This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Domingo, M.-C.
Right arrow Articles by Bergeron, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Domingo, M.-C.
Right arrow Articles by Bergeron, M. G.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, November 2005, p. 4784-4786, Vol. 49, No. 11
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.11.4784-4786.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

High Prevalence of Glycopeptide Resistance Genes vanB, vanD, and vanG Not Associated with Enterococci in Human Fecal Flora

M.-C. Domingo,1,2 A. Huletsky,1,2 R. Giroux,1 K. Boissinot,1,2 F. J. Picard,1,2 P. Lebel,3 M. J. Ferraro,4 and M. G. Bergeron1,2*

Centre de Recherche en Infectiologie de l'Université Laval, CHUQ, Pavillon CHUL,1 Division de Microbiologie, Faculté de Médecine, Université Laval, Sainte-Foy,2 Département de Microbiologie, Hôpital Général de Montréal, McGill University Health Center, Montréal, Québec, Canada,3 Department of Clinical Microbiology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts4

Received 4 May 2005/ Returned for modification 26 June 2005/ Accepted 23 July 2005


arrow
ABSTRACT
 
The presence of Enterococcus-associated vancomycin resistance genes vanA, vanB, vanD, vanE, and vanG in rectal swabs was investigated in two hospitals using PCR. All vanA genes detected were associated with vancomycin-resistant enterococci (VRE), whereas VRE-associated vanB genes were detected in only one hospital (4.7%). However, in both hospitals, high prevalences of vanB (6.2 and 2.3%), vanD (43.8 and 26.7%), and vanG (10.5 and 6.9%) genes not associated with enterococci were found.


arrow
TEXT
 
Since their first appearance in 1988, vancomycin-resistant enterococci (VRE) have emerged worldwide and have become an increasing problem in clinical settings (5). Acquired glycopeptide resistance in Enterococcus species is due to the acquisition of vanA, vanB, vanD, vanE, and vanG genes, resulting in the production of peptidoglycan precursors with reduced affinity for glycopeptide antibiotics (7). The origin of these van genes is still unknown, but recent studies have indicated that vanB resistance in enterococci might arise from gene transfer from the human bowel flora (1-3, 6). In this study, we investigated the presence of Enterococcus-associated vanA, vanB, vanD, vanE, and vanG genes in human rectal swabs.

Two rectal swabs each obtained from 162 patients at the Hôpital Général de Montréal (HGM) (Montréal, Québec, Canada) and one rectal swab each obtained from 86 patients at the Massachusetts General Hospital (MGH) (Boston, Mass.) were used to detect van-associated enterococci. One of the two swabs from each patient at HGM and each swab from MGH were suspended in 1 ml of buffer, and 50 µl of this suspension was used for DNA extraction as previously described (4). Conventional PCR amplifications were performed with crude DNA extracts prepared from each rectal swab using primer pairs specific to vanA (forward, AATAGCGCGGACGAATTGGAC; reverse, AACGCGGCACTGTTTCCCAA), vanB (forward, CTTAACGCTGCGATAGAAGC; reverse, CTGATGGATGCGGAAGATAC), vanD (forward, TTTGTAAAGCCTGCCCGTTC; reverse, CCAAGTAYCCGGTAAATCTTC), vanE (forward, AAATAATGCTCCATCAATTTGCTGA; reverse, ATAGTCGAAAAAGCCATCCACAAG), or vanG (forward, TTGGAGGCAATTCAACAGAGT; reverse, TCGCAGCCAACAACAGGTATT) genes. The PCR conditions were as previously described (4), except for the annealing temperatures, which varied from 58°C to 60°C depending on the van-specific primers used. Coamplification of a 250-bp fragment of plasmid M13pSL3 served as an internal control in all PCRs (4). Strict precautions to prevent carryover of amplified DNA and appropriate control reactions were used (4). The detection limit for each primer pair was approximately 5 genome copies per PCR.

To recover van-associated enterococcal isolates from rectal swabs, a 300-µl aliquot of the swab suspension was used to inoculate 10 ml of Enterococcosel broth (Becton Dickinson, Cockeysville, MD) containing 6 mg/liter vancomycin and 60 mg/liter aztreonam (EBVA), which was incubated aerobically for 24 h at 35°C. The other swab from each patient at HGM was placed directly into 10 ml of EBVA and incubated for 24 h at 35°C. An aliquot of each EBVA culture was plated onto both Enterococcosel agar containing 6 mg/liter vancomycin and blood agar plates that were incubated aerobically for 72 h at 35°C. Species identification and antibiotic (vancomycin and teicoplanin) susceptibility testing of all colonies resembling enterococci by phenotypic characteristics were performed using standard methods. Each enterococcal isolate recovered from a van-positive rectal swab was tested with PCR primers targeting the van gene(s) detected from that specimen.

PCR was positive for vanA for 23 out of 248 (9.3%) rectal swabs, which were all shown to contain vancomycin-resistant Enterococcus faecium (n = 22) or Enterococcus faecalis (n = 1) harboring vanA. PCR was positive for vanB for 16 out of 248 (6.5%) rectal swabs, 4 of which (1.6%) were shown to contain vancomycin-resistant E. faecium (n = 2) or E. faecalis (n = 2) harboring vanB, whereas 12 specimens (4.8%) did not contain any vanB-positive enterococci. Ninety-four out of 248 (37.9%) and 23 out of 248 (9.3%) specimens were positive for vanD and vanG, respectively, whereas no vanD- or vanG-positive enterococcal isolates were identified from these specimens (Table 1). No rectal swabs were PCR positive for vanE. Among the van-positive specimens, several contained more than one van gene: 2 specimens contained both vanA and vanB, 4 contained both vanA and vanD, 4 contained both vanD and vanG, 5 contained both vanB and vanD, 2 contained both vanB and vanG, 13 contained both vanD and vanG, 1 contained vanB, vanD, and vanG, and 1 contained vanA, vanB, vanD, and vanG. There was no significant PCR inhibition by any of the rectal swabs tested, and all control reactions to which no target DNA was added confirmed the absence of DNA carryover.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Prevalence of vancomycin resistance genes in human rectal swabs

We sequenced 13 vanD and 9 vanG PCR products from HGM as well as 15 vanD and 5 vanG PCR products from MGH. Sequence analysis of the vanD PCR products revealed that 1 was most similar (98% identity) to both vanD1 and vanD3 (GenBank accession numbers AF130997 and AF175293, respectively), 5 were most similar (98.7 to 100% identity) to vanD1, 4 were most similar (98.4 to 100% identity) to vanD3, and 18 were most similar (95.7 to 100% identity) to vanD4 (accession number AF277571). The 14 vanG PCR products exhibited variable identities ranging from 77.4 to 100% with the vanG gene of E. faecalis BM4518 (accession number AY271782).

We recently isolated and characterized a Clostridium species carrying vanB2 (3) from one of the vanB-positive rectal swabs from HGM described in the present report. This specimen was shown to contain both vanB2 and vanD1, but vanD1 was not carried by this Clostridium strain (data not shown). To isolate the bacteria harboring vanD and vanG, a 300-µl aliquot of the swab suspension from 10 vanD- and 7 vanG-positive rectal swabs from HGM was incubated anaerobically for 24 h at 35°C in brain heart infusion broth supplemented with 0.001 mg/ml vitamin K and 0.005 mg/ml hemin (eBHIB) and then incubated aerobically for 24 h in brain heart infusion broth (BHIB). A PCR signal for vanD was detected, using vanD-specific primers, in one eBHIB culture that had been incubated anaerobically, whereas no PCR signal for vanG was detected in either aerobic or anaerobic broth cultures using vanG-specific primers. The PCR signal for vanD could be maintained following sequential passaging in eBHIB containing 32 mg/liter vancomycin, 50 mg/liter aztreonam, or 1 mg/liter colistin. The PCR signal became negative in eBHIB with 8 mg/liter metronidazole, suggesting that the vanD gene was carried by an anaerobe. The eBHIB culture was subcultured onto eBHI agar containing 32 mg/liter vancomycin (eBHIA) and incubated anaerobically for 3 days. Of the several colony types that grew, only one was PCR positive for vanD. Gram staining of this colony showed the presence of both gram-positive and gram-negative cocci and bacilli with different shapes. This vanD-positive colony was subcultured onto eBHIA and blood agar, but it was not possible to isolate a pure vanD-positive bacterium. This suggests that the growth of this vanD-positive bacterium depends on a bacterial consortium. Work is in progress to identify the factor(s) required for growth and isolation of the vanD- and vanG-containing bacteria in rectal swabs.

This study reports a high prevalence of vanB-, vanD-, and vanG-like genes not associated with enterococci in human rectal swabs. An anaerobic bacterial reservoir for vanB genes in the human bowel was previously described in Australia and Québec (1-3, 6). Recent studies showed that the genetic elements carrying vanB in these anaerobes were similar to those found in enterococci (2, 3). The vanD and vanG genes have so far been found in a few clinical isolates of E. faecium and E. faecalis, respectively, and recently a new allele of vanG was described in an E. faecalis strain isolated in Canada (D. A. Boyd, S. Tyler, B. Watson, F. Jamieson, S. Brown, and M. R. Mulvey, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-948, 2004). The presence of anaerobic bacteria containing vanB and probably vanD and vanG-like genes suggests that the intestinal flora represents an important reservoir of several glycopeptide resistance genes. The recent emergence of clinical Staphylococcus aureus isolates containing vanA emphasizes the transfer potential of the van glycopeptide resistance genes in pathogenic species. Hospital infection control of VRE is presently based on the isolation of VRE carriers. The presence of human reservoirs, most likely anaerobic bacteria, carrying multiple vancomycin resistance genes may seriously threaten the control of VRE dissemination.


arrow
ACKNOWLEDGMENTS
 
This study was supported by grant PA-15586 from the Canadian Institutes of Health Research (CIHR), by grant 2201-181 from Valorisation Recherche Québec (VRQ), and by Infectio Diagnostic (I.D.I.) Inc. (Sainte-Foy, Québec, Canada). M.-C. Domingo holds a fellowship from Bayer Healthcare/CIHR/AMMI Canada/CFID.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Centre de Recherche en Infectiologie de l'Université Laval, CHUQ (Pavillon CHUL), 2705 boul. Laurier, Sainte-Foy, Québec, G1V 4G2, Canada. Phone: (418) 654-2705. Fax: (418) 654-2715. E-mail: michel.g.bergeron{at}crchul.ulaval.ca. Back


arrow
REFERENCES
 
    1
  1. Ballard, S. A., E. A. Grabsch, P. D. Johnson, and M. L. Grayson. 2005. Comparison of three PCR primer sets for identification of vanB gene carriage in feces and correlation with carriage of vancomycin-resistant enterococci: interference by vanB-containing anaerobic bacilli. Antimicrob. Agents Chemother. 49:77-81.[Abstract/Free Full Text]
  2. 2
  3. Ballard, S. A., K. K. Pertile, M. Lim, P. D. Johnson, and M. L. Grayson. 2005. Molecular characterization of vanB elements in naturally occurring gut anaerobes. Antimicrob. Agents Chemother. 49:1688-1694.[Abstract/Free Full Text]
  4. 3
  5. Domingo, M.-C., A. Huletsky, A. Bernal, R. Giroux, D. K. Boudreau, F. J. Picard, and M. G. Bergeron. 2005. Characterization of a Tn5382-like transposon containing the vanB2 gene cluster in a Clostridium strain isolated from human faeces. J. Antimicrob. Chemother. 55:466-474.[Abstract/Free Full Text]
  6. 4
  7. Ke, D., C. Ménard, F. J. Picard, M. Boissinot, M. Ouellette, P. H. Roy, and M. G. Bergeron. 2000. Development of conventional and real-time PCR assays for the rapid detection of group B streptococci. Clin. Chem. 46: 324-331.[Abstract/Free Full Text]
  8. 5
  9. Patel, R. 2003. Clinical impact of vancomycin-resistant enterococci. J. Antimicrob. Chemother. 51(Suppl. 3):13-21.[Abstract/Free Full Text]
  10. 6
  11. Stinear, T. P., D. C. Olden, P. D. Johnson, J. K. Davies, and M. L. Grayson. 2001. Enterococcal vanB resistance locus in anaerobic bacteria in human faeces. Lancet 357:855-856.[CrossRef][Medline]
  12. 7
  13. Woodford, N. 2001. Epidemiology of the genetic elements responsible for acquired glycopeptide resistance in enterococci. Microb. Drug Resist. 7: 229-236.[CrossRef][Medline]


Antimicrobial Agents and Chemotherapy, November 2005, p. 4784-4786, Vol. 49, No. 11
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.11.4784-4786.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Domingo, M.-C., Huletsky, A., Boissinot, M., Bernard, K. A., Picard, F. J., Bergeron, M. G. (2008). Ruminococcus gauvreauii sp. nov., a glycopeptide-resistant species isolated from a human faecal specimen. Int. J. Syst. Evol. Microbiol. 58: 1393-1397 [Abstract] [Full Text]  
  • Malhotra-Kumar, S., Haccuria, K., Michiels, M., Ieven, M., Poyart, C., Hryniewicz, W., Goossens, H., on behalf of the MOSAR WP2 Study Team, (2008). Current Trends in Rapid Diagnostics for Methicillin-Resistant Staphylococcus aureus and Glycopeptide-Resistant Enterococcus Species. J. Clin. Microbiol. 46: 1577-1587 [Full Text]  
  • Graham, M., Ballard, S. A., Grabsch, E. A., Johnson, P. D. R., Grayson, M. L. (2008). High Rates of Fecal Carriage of Nonenterococcal vanB in both Children and Adults. Antimicrob. Agents Chemother. 52: 1195-1197 [Abstract] [Full Text]  
  • Domingo, M.-C., Huletsky, A., Giroux, R., Picard, F. J., Bergeron, M. G. (2007). vanD and vanG-Like Gene Clusters in a Ruminococcus Species Isolated from Human Bowel Flora. Antimicrob. Agents Chemother. 51: 4111-4117 [Abstract] [Full Text]  
  • Stamper, P. D., Cai, M., Lema, C., Eskey, K., Carroll, K. C. (2007). Comparison of the BD GeneOhm VanR Assay to Culture for Identification of Vancomycin-Resistant Enterococci in Rectal and Stool Specimens. J. Clin. Microbiol. 45: 3360-3365 [Abstract] [Full Text]  
  • Young, H. L., Ballard, S. A., Roffey, P., Grayson, M. L. (2007). Direct detection of vanB2 using the Roche LightCycler vanA/B detection assay to indicate vancomycin-resistant enterococcal carriage - sensitive but not specific. J Antimicrob Chemother 59: 809-810 [Full Text]  
  • Boyd, D. A., Du, T., Hizon, R., Kaplen, B., Murphy, T., Tyler, S., Brown, S., Jamieson, F., Weiss, K., Mulvey, M. R., the Canadian Nosocomial Infection Surveillance Pro, (2006). VanG-Type Vancomycin-Resistant Enterococcus faecalis Strains Isolated in Canada.. Antimicrob. Agents Chemother. 50: 2217-2221 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Domingo, M.-C.
Right arrow Articles by Bergeron, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Domingo, M.-C.
Right arrow Articles by Bergeron, M. G.