2005
|
|
|---|
|
|
|---|
The finding that antimicrobial peptides are key factors in the fight against many pathogens, not only in humans but also in most animal species, suggests that they might be a source of novel antibiotics of therapeutic value. Some success has indeed already been obtained with a number of molecules, reaching the phases of clinical evaluation and even marketing (1, 9, 29). Antimicrobial peptides generally show a wide activity spectrum against bacteria, but they also exhibit some degree of toxicity for the host's cells. Although they are very diverse in structure, origin, and biosynthesis, they share a high affinity for biological membranes which are, for most of them, the main bacterial target. The disruption of membrane integrity often leads to a rapid death of bacteria because this action is faster than the setup of most resistance mechanisms (for a review see reference 27). Although antimicrobial peptides offer a strong barrier against infection, some bacteria have developed strategies to circumvent this line of defense. The molecular mechanisms underlying this resistance (for reviews see references 16 and 38) include the production of proteases (44) and efflux mechanisms (5, 50) and the modulation of the cell surface electrical charge by modifying envelope components, such as the lipopolysaccharides (19, 22, 26) or the capsule (11).
Several mycoplasmas, bacteria belonging to the class Mollicutes, are responsible for infections in animals and humans which are usually progressive and chronic (for reviews see references 8 and 20). Even after the clinical manifestations of the disease have receded, mycoplasmas have been shown to persist in their hosts for extended periods of time (25, 47). Mycoplasmas usually parasitize mucosal surfaces, such as the respiratory and urogenital tracts of their animal hosts, and consequently have to cope with the innate immune system, including the antimicrobial peptides. It has been shown that innate immunity provides an effective defense of the lungs against Mycoplasma pulmonis, the etiologic agent of murine respiratory infections (12, 57). In particular, the marked difference in susceptibility to M. pulmonis disease between C3H and C57BL/6 mice has been linked to the lesser ability of C3H mice to clear the mycoplasma in the early phase of infection, before the development of adaptive immunity (12).
We have chosen M. pulmonis as a model for studying the interaction between mycoplasmas and antibacterial peptides because (i) it is a natural respiratory pathogen, (ii) its genome has been sequenced (13), and (iii) it is amenable to genetic manipulation (15). The goal of this study was to determine whether this mycoplasma could develop a resistance to antimicrobial peptides and, if so, to elucidate the underlying molecular mechanism.
After determining the MICs of 10 antimicrobial peptides for M. pulmonis, clones of this mycoplasma showing increased resistance to melittin and gramicidin D were obtained after in vitro selection. The MIC of tetracycline for these clones was also increased. A proteomic analysis suggested that the stress response in these clones was constitutively activated. This activation resulted from mutations in the hrcA gene, which encodes a negative regulator of heat shock proteins; this was confirmed by complementation of the mutants with the wild-type hrcA gene.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Antimicrobial peptides used in this study
|
For DNA cloning procedures, the Escherichia coli strain DH10B [F mcrA
(mrr-hsdRMS-mcrBC)
80dlacZ
M15
lacX74 deoR recA1 endA1 araD139
(ara leu)7697 galU galK rpsL nupG] (Life Technologies) was used. This strain was grown in LB medium, and when needed, the following antibiotics were added: ampicillin (100 µg/ml) and tetracycline (5 µg/ml).
Determination of MICs. The antimycoplasma activities of the antimicrobial peptides and other antibiotics were determined as described previously (6, 33). Briefly, mycoplasmas at an initial concentration of 106 CFU/ml were grown in 96-well plates in the presence of twofold serial dilutions of the antibiotics. A change in the color of the phenol red added to the medium as a pH indicator was used to monitor bacterial growth. The MIC was defined as the lowest antibiotic concentration that completely inhibited the growth of the mycoplasma after 48 h.
Selection of clones with increased resistance to antimicrobial peptides. The cultures were performed either in liquid medium or on agar plates. For the selection in broth medium, the first passage was performed with the peptide added at a concentration equal to half the MIC (MIC/2), and this concentration was serially increased by twofold in the next passages. Following this process of selection, individual clones were picked up after plating on agar plates which did not contain the selecting peptide. For the selection on agar plates, a Whatman disk (diameter, 5 mm) was laid at the surface of the medium, and the peptide (100 µl) was added directly to it at the concentration of MIC/2 for the first passage as detailed above.
Proteome analyses. Mycoplasmas were collected by centrifugation at the end of the exponential growth phase. Mycoplasma proteins were extracted by two different methods. In method A, the pelleted cells were directly lysed in a solution of 1x phosphate-buffered saline containing 0.5% sodium dodecyl sulfate, and the lysate was brought to 65°C for 15 min. After cooling, 4 volumes of cold acetone was added, and the proteins were recovered by centrifugation (12,000 x g, 15 min, 4°C). The pellet was air dried, and the proteins were solubilized in a cocktail buffer containing 7 M urea, 2 M thiourea, 2% (wt/vol) 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS), 1% (wt/vol) dithiothreitol, and 2% (vol/vol) Ampholytes (pH range, 3 to 10; Bio-Rad). In method B, the proteins were directly extracted from the mycoplasma cellular pellet in the same cocktail buffer, except that 2 mM protease inhibitor Pefabloc SC (Roche) was added. The subsequent analytical two-dimensional (2-D) gel electrophoreses were performed as described by others (41). Protein was determined using a modified Bradford assay (39). In the first dimension the isoelectric focusing (IEF) was performed using 24-cm ReadyStrip immobilized pH gradient strips with a nonlinear pH gradient of 3 to 10 (Bio-Rad). The proteins were separated by electrophoresis in the chamber of a PROTEAN IEF cell (Bio-Rad) for a total of 60 to 80 kVh. The second dimension was vertical sodium dodecyl sulfate gel electrophoresis using the buffer system of Laemmli in 12% polyacrylamide gels. After electrophoresis, the proteins were detected either by silver staining (34) or by Coomassie blue R-250 staining. Acquisition of gel images was performed using a GS-800 scanning densitometer and the dedicated PDQuest software (Bio-Rad).
Identification of proteins by mass spectroscopy. (i) In-gel protein digestion. Spots containing the proteins of interest were excised from the gel. When needed, silver-stained spots were destained using the PROTSIL2 Silver kit (Sigma Aldrich) according to the manufacturer's instructions. Spot-containing gel pieces were successively washed in H2O/methanol/acetic acid (47.5:47.5:5) and in acetonitrile (ACN), dried under a vacuum, rehydrated in 50 mM NH4HCO3 containing 10 ng µl1 trypsin (Sigma Aldrich), and incubated for 5 h at 37°C. This first supernatant was collected and stored at 20°C. The peptides left in the gel pieces were extracted once with 50 mM NH4HCO3 and twice with a H2O/ACN/HCOOH (47.5:47.5:5) solution. These three supernatants were pooled to the first one, concentrated in a vacuum centrifuge to a final volume of 30 µl, acidified by adding 1.8 µl of acetic acid, and stored at 20°C. The peptide mixtures were analyzed either by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) or by high-performance liquid chromatography-nanospray ion trap tandem MS analyses (LC-MS/MS) (see below), as indicated.
(ii) MALDI-TOF.
The MALDI-TOF analysis was performed using a spectrophometer from Applied Biosystems equipped with a nitrogen laser (337 nm, 20 Hz). The spectra of peptide masses were acquired in "reflectron" mode with a delay of extraction of 130 ns and a matrix of
-cyano-4-hydroxy cinnamic acid (CHCA). The data were collected by gating the masses from 500 to 5,000 Da. The resulting peptide fingerprints were compared to those deduced from the SWISS-PROT databank and from the M. pulmonis proteome predicted from its sequenced genome (13) using the MS-Fit tool of the Protein Prospector software (http://prospector.ucsf.edu/). The precision requirement was 30 ppm. The minimum number of peptides required for identification was four for each protein.
(iii) Online capillary LC-MS/MS. The peptide mixture resulting from trypsin digestion was analyzed by online capillary high-performance liquid chromatography (LC Packings) coupled to a nanospray LCQ ion trap mass spectrometer (ThermoFinnigan). Peptides were separated on a 75-µm (inner diameter) by 15-cm C18 PepMap column (LC Packings). The flow rate was 200 nl/min, and peptides were eluted using a 5 to 50% linear gradient of solvent B in solvent A; solvent A was 0.1% (vol/vol) formic acid in 5% ACN, and solvent B was 0.1% formic acid in 80% ACN. The mass spectrometer was operated in positive-ion mode at a 1.8-kV needle voltage and a 38-V capillary voltage. Data acquisition was performed in a data-dependent mode consisting of a full-scan MS over the range m/z 300 to 2,000, followed by three MS/MS on the three most intense ions in the survey scan in an exclusion dynamic mode. MS/MS data were acquired using a 2-m/z unit ion isolation window, 35% relative collision energy, and a 5-min dynamic exclusion duration. Data were searched against the theoretical proteome of M. pulmonis by using the SEQUEST software (ThermoFinnigan).
Recombinant DNA techniques. M. pulmonis genomic DNA was extracted using the Wizard genomic DNA purification kit (Promega) according to the supplier's recommendations. The hrcA gene (mnemonic Mypu_1420 [13]) from the different M. pulmonis clones was PCR amplified using the hrcAL (5'TTGGAAAATGGTTTTATTTATTTCTTCA3') and hrcAR (5'TCATCAAAGGCAGAGATGTCA3') primers. The PCR mixture was subjected to denaturation for 2 min at 94°C followed by 40 thermal cycles at 94°C (30 s), 68°C (30 s), and 72°C (2 min), followed by a final 5-min extension time at 72°C. The PCR products were sent to a commercial sequencing company (GENOME Express) for direct sequencing using the dideoxy chain termination method.
The pMPO5 plasmid (6,060 bp) which was previously described (15) harbors the oriC region of M. pulmonis and the tetM gene from the transposon Tn916. The full hrcA gene together with 280 nucleotides located upstream from its coding sequence was PCR amplified from the M. pulmonis MpUR1.1 genome using the hrcA1 (5'CCCACATGTATGGAGCAACATAGACCTTCA3') and hrcA2 (5'CCCACATGTTCATCAAAGGCAGAGATGTCA3') primers that include an AflIII site (underlined). The PCR product was digested with the restriction enzyme AflIII and inserted in the pMPO5 plasmid digested with the same enzyme to obtain the pHRCA plasmid. The integrity of the hrcA cloned gene was verified by sequencing. The MpUR1.1, G1, and M1 clones of M. pulmonis were transformed with the pHRCA plasmid in the presence of polyethylene glycol as previously described (15). The transformants were selected in liquid broth containing 5 µg/ml of tetracycline, and this concentration was increased to 20 µg/ml in the following passages.
Bioinformatics. The nucleotide and protein sequences were aligned using the ClustalW program (48). The CIRCE putative elements in the genome of M. pulmonis were searched using the SPAT program (search pattern annotation tool) available in the MolliGen database (4). The query sequence used was the following CIRCE consensus sequence (56): TTAGCACTC-N9-GAGTGCTAA, where N represents any nucleotide. A maximum of three substitutions was authorized.
|
|
|---|
Selection of M. pulmonis clones showing increased resistance to antimicrobial peptides. In order to obtain M. pulmonis clones showing increased resistance to at least some of these peptides, the mycoplasma was grown in the presence of increasing concentrations of peptide, starting with a concentration equal to half the MIC. These cultures were performed either in liquid medium or on agar plates.
Although repeated attempts were made, resistant clones were obtained with only melittin and gramicidin D, out of the seven peptides selected for these experiments. With melittin, four clones obtained from two independent rounds of selection in liquid medium (two clones from each round) and one clone obtained by selection on agar plates were kept for further study. With gramicidin D, eight clones obtained from two independent rounds of selection in liquid medium (four clones from each round) and two clones obtained by selection on agar plates were kept for further characterization (Table 2). The MICs of gramicidin D were increased from 16- to 128-fold for the gramicidin-resistant clones, and the MICs of melittin from 2.5- to 4-fold for the melittin-resistant clones. Once obtained, the level of resistance was quite stable without the need to maintain selection pressure (i.e., peptide added to the culture medium). Indeed, after 12 passages of the G1, G8, M1, and M2 clones in liquid medium without peptide, the MICs of melittin and gramicidin D were identical to those before passaging. This stability of the phenotype suggested that the resistance for the peptides was due to a mutation rather than to transient regulation of gene expression.
|
View this table: [in a new window] |
TABLE 2. Increased antibiotic resistance of M. pulmonis clones selected in the presence of melittin and gramicidin Da
|
The MICs of conventional antibiotics known to be active against M. pulmonis were also determined for the peptide-resistant clones and were compared with that for M. pulmonis MpUR1.1 (Table 2). Although the MICs of three antibiotics (enrofloxacin, chloramphenicol, and doxycycline) remained unchanged, a 4- to 32-fold increase in the MIC of tetracycline was measured for all the resistant clones (Table 2). This increase was not directly related to the level of resistance to the peptide, neither for gramicidin D nor for melittin.
The level of cross-resistance to gramicidin D, melittin, or tetracycline of the different clones was stable and was not affected by passages in a culture medium without selecting peptide added.
Comparative analyses of proteomes of M. pulmonis clones. In order to find the molecular mechanism underlying the antibiotic resistance detected in the G and M clones, we chose a global method of exploration. The proteomic technology was chosen since it was shown to be suitable to elucidate the cellular response of bacteria to antibiotics (3). The proteomes of M. pulmonis MpUR1.1 and of G and M clones were analyzed by 2-D gel electrophoresis. Cell proteins were resolved in more than 400 spots after silver staining (Fig. 1A). The proteomes of the G8 and M1 clones were highly similar to each other (Fig. 1B and C) and to the other G and M clones (data not shown). However, they contained several spots with higher intensity than in the reference MpUR1.1 clone (Fig. 1). To identify these upregulated proteins, the corresponding spots were excised from the gels and trypsin digested, and a peptide spectrum was generated by MALDI-TOF MS. The identification of the proteins was performed by peptide mass fingerprinting. The proteins that were upregulated in each of the G and M clones included the heat shock protein DnaK, elongation factor Tu (EF-Tu), enzyme I of the phosphoenolpyruvate transferase system, the pyruvate dehydrogenase alpha and beta subunits, the DNA-directed RNA polymerase alpha subunit, and subunit R3 of a restriction modification system. Although the stress response in M. pulmonis has not yet been studied, the upregulation of DnaK suggests that this response could be constitutively activated in the G and M clones. Although the other upregulated proteins are not considered heat shock proteins, some of them have been found upregulated in other bacteria responding to stress conditions. Indeed, in the gram-positive bacterium Listeria monocytogenes, there was increased production of elongation factor Tu, mannose-specific phosphotransferase system enzyme IIAB, and pyruvate dehydrogenase after a salt stress (18).
![]() View larger version (81K): [in a new window] |
FIG. 1. Comparative proteomic analysis of M. pulmonis MpUR1.1 (A), the G8 clone (B), and the M1 clone (C). Proteins were extracted from mycoplasma cells using method A (see Materials and Methods). Panels D, E, and F are enlargements of selected regions from panels A, B, and C, respectively. Two-dimensional electrophoresis was performed using 24-cm strips with a nonlinear pH gradient of 3 to 10 in the first dimension and a 12% polyacrylamide gel in the second dimension. Proteins were detected by silver staining. Molecular masses are given in kDa. Seven upregulated proteins were identified by mass spectrometry (MALDI-TOF): DnaK (a), enzyme I of the phosphoenolpyruvate transferase system (b), subunit R3 of a restriction modification system (c), a pyruvate dehydrogenase beta subunit (d), EF-Tu (e), a pyruvate dehydrogenase alpha subunit (f), and a DNA-dependent RNA polymerase alpha subunit (g). (G) The corresponding gene (Mypu_no) is indicated according to the published nomenclature of the M. pulmonis gene complement (13). The identification of the polypeptides was performed by MALDI-TOF MS. The number of peptides matching the theoretical trypsin digest of the polypeptide (Matching) is compared to the total number of detected peptides (Total). The ratio between the cumulative length of the matching peptides and the length of the protein is expressed as the percentage of peptide sequence coverage.
|
HrcA and stress response in M. pulmonis. In most bacteria, the stress response is mediated by alternative sigma factors and specific regulators. In mycoplasmas, including M. pulmonis, genome analysis has revealed only one sigma factor (13), which is homologous to general sigma factor A (or sigma-43 factor) of Bacillus subtilis. Therefore, since this work and other reports (52) indicate that mycoplasmas are capable of developing a stress response leading to the upregulation of heat shock proteins, regulatory factors other than alternative sigma factors have to be implicated in the expression of these proteins. The repressor HrcA, which is a regulator of stress response found in numerous bacteria (32, 56), has been predicted to be encoded in all of the 11 mollicute genomes sequenced at this time, and we could confirm this by searching the database MolliGen, which is dedicated to the genomics of Mollicutes for HrcA homologues (4; http://cbi.labri.fr/outils/molligen/). Transcriptional studies of the heat shock response in Mycoplasma pneumoniae (52) and in silico prediction suggested that the CIRCE-HrcA system could play a role in the response of mycoplasmas to this stress. From these data, it was hypothesized that a mutation in the hrcA gene could have occurred in the genomes of the G and M clones.
Therefore, the hrcA genes from M. pulmonis MpUR1.1 and from eight selected clones (G1, G2, G4, G8, G9, M1, M2, and M5) were PCR amplified and sequenced. The coding and the adjacent intergenic sequences of the hrcA gene from M. pulmonis MpUR1.1 were identical to the corresponding region in the published genome sequence of the M. pulmonis UAB CTIP strain (Fig. 2). In contrast, in all the hrcA sequences from the other clones, mutations which would result in a truncated HrcA product were found. With the exception of the G4 and M2 clones, there were insertions localized within a stretch of 29 nucleotides between positions 692 and 721 in the hrcA coding sequences of all the clones (Fig. 2). The G1, G8, M1, and M5 clones, which were independently obtained, shared the same insertion (GT between nucleotides 716 and 717), but for each of the four other clones (G2, G4, G9, and M2), the sequence was unique. For six of the clones (G1, G2, G8, G9, M1, and M5) the mutation would result in a C-terminal truncation of 100 to 111 amino acids. For the G4 clone, a single insertion at position 778 would result in an HrcA product in which the 73 C-terminal amino acids were truncated. For the M2 clone, a substitution and a single nucleotide deletion would result in an even shorter HrcA truncation of only six C-terminal amino acids and a modified C terminus over the last eight residues. Interestingly, upstream from these mutations, all the hrcA sequences from M. pulmonis MpUR1.1 and the eight selected clones were identical over 700 nucleotides.
![]() View larger version (55K): [in a new window] |
FIG. 2. hrcA gene sequence analysis in M. pulmonis MpUR1.1 (WT) and in eight other clones (G1, G2, G4, G8, G9, M1, M2, and M5). PCR products were obtained using primers hrcAL and hrcAR. (A) Sequencing by the same primers revealed insertions (Y), a deletion ( ), and a substitution (S) that produced new stop codons (black vertical bars). All mutations were found outside the helix-turn-helix motif (HTH) of the HrcA protein. The hatched rectangle indicates the region of the gene for which the alignment of the sequences is provided in panel B. (B) ClustalW alignment of the hrcA gene sequences at nucleotide positions 684 to 1041 (numbering from the wild-type sequence). Stop codons and mutated sites are underlined once and twice, respectively.
|
The genes which are regulated following a specific stress belong to a set that is partially overlapping a set of genes regulated during a different type of stress. With this in mind, we evaluated whether an experimentally induced heat stress response in M. pulmonis would be associated with decreased sensitivity towards antimicrobial peptides or other antibiotics.
Heat shock response in M. pulmonis and resistance to antimicrobial peptides. During a natural M. pulmonis infection, part of the host's response consists of an increased body temperature (i.e., fever), which represents a stress for the mycoplasma. We evaluated whether these conditions would lead to increased MICs of the antimicrobial peptides. M. pulmonis MpUR1.1 was passaged nine times under an incubation temperature kept at 40°C, with the hope that these conditions would mimic the temperature found in the rodent lung during an active M. pulmonis acute infection. After these passages at 40°C, the MICs of melittin, gramicidin D, and tetracycline were determined at 37°C; only the MIC of gramicidin D was found to be increased (eightfold increase) (Table 3). Interestingly, if the nine passages at 40°C were followed by two passages at 37°C before determination of the MIC, the MIC of gramicidin D was not found to be increased. This result clearly established that the passages at an increased temperature (40°C) resulted in changes in the cell metabolism that were associated with increased resistance to gramicidin D. However, this increased MIC was transient and returned to normal once the mycoplasma was grown at 37°C (Table 3).
|
View this table: [in a new window] |
TABLE 3. Effect of M. pulmonis MpUR1.1 growth temperature on MICs of antimicrobial peptidesa
|
![]() View larger version (54K): [in a new window] |
FIG. 3. Proteomic analysis of M. pulmonis MpUR1.1 after culture at 37°C (A) or 40°C (B). Proteins were extracted from the mycoplasma cells by method B (see Materials and Methods). Two-dimensional electrophoresis was performed as indicated in the legend to Fig. 1. Proteins were stained with Coomassie blue. Six upregulated spots were analyzed by LC-MS/MS and identified as DnaK (spot a), EF-Ts (spot b), glyceraldehyde 3 phosphate dehydrogenase (spot c), thioredoxin reductase (spot d), and protein of unknown function (spots e and f). (C) The corresponding gene (Mypu_no) is indicated according to the published nomenclature of the M. pulmonis gene complement (13). The number of peptides identified by LC-MS/MS, the cumulative length of these peptides compared to the total length of the protein, and the corresponding percentage of peptide coverage are indicated.
|
![]() View larger version (58K): [in a new window] |
FIG. 4. Proteomic analysis of the hrcA-complemented M. pulmonis M1 clone. Proteins were extracted from the cells of M. pulmonis MpUR1.1 (A), clone M1 (B), and transformant CM1 (C) by method B (see Materials and Methods). Two-dimensional electrophoresis was performed as indicated in the legend to Fig. 1. Proteins were detected using silver staining. The seven upregulated proteins (Fig. 1) that were identified by comparing the proteomes of M. pulmonis MpUR1.1 and clone M1 are indicated (spots a to g). Spot h corresponds to a mixture of two proteins that are upregulated in the CM1 transformant compared to the proteome of M. pulmonis MpUR1.1. (D) The number of peptides identified by LC-MS/MS, the cumulative length of these peptides compared to the total length of the protein, and the corresponding percentage of peptide coverage are indicated.
|
|
|
|---|
The isolation of M. pulmonis clones with increased MICs to both melittin and gramicidin D but not to other antimicrobial peptides is surprising because these two molecules are structurally different although being both linear (Table 1). Melittin, a bee venom component, is a genetically encoded 26-residue peptide composed exclusively of amino acids identical to those found in proteins. In contrast, gramicidin D is a shorter peptide (15 residues), is nonribosomally synthesized by Bacillus brevis, and displays a sequence of alternating D- and L-amino acids. Furthermore, while melittin is mainly
-helical in lipid bilayers, gramicidin D is believed to form transmembrane, left-handed antiparallel ß-helices (10). The association between the increased MICs of these two peptides for the G and M clones and an increased MIC of tetracycline is of particular interest because this may represent a new mechanism of resistance to an antibiotic that is still widely used in the clinical setting (14).
Modifications observed in the expressed proteomes of resistant clones suggested that peptide resistance and stress response could be correlated in some way. An association between antibiotic resistance and stress response has already been reported in gram-negative bacteria (Gracilicutes) for which a response to osmotic stress was observed after nonbactericidal exposure to polymyxin B or cecropin (35, 36). In agreement with this hypothesis, in all the G and M clones, mutations were identified in the hrcA gene that has been shown to control stress response in many bacteria (32, 56) and proposed to play the same role in mycoplasmas (52, 56). The HrcA protein acts as a repressor of several genes encoding stress proteins, among them the chaperones DnaK and DnaJ and the protease Lon. The mutations in the hrcA gene in the G and M clones could result in constitutive activation of the stress response in cells. In agreement with this proposal, DnaK was identified among the proteins that were upregulated in the G and M clones, which supports the hypothesis that the dnaK gene is under the negative regulation of HrcA. Moreover, a computer search of HrcA-binding sequences (CIRCE elements) on the M. pulmonis genome revealed a potential CIRCE element upstream from the dnaK gene. Two other CIRCE elements, upstream from the lon and dnaJ genes, were predicted (Table 4). Although no definitive conclusion could be drawn for the regulation of these two genes because the corresponding proteins were not identified by 2-D gel electrophoresis, our results strongly suggest that resistance to melittin and gramicidin D could result, at least in part, from a derepression of HrcA-regulated genes. The partial restoration of peptide sensitivity after complementation with the wild-type hrcA gene is in agreement with this proposal.
|
View this table: [in a new window] |
TABLE 4. Localization of CIRCE elements in the M. pulmonis genome
|
The upregulation of enzymes involved in the energetic metabolism of M. pulmonis (phosphotransferase system enzymes involved in the uptake of sugars and pyruvate dehydrogenase which catalyzes the formation of acetyl-coenzyme A) may be necessary to cope with increased energy demand. Indeed, mycoplasmas use the proton motive force to activate secondary substrate transport systems. In fermentative bacteria, the proton motive force is generated by the ATPase F0F1 functioning as a proton pump activated by the ATP produced by substrate-level phosphorylation. Since in bacteria the cell energetic charge needs to be finely tuned, any loss of energy due, for example, to membrane permeabilization by amphipathic peptides should be compensated by an increased yield of energy.
The proteomic analysis of the G and M clones of M. pulmonis defined a set of proteins that were upregulated, plausibly as a consequence of the mutations in the hrcA gene. However, the proteins detected by 2-D gel electrophoresis are only a subset of the complete proteome and probably do not include very hydrophobic proteins and proteins with a high pI, a well-known limit of 2-D protein electrophoresis. Consequently, we cannot exclude the possibility that the expression of other proteins could be modified in the resistant clones. In fact, an analysis performed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that the variable surface antigens of M. pulmonis varied among the analyzed clones (data not shown). The analysis of these polypeptides that are known to vary at high frequency (51) did not reveal any correlation with resistance to antimicrobial peptides. This is in agreement with a recent report indicating that larger versions of variable surface antigens provide M. pulmonis with a shield protecting it from complement lysis but not the action of smaller molecules, such as gramicidin D (45).
The occurrence of mutations in the same region of the hrcA gene among M. pulmonis clones that were independently obtained is striking and raises the possibility that this region of the genome could be a hot spot for mutations. Although the exploration of such a hypothesis would require much more data, it is of interest to note that no other mutation was found in the 700 nucleotides upstream from the mutated region of hrcA. The lack of a system of methyl-directed mismatch repair in mycoplasmas led to the hypothesis that they could be considered constitutive mutators (46). If this were true, it would favor the development of antibiotic resistance as previously described for other bacteria (24). The genomes of mutator bacteria are characterized by a high frequency of mutations; in the case of mycoplasmas, this is supported at least partially by phylogenetic studies based on rRNA gene sequences which suggested that mycoplasmas have a high mutation rate and hence are in a state of rapid evolution (43, 53, 55). In the case of genome regions other than rRNA, there is a lack of experimental data to document a putative higher-than-normal frequency of mutation. However, it has been shown for many mycoplasma species that high-frequency point mutations at specific locations, such as microsatellites, is a strategy used by mycoplasmas to generate surface antigen diversity (40, 42). It was also found recently that reversible point mutations, located in a nonrepeated region of the chromosome, are responsible for the phase variation of the GapA cytadhesin in M. gallisepticum (54) and of the glucose phosphotransferase system permease (ptsG) in M. mycoides subsp. mycoides SC (23). In our study, the mutations in the hrcA gene occur in the same region of the gene where no statistically significant DNA repeats were found during a survey of the entire genome (42). It is possible that the stress due to the exposure to the antimicrobial peptides could favor the accumulation of mutations in particular regions of the genome. Recently, the stress associated with aging cells within a bacterial population was described as a factor influencing the mutation rate in E. coli (7). It remains to be determined whether the mutation in the hrcA gene is reversible, even at low frequency, as was documented for the mutation in the ptsG gene of M. mycoides subsp. mycoides SC, and whether such instability could be considered as an evolutionary strategy to escape peptide-mediated antimicrobial response during host-pathogen interaction.
We acknowledge the help of Marc Bonneu and Stéphane Claverol from the Pôle Protéomique of the Plateforme Génomique Fonctionnelle de Bordeaux, who provided the expertise and technical assistance for the identification of proteins by mass spectrometry. We also acknowledge the gift of dermaseptin B5 from Pierre Nicolas (Institut Jacques Monod, Université de Paris 6).
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»