Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, October 2005, p. 4379-4381, Vol. 49, No. 10
0066-4804/05/$08.00+0 doi:10.1128/AAC.49.10.4379-4381.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Macrolide Resistance Mediated by a Bifidobacterium breve Membrane Protein
Abelardo Margolles,1*
José Antonio Moreno,1,2
Douwe van Sinderen,2 and
Clara G. de los Reyes-Gavilán1
Instituto de Productos Lácteos de Asturias, Consejo Superior de Investigaciones Científicas, Ctra. Infiesto s/n, 33300, Villaviciosa, Asturias, Spain,1
Alimentary Pharmabiotic Centre, Department of Microbiology, University College Cork, Western Road, Cork, Ireland2
Received 7 April 2005/
Returned for modification 24 June 2005/
Accepted 14 July 2005

ABSTRACT
A gene coding for a hypothetical membrane protein from
Bifidobacterium breve was expressed in
Lactococcus lactis. Immunoblotting demonstrated
that this protein is located in the membrane. Phenotypical changes
in sensitivity towards 21 antibiotics were determined. The membrane
protein-expressing cells showed higher levels of resistance
to several macrolides.

TEXT
Bifidobacteria are natural inhabitants of the human gut microbiota,
representing up to 91% of the total gut population in breast-fed
babies (
3). Some strains of the genus
Bifidobacterium are considered
probiotics and can exert several health-promoting effects (
11).
Among them,
Bifidobacterium breve is one of the species more
often found in infants (
9).
The intestinal microbiota is continuously exposed to cytotoxic agents, including antibiotics. Recent evidence indicates that B. breve is generally more resistant to antibiotics than other Bifidobacterium species (10). It is thus reasonable to assume that this species may have a stronger intrinsic resistance than the other species of this genus. In this context, we investigated B. breve genes with a potential role in conferring resistance to cytotoxic compounds, such as antibiotics and bile salts.
Gene selection and protein location.
Using a bioinformatics-based analysis with the preliminary genome sequence of B. breve UCC2003 (S. Leahy, J. A. Moreno, M. O'Connell-Motherway, H. G. Higgins, G. F. Fitzgerald, and D. Van Sinderen, unpublished data), a 3,301-bp DNA fragment was selected. Its genetic analysis revealed the presence of a 1,074-bp open reading frame encoding a hypothetical 357-amino-acid membrane protein. Two incomplete open reading frames, transcribed in opposite directions, were found, indicating that the gene is located in a monocistronic operon (Fig. 1A). A database enquiry allowed us to determine that the hypothetical protein of 38.6 kDa displayed significant homology to several hypothetical bile and multidrug resistance secondary transporters. Hydropathy profile analysis using the Expasy Proteomic Server predicted a highly hydrophobic protein with eight transmembrane-spanning regions and hydrophilic sequences, at both the N and C termini, located in the cytoplasm (Fig. 1B).
Currently, genetic studies of the genus
Bifidobacterium are
limited by the lack of molecular tools for disrupting genes
and expressing proteins. Since previous studies have shown that
Lactococcus lactis can express large quantities of
Bifidobacterium proteins (
8),
L. lactis was chosen as the host to analyze the
change of phenotype occurring as a consequence of expressing
the hypothetical membrane protein. Total DNA was obtained from
B. breve as described previously (
8), and the gene was amplified
using the primers 5'-TGCGACCA
CCATGGAGAAGGTCAAGGCTTTCGC-3' and
5'-GCCGAC
TCTAGATTATCAGCCTTCGACCTTGGC-3'. The PCR product was
digested with NcoI and XbaI and ligated into the pNZ8048 vector
(
2), resulting in pN38. This nisin-inducible plasmid was transformed
into
L. lactis NZ9000 (
7). A variant of the gene was constructed,
which contained a set of 3'-tagged histidine codons, using the
same forward primer combined with the primer 5'-TGCGATCA
AAGCTTTTATCAGTGATGGTGATGGTGATGGCCTTCGACCTTGGCATCAGCG-3'.
The resulting PCR product was digested with NcoI and HindIII
and ligated into pNZ8048 to yield plasmid pNH38.
Inside-out membrane vesicles from L. lactis were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 2A) and Western blotting (Fig. 2B), using horseradish peroxidase-conjugated antihistidine antibodies (QIAGEN, Inc., Valencia, CA). Western blots were developed with 4-chloro-1-naphthol. The nisin-induced control cells, harboring the empty vector, and the noninduced pNH38-containing cells did not show any signal on the Western blot (Fig. 2B). In contrast, the addition of nisin to L. lactis harboring pNH38 resulted in the synthesis of the histidine-tagged protein, which was located in the membrane and had the expected molecular mass of about 38 kDa.
Antimicrobial susceptibility.
For MIC determinations, control cells (harboring pNZ8048) and
pN38-containing cells were grown at 30°C to an optical density
at 600 nm (OD
600) of about 0.4 in GM17 (M17 [Oxoid Limited,
Hampshire, United Kingdom] with 0.5% of glucose) containing
5 µg/ml chloramphenicol. At this point, 0.05% of the culture
supernatant of the nisin-producing strain
L. lactis NZ9700 (
5)
was added to trigger transcription. Subsequently, the cells
were incubated for 1 h, and one milliliter of the culture was
added to 30 ml of soft (0.7% agar) GM17 at 40°C, containing
0.05% of the
L. lactis NZ9700 culture supernatant. Then, the
mixture was layered on the top of 15-cm petri dishes containing
50 ml of GM17 (2% agar), to which supernatant of the
L. lactis nisin-producing strain had been added. Etest strips of 21 different
antibiotics (AB Biodisk, Solna, Sweden) were applied with an
applicator, and MICs were determined after 48 h of incubation.
The membrane protein conferred resistance (more than 3.9-fold
increase in MIC determinations) to erythromycin, clarithromycin,
dirithromycin, and azithromycin (Table
1). A smaller increase
of resistance was observed for amynoglycosides, quinupristin-dalfopristin,
rifampin, polymyxin, and vancomycin. Additional susceptibility
tests were carried out using ethidium bromide, ox bile extract,
and several bile salts. However, no differences in growth inhibition
between the control (containing pNZ8048) and the cells containing
pN38 were found for these compounds.
View this table:
[in this window]
[in a new window]
|
TABLE 1. MICs of several antibiotics for the membrane protein-expressing L. lactis cells (pN38) and L. lactis cells not expressing the protein (control)a
|
Growth inhibition assays.
Precultures of induced control and pN38-containing cells grown
to an OD
600 of 0.8 were diluted 100-fold in GM17 containing
nisin and erythromycin, clarithromycin, dirithromycin, or azithromycin
at different concentrations. Cells were grown until they reached
the stationary phase (8 to 10 h) and compared by monitoring
the growth rate and the optical density. In the absence of antibiotic,
the growth rate of control cells was comparable to that of the
membrane protein-expressing cells (0.71 ± 0.053 and 0.77
± 0.033, respectively), and the OD
600s of the cultures
at the stationary phase were very similar (2.31 ± 0.07
for control cells and 2.37 ± 0.15 for the membrane protein-expressing
cells). However, nisin-induced pN38-containing cells consistently
reached higher densities and higher growth rates than the control
cells under the same conditions. Figure
3 shows the effect of
erythromycin, clarithromycin, and azithromycin on the maximum
specific growth rate. Half-maximal inhibitory concentrations
for the four macrolides studied were between 1.7 and 2.7 times
higher for the membrane protein-expressing cells (erythromycin,
0.22 ± 0.015 µM; clarithromycin, 0.08 ±
0.008 µM; dirithromycin, 6.7 ± 1.8 µM; and
azithromycin, 0.64 ± 0.06 µM) compared to the control
cells (erythromycin, 0.13 ± 0.01 µM; clarithromycin,
0.04 ± 0.007 µM; dirithromycin, 3.1 ± 0.1
µM; and azithromycin, 0.24 ± 0.04 µM).
Concluding remarks.
Several studies have dealt with resistance patterns of
Bifidobacterium (
1,
6,
10,
15,
16), but only a single molecular determinant,
tetW, has so far been identified (
14). In this report we show
the first evidence for the involvement of a membrane protein
from
B. breve conferring moderate resistance to macrolides when
expressed in the heterologous host
L. lactis. This membrane
protein exhibits characteristics reminiscent of multidrug resistance
proteins, representing transporters with a broad substrate specificity,
which includes bile salts and many antibiotics (
4,
12,
13).
We therefore propose to name this membrane protein BbmR (
Bifidobacterium
breve
macrolide
Resistance protein; GenBank accession number
DQ115902).

ACKNOWLEDGMENTS
This research was financially supported by the Ministerio de
Ciencia y Tecnología of Spain (grant AGL2001-2296) and
by the European Union through the STREP project ACE-ART (FP6506214)
and by FEDER founds. The work was also financially supported
by the Department of Agriculture and Food FIRM program (01/R&D/C/159),
by the Higher Education Authority Programme for Research in
Third Level Institutions, and by the SFI-funded Alimentary Pharmabiotic
Centre.
We thank S. Leahy, M. O'Connell-Motherway, G. F. Fitzgerald, and H. G. Higgins for sharing unpublished data with us. We acknowledge Oscar Kuipers for providing us with the plasmid pNZ8048.

FOOTNOTES
* Corresponding author. Mailing address: Instituto de Productos Lácteos de Asturias, Consejo Superior de Investigaciones Científicas (CSIC), Ctra. Infiesto s/n, 33300, Villaviciosa, Asturias, Spain. Phone: 34 985 89 21 31. Fax: 34 985 89 22 33. E-mail:
amargolles{at}ipla.csic.es.


REFERENCES
1 - Charteris, W. P., P. M. Kelly, L. Morelli, and J. K. Collins. 1998. Antibiotic susceptibility of potentially probiotic Bifidobacterium isolates from human gastrointestinal tract. Lett. Appl. Microbiol. 26:333-337.[CrossRef][Medline]
2 - de Ruyter, P. G., O. P. Kuipers, and W. M. de Vos. 1996. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol. 62:3662-3667.[Abstract/Free Full Text]
3 - Harmsen, H. J., A. C. Wildeboer-Veloo, G. C. Raangs, A. A. Wagendorp, L. Klijn, J. G. Bindels, and G. W. Welling. 2000. Analysis of intestinal flora development in breast-fed and formula-fed infants by using molecular identification and detection methods. J. Pediatr. Gastroenterol. Nutr. 30:61-67.[CrossRef][Medline]
4 - Janvilisri, T., S. Shahi, H. Venter, L. Balakrishnan, and H. W. van Veen. 2005. Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem. J. 385:419-426.[CrossRef][Medline]
5 - Kuipers, O. P., M. M. Beerthuyzen, R. J. Siezen, and W. M. de Vos. 1993. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for development of immunity. Eur. J. Biochem. 216:281-291.[Medline]
6 - Lim, K. S., C. S. Huh, and Y. J. Baek. 1993. Antimicrobial susceptibility of bifidobacteria. J. Dairy Sci. 76:2168-2174.[Abstract]
7 - Margolles, A., M. Putman, H. W. van Veen, and W. N. Konings. 1999. The purified and functionally reconstituted multidrug transporter LmrA of Lactococcus lactis mediates the transbilayer movement of specific fluorescent phospholipids. Biochemistry 38:16298-16306.[CrossRef][Medline]
8 - Margolles, A., and C. G. de los Reyes-Gavilán. 2003. Purification and functional characterization of a novel
-L-arabinofuranosidase from Bifidobacterium longum NB667. Appl. Environ. Microbiol. 69:5096-5103.[Abstract/Free Full Text]
9 - Matsuki, T., K. Watanabe, R. Tanaka, M. Fukuda, and H. Oyaizu. 1999. Distribution of bifidobacterial species in human intestinal microflora examined with 16S rRNA gene-targeted species-specific primers. Appl. Environ. Microbiol. 65:4506-4512.[Abstract/Free Full Text]
10 - Moubareck, C., F. Gavini, L. Vaugien, M. J. Butel, and F. Doucet-Populaie. 2005. Antimicrobial susceptibility of bifidobacteria. J. Antimicrob. Chemother. 55:38-44.[Abstract/Free Full Text]
11 - Ouwehand, A. C., S. Salminen, and E. Isolauri. 2002. Probiotics: an overview of beneficial effects. Antonie Leeuwenhoek 82:279-289.
12 - Prouty, A. M., I. E. Brodsky, S. Falkow, and J. S. Gunn. 2004. Bile-salt-mediated induction of antimicrobial and bile resistance in Salmonella typhimurium. Microbiology 150:775-783.[Abstract/Free Full Text]
13 - Rosenberg, E. Y., D. Bertenthal, M. L. Nilles, K. P. Bertrand, and H. Nikaido. 2003. Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein. Mol. Microbiol. 48:1609-1619.[CrossRef][Medline]
14 - Scott, K. P., C. M. Melville, T. M. Barbosa, and H. J. Flint. 2000. Occurrence of the new tetracycline resistance gene tet(W) in bacteria from the human gut. Antimicrob. Agents Chemother. 44:775-777.[Abstract/Free Full Text]
15 - Yazid, A. M., A. M. Ali, M. Shuhaimi, V. Kalaivaani, M. Y. Rokiah, and A. Reezal. 2000. Antimicrobial susceptibility of bifidobacteria. Lett. Appl. Microbiol. 31:57-62.[CrossRef][Medline]
16 - Zhou, J. S., C. J. Pillidge, P. K. Gopal, and H. S. Hill. 2005. Antibiotic susceptibility profiles of new probiotic Lactobacillus and Bifidobacterium strains. Int. J. Food. Microbiol. 98:211-2177.[CrossRef][Medline]
Antimicrobial Agents and Chemotherapy, October 2005, p. 4379-4381, Vol. 49, No. 10
0066-4804/05/$08.00+0 doi:10.1128/AAC.49.10.4379-4381.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Gueimonde, M., Garrigues, C., van Sinderen, D., de los Reyes-Gavilan, C. G., Margolles, A.
(2009). Bile-Inducible Efflux Transporter from Bifidobacterium longum NCC2705, Conferring Bile Resistance. Appl. Environ. Microbiol.
75: 3153-3160
[Abstract]
[Full Text]
-
Aires, J., Doucet-Populaire, F., Butel, M. J.
(2007). Tetracycline Resistance Mediated by tet(W), tet(M), and tet(O) Genes of Bifidobacterium Isolates from Humans. Appl. Environ. Microbiol.
73: 2751-2754
[Abstract]
[Full Text]
-
Margolles, A., Florez, A. B., Moreno, J. A., van Sinderen, D., de los Reyes-Gavilan, C. G.
(2006). Two membrane proteins from Bifidobacterium breve UCC2003 constitute an ABC-type multidrug transporter. Microbiology
152: 3497-3505
[Abstract]
[Full Text]