AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Webber, M. A.
Right arrow Articles by Piddock, L. J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webber, M. A.
Right arrow Articles by Piddock, L. J. V.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, October 2005, p. 4390-4392, Vol. 49, No. 10
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.10.4390-4392.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Contribution of Mutation at Amino Acid 45 of AcrR to acrB Expression and Ciprofloxacin Resistance in Clinical and Veterinary Escherichia coli Isolates

Mark A. Webber, Ashraf Talukder, and Laura J. V. Piddock*

Antimicrobial Agents Research Group, Division of Immunity and Infection, The University of Birmingham, Edgbaston, Birmingham, B15 2TT, United Kingdom

Received 23 May 2005/ Returned for modification 1 July 2005/ Accepted 21 July 2005


   ABSTRACT
Top
 Abstract
Text
 References
 
Fluoroquinolone-resistant Escherichia coli isolates which overexpressed acrB and had a substitution at amino acid 45 of AcrR were complemented with wild-type acrR. Complementation led to increased sensitivity to ciprofloxacin and to ethidium bromide, suggesting that mutation at amino acid 45 of AcrR contributes to ciprofloxacin resistance.


   TEXT
Top
 Abstract
 Text
References
 
The AcrAB-TolC efflux system has been shown to contribute to the intrinsic antibiotic resistance of Escherichia coli, and overexpression of this system can lead to multiple-antibiotic resistance (6). Consequently, the genetic mechanisms leading to overexpression of acrAB have been the focus of recent interest. Initially, in vitro experiments suggested that the global regulators, MarA, SoxS, and Rob, all of which can activate transcription of acrAB, may be the primary mechanism by which overexpression of acrAB is mediated (1). However, analysis of highly antibiotic resistant clinical isolates of E. coli, Salmonella enterica serovar Typhimurium, and Klebsiella pneumoniae by ourselves and others (7, 8, 9, 10, 11) have identified mutations within AcrR, the repressor of AcrAB (5) at a higher frequency than mutations within the mar, sox, and rob loci. Previously, we identified a number of ciprofloxacin-resistant mutants that overexpressed acrB from disparate locations and sources (animal isolates from the United Kingdom and human isolates from Argentina and Spain) which carried a cysteine replacing an arginine at amino acid 45 of AcrR (11). While other workers have reported mutations throughout AcrR, the recurring mutation at position 45 in our isolates suggested that this mutation was particularly important. The fact that this mutation was detected among unrelated isolates from animals and humans from three geographically distant countries indicated that it is likely that this mutation can arise spontaneously in E. coli with diverse genetic backgrounds. Analysis of the structure of AcrR indicated that amino acid 45 lies within the middle of a putative helix-turn-helix DNA binding motif. Alignment of other AcrR homologues indicated that the arginine at position 45 is highly conserved, further evidence that mutation here will lead to loss of repressive function.

The aim of this study was to determine whether the mutation at amino acid 45 of AcrR observed in the isolates characterized previously was responsible for the elevated expression of AcrAB observed in these strains.

All the strains used in this study are listed in the table, strains I87, I88, I89, I237, I238, and I239 all carry the substitution of arginine with cysteine at amino acid 45 of AcrR and all carry a leucine replacing a serine at amino acid 83 of GyrA. Strains AG100 and AG102 are a wild-type E. coli K-12 strain and a marR1 derivative strain, respectively, which were used as controls (4). Bacteria were cultured on Luria-Bertani agar and in Luria-Bertani broth. All chemicals were obtained from Sigma Aldrich Ltd. (Poole, United Kingdom). Ciprofloxacin was a kind gift of Bayer AG (Wuppertal, Germany).

The plasmid pAT was constructed for complementation experiments. Wild-type acrR was amplified from AG100 (using forward [5' GAACCTGAAGAACGACCTGA 3'] and reverse [5' CATCAGAACGACCGCACGAG 3'] primers) and, after verification by sequencing, cloned into pGEM-T Easy (Promega, Southampton, United Kingdom) to create pAT. pAT was electroporated into all the isolates with the substitution at amino acid 45.

The MIC of ciprofloxacin and ethidium bromide for each strain was determined by using the agar dilution method according to the guidelines of the British Society for Antimicrobial Chemotherapy by use of Iso-Sensitest agar (2).

Expression of acrB and acrR was determined using comparative reverse transcription-PCR (3). RNA was prepared by using the RNAce spin cell mini kit (Bioline, London, United Kingdom) before being reverse transcribed into cDNA by using Superscript III (Invitrogen, Paisley, United Kingdom). Serial dilutions of cDNA were used as templates in PCRs for amplification of acrR, acrB, and 16S rRNA. The resulting amplimers were quantified by using a WAVE dHPLC instrument (Transgenomic, Crewe, United Kingdom) and Navigator software (Transgenomic, Crewe, United Kingdom). Expression of each gene was compared in early and late growth phase, in the presence and absence of pAT.

The MICs of each strain in the presence and absence of pAT are shown in Table 1. The presence of pAT led to a two- to fourfold increase in sensitivity to ciprofloxacin for all the test strains and increased susceptibility to ethidium bromide for 3/6 test isolates. Transformation of AG100 with pAT alone caused no change in susceptibility to ciprofloxacin or ethidium bromide, indicating that the plasmid itself had no effect on susceptibility to these agents.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Strains used in this study, mutations, and antibiotic susceptibilities

 
Figure 1 shows the expression of acrB and acrR in early and late logarithmic growth phase. The addition of pAT led to clear changes in the expression levels of acrR and acrB (Fig. 1A and B, respectively). Increased acrR expression in the presence of pAT was observed for 5/6 strains at early logarithmic growth and for 4/6 strains at late logarithmic growth. In contrast, the addition of pAT led to a decrease in the expression of acrB for all strains at both growth phases investigated. These data suggest that the addition of pAT increases the amount of acrR expressed by the cell and that expression of wild-type acrR from the pAT vector leads to a reduction of acrB expression, presumably as a result of restoration of repressive activity.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 1. Expression of acrB and acrR at early and late logarithmic growth phases in the presence and absence of pAT. (A) Expression of acrR. (B) Expression of acrB. +, expression in the presence of pAT. Closed bars indicate expression at an optical density of 0.4 and open bars expression at an optical density of 0.8. Expression is displayed in arbitrary units of fluorescence.

 
The results presented here suggest that mutation at amino acid 45 of AcrR contributes to resistance to ciprofloxacin in conjunction with substitutions in GyrA as shown by the increased sensitivity to ciprofloxacin observed upon the addition of pAT to the ciprofloxacin-resistant strains. The mechanism of this is presumably by restoration of the repressive function of wild-type AcrR. These data suggest that mutation at amino acid 45 is important as a contributor to antibiotic resistance, and the detection of this mutation among diverse isolates from animals and humans from divergent geographical locations indicates that it may be of particular importance. However, the relative frequency of the occurrence of this mutation is unknown, and more isolates need to be examined to determine whether this mutation is a significant contributor to multiple-antibiotic resistance in E. coli. Interestingly, although our laboratory has been successful in introducing a number of mutations into efflux-associated genes in various Enterobacteriaceae in recent years, attempts to artificially engineer this substitution in wild-type K-12 laboratory strains of E. coli by using the pKNOCK family of suicide vectors have not been successful to date. It is possible that attenuated laboratory strains are not amenable to this mutation being present or that specific selective conditions which we have been unable to recreate in the laboratory are required to select mutants carrying the substitution of arginine to cysteine in AcrR. Further characterization of the role of mutations within AcrR as a contributor to antibiotic resistance in conjunction with different topoisomerase genotypes is required to further define the role of this gene in resistance.


   ACKNOWLEDGMENTS
 
M.W. is supported by the Bristol Myers Squibb Unrestricted award in infectious diseases awarded to L.J.V.P.

We thank Andrew Bailey for reading the manuscript.


   FOOTNOTES
 
* Corresponding author. Mailing address: Antimicrobial Agents Research Group, Division of Immunity and Infection, The University of Birmingham, Edgbaston, Birmingham, B15 2TT, United Kingdom. Phone: 44 121 414 6966. Fax: 44 121 414 6815. E-mail: l.j.v.piddock{at}bham.ac.uk. Back


   REFERENCES
Top
 Abstract
 Text
 References
 

  1. Alekshun, M. N., and S. B. Levy. 1999. The mar regulon: multiple resistance to antibiotics and other toxic chemicals. Trends Microbiol. 7:410-413.[CrossRef][Medline]
  2. Andrews, J. M. 2001. Determination of minimum inhibitory concentrations. J. Antimicrob. Chemother. 48(Suppl. 1):5-16.[Abstract]
  3. Eaves, D. J., V. Ricci, and L. J. Piddock. 2004. Expression of acrB, acrF, acrD, marA, and soxS in Salmonella enterica serovar Typhimurium: role in multiple antibiotic resistance. Antimicrob. Agents Chemother. 48:1145-1150.[Abstract/Free Full Text]
  4. George, A. M., and S. B. Levy. 1983. Amplifiable resistance to tetracycline, chloramphenicol, and other antibiotics in Escherichia coli: involvement of a non-plasmid-determined efflux of tetracycline. J. Bacteriol. 155:531-540.[Abstract/Free Full Text]
  5. Ma, D., M. Alberti, C. Lynch, H. Nikaido, and J. E. Hearst. 1996. The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia coli by global stress signals. Mol. Microbiol. 19:101-112.[CrossRef][Medline]
  6. Okusu, H., D. Ma, and H. Nikaido. 1996. AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. J. Bacteriol. 178:306-308.[Abstract/Free Full Text]
  7. Olliver, A., M. Valle, E. Chaslus-Dancla, and A. Cloeckaert. 2004. Role of an acrR mutation in multidrug resistance of in vitro-selected fluoroquinolone-resistant mutants of Salmonella enterica serovar Typhimurium. FEMS Microbiol. Lett. 238:267-272.[Medline]
  8. Rand, J. D., S. G. Danby, D. L. Greenway, and R. R. England. 2002. Increased expression of the multidrug efflux genes acrAB occurs during slow growth of Escherichia coli. FEMS Microbiol. Lett. 207:91-95.[CrossRef][Medline]
  9. Schneiders, T., S. G. Amyes, and S. B. Levy. 2003. Role of AcrR and RamA in fluoroquinolone resistance in clinical Klebsiella pneumoniae isolates from Singapore. Antimicrob. Agents Chemother. 47:2831-2837.[Abstract/Free Full Text]
  10. Wang, H., J. L. Dzink-Fox, M. Chen, and S. B. Levy. 2001. Genetic characterization of highly fluoroquinolone-resistant clinical Escherichia coli strains from China: role of acrR mutations. Antimicrob. Agents Chemother. 45:1515-1521.[Abstract/Free Full Text]
  11. Webber, M. A., and L. J. Piddock. 2001. Absence of mutations in marRAB or soxRS in acrB-overexpressing fluoroquinolone-resistant clinical and veterinary isolates of Escherichia coli. Antimicrob. Agents Chemother. 45:1550-1552.[Abstract/Free Full Text]

Antimicrobial Agents and Chemotherapy, October 2005, p. 4390-4392, Vol. 49, No. 10
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.10.4390-4392.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Webber, M. A.
Right arrow Articles by Piddock, L. J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webber, M. A.
Right arrow Articles by Piddock, L. J. V.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS