Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gilbert, C. Articles by Boivin, G. Search for Related Content PubMed PubMed Citation Articles by Gilbert, C. Articles by Boivin, G.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, December 2005, p. 4860-4866, Vol. 49, No. 12
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.12.4860-4866.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

New Reporter Cell Line To Evaluate the Sequential Emergence of Multiple Human Cytomegalovirus Mutations during In Vitro Drug Exposure

C. Gilbert and G. Boivin^*

Research Center in Infectious Diseases of the Centre Hospitalier Universitaire de Québec and Department of Medical Biology, Université Laval, Québec, Canada

Received 22 June 2005/ Returned for modification 18 August 2005/ Accepted 13 September 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
We developed a new reporter cell line for human cytomegalovirus (HCMV) drug susceptibility testing. This cell line was obtained by incorporating the luciferase reporter gene under the control of an HCMV-specific promoter into the genome of astrocytoma cells (U373MG). We then used our reporter cell line to evaluate phenotypic changes conferred by the sequential emergence of HCMV UL54 and UL97 mutations following long-term drug exposure. The laboratory strain AD169 was passaged in the presence of increasing concentrations of ganciclovir (one viral line) or foscarnet (two viral lines). Resistant viruses were plaque purified at five different concentrations of ganciclovir and at three different concentrations of foscarnet. In addition to the previously described M460I and L595S UL97 mutations and the L545S and V812L UL54 mutations, exposition to ganciclovir (up to 3,000 µM) resulted in the selection of two unreported UL54 mutations (P829S and D879G). Passages in the presence of foscarnet (up to 3,000 µM) resulted in the selection of seven not previously described UL54 mutations (K500N, T552N, S585A, N757K, L802V, L926V, and L957F) in addition to the N408D mutation that has been associated with ganciclovir and cidofovir resistance. Long-term exposure of HCMV to either ganciclovir or foscarnet ultimately resulted in the selection of multiple UL54 mutations that conferred high levels of resistance to all approved HCMV DNA polymerase inhibitors, i.e., ganciclovir, cidofovir, and foscarnet. Emergence of each viral mutation conferred stepwise increases in drug 50% inhibitory concentrations that could be objectively measured with the new reporter cell assay.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Despite an important reduction in the number of cases of human cytomegalovirus (HCMV) diseases in human immunodeficiency virus-infected patients following the introduction of highly active antiretroviral therapy (16, 30), HCMV remains a significant pathogen in solid organ and bone marrow transplant recipients (2, 29, 32). The morbidity and mortality associated with those infections in immunocompromised patients have resulted in substantial use of anti-HCMV agents either given as prophylaxis or preemptive therapy or for treatment of established HCMV disease. At present, only a few antivirals have received approval for the systemic treatment of active HCMV infections. Ganciclovir (GCV, Cytovene) and its valyl-ester prodrug valganciclovir (Valcyte) (Hoffmann La Roche) are first-line agents, whereas cidofovir (CDV, Vistide; Gilead Sciences) and foscarnet (FOS, Foscavir; Astra-Zeneca), which are associated with more toxicity, are usually reserved for cases of GCV resistance or intolerance. Despite some differences in their mechanisms of action, all these antivirals ultimately inhibit the HCMV DNA polymerase (Pol) (11, 23, 27). Even though these antivirals appear to be effective for the initial treatment of symptomatic HCMV infections, their prolonged use in immunocompromised patients has led to the emergence of drug-resistant HCMV strains that may be associated with clinical failure (5, 9, 19, 24, 25, 34, 40).

The molecular bases for HCMV resistance to antivirals have been studied in both clinical isolates and laboratory-derived strains (17, 18). As anticipated from their mechanisms of action, molecular alterations leading to antiviral resistance to one or more of these antivirals were found in the gene encoding the viral DNA Pol. In the case of GCV, which requires phosphorylation by viral and cellular kinases, alterations within another viral gene (HCMV UL97) have also been commonly associated with drug resistance (17, 18).

The sequential emergence of multiple reverse transcriptase mutations leading to increasing levels of zidovudine resistance and cross-resistance to other antiretroviral drugs has been well studied in human immunodeficiency virus isolates (22). However, there is only a paucity of data concerning the sequential emergence of DNA Pol mutations conferring multidrug resistance (5, 9, 28, 35). Although it is generally assumed that GCV resistance first emerges as the result of UL97 mutations, followed in some cases by DNA Pol mutations (14, 19, 33), the synergistic effects of sequential mutations on various drug resistance phenotypes have not been well studied both in vivo or in vitro. Such knowledge is particularly important in transplant recipients who often receive long-term antiviral prophylaxis combined with multiple courses of treatment, which may lead to drug resistance and treatment failure (24).

To study the cumulative effects of drug resistance mutations in the HCMV UL97 and/or DNA Pol gene, we selected high-level drug-resistant mutants in the presence of either GCV or FOS. The mutants were plaque purified and characterized at different concentrations of both antivirals using a new phenotypic assay based on the expression of a reporter gene in response to HCMV replication in cells to rapidly and objectively evaluate drug resistance levels of our mutants.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cells and viruses. Human foreskin fibroblasts (HFFs) were grown in Eagle's minimal essential medium (MEM) supplemented with 10% fetal bovine serum (FBS). The astrocytoma cell line U373MG (a gift from Pierre Talbot, Institut Armand Frappier, Montreal, Canada) was grown in Dulbecco's modified Eagle medium supplemented with 10% FBS. The laboratory strain AD169 (ATCC VR-538) and the recombinant virus Xbaf 4-3-1 (37) were, respectively, used as the parental strain for induction of drug-resistant mutants and as an external GCV-resistant control.

Selection, purification, and genotyping studies of HCMV mutants. An aliquot of the viral strain AD169 was passaged in the presence of increasing concentrations of GCV (from 1.5 to 3,000 µM), whereas two separate aliquots of AD169 were passaged independently in the presence of increasing concentrations of FOS (from 20 to 3,000 µM). Viruses were grown in HFFs in 25-cm² flasks containing MEM supplemented with 2% FBS and increasing concentrations of either GCV or FOS. Drug concentrations were increased only when good viral replication was noted. At predetermined concentrations of each antiviral (five concentrations for GCV and three for FOS), viruses were plaque purified twice in the presence of drug and 0.5% agarose. At least two independent viral clones were selected from each plaque purification step. Of note, further exposure of viruses to the selected antiviral agent was performed using non-plaque-purified viruses. Viral DNA was extracted from infected cells using a rapid cell lysis protocol (4). A fragment of the UL97 gene involved in GCV resistance (codons 363 to 698) was amplified and sequenced as previously described (3). The catalytic portion of the HCMV DNA Pol gene (codons 164 to 1020) was amplified using primers Pol1152 (CGATAGGCTGCGTGAGGTC) and Pol3720 (CGAGTGAGAGGCGCGACAGG) and then sequenced with different internal primers. Sequences from UL97 and UL54 genes were aligned and compared with those of the parental strain (AD169).

Construction of a reporter cell line. The activation domain of the HCMV UL54 promoter (36), comprised of nucleotides –127 to + 24 relative to the transcription initiation site, was amplified using primers ProUL54-Up (AACCTCTTTCCCCATATGGTGTCCG) and ProUL54-Lo (TGGAAGCTTCAGACGACGGTGG). The primers were designed to incorporate unique NdeI (underlined in the ProUL54-Up sequence) and HindIII (underlined in the ProUL54-Lo sequence) restriction sites to allow directional cloning into the pNFAT-Luc (39) expression vector resulting in the insertion of a partial UL54 promoter (nucleotides –115 to + 21) upstream of the luciferase gene (pProUL54-Luc). The plasmid pProUL54-Luc (containing a neomycin resistance gene) was linearized using the restriction endonuclease ScaI and was transfected into U373MG cells in 12-well plates using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as recommended by the manufacturer. Cellular clones were then isolated by a technique adapted from viral plaque purification protocols. In brief, the day after transfection, cells were reseeded in six-well plates (1 in 15 split ratio), and the cells were then allowed to replicate for 72 h. The cell culture medium was then replaced with fresh medium containing 250 µg/ml of neomycin (Geneticin; Gibco BRL, Grand Island, NY) to select for stably transfected cells. The selection medium was replaced every 2 to 3 days until isolated cell colonies could be identified (8 to 16 days). At this point, the selection medium was removed from wells where isolated clones were identified, and a semisolid medium, consisting of MEM with 5% FBS and 0.5% agarose (final concentrations), was then added to the wells. Once the overlay medium has been allowed to jellify at room temperature for an hour, a portion of the above selected clones was aspirated, followed by trypsinization and transfer of cell colonies to a new well in 48-well plates. Cellular clones were then amplified in the presence of 100 to 200 µg/ml of neomycin until sufficient stocks could be frozen. All clones were then assessed for their Luc expression in response to HCMV replication. In brief, each clone was seeded in 6 wells of a 24-well plate, and then serial (threefold) dilutions of the laboratory strain AD169 (from 0 to 1,215 PFU/well) were added to separate wells. After 4 days of incubation, the culture medium was removed and replaced by a Luc-compatible lysis buffer (25 mM Tris, 2 mM dithiothreitol, 1% Triton X-100, 10% glycerol, pH 7.8). Photon emission was measured after the addition of luciferin to 25-µl aliquots of cell lysates. One of the clones (U373/proUL54) was selected for further analyses on the basis of low background expression levels of Luc (in the absence of virus) with a constant increase of Luc activity along with increasing virus titers.

Susceptibility testing. The U373/proUL54 reporter cell line was used to assess the susceptibility of selected strains to different antivirals (GCV, CDV, and FOS). Cell-free virus stocks were first prepared from HFFs for each of the plaque-purified mutants reported in this study. A predetermined viral inoculum (i.e., resulting in 90 to 100% cytopathic effect after 5 days of incubation) was added to confluent HFFs in 96-well plates in the presence of serial dilutions of one of the antivirals, and this was incubated for 5 to 6 days. Aliquots (100 µl) of supernatant from each well were then transferred into the corresponding well of a 96-well plate containing monolayers of U373/proUL54 cells in the absence of antivirals. After 48 h of incubation, reporter cells were lysed in 50 µl of a Luc-compatible lysis buffer. Aliquots (25 µl) of cell lysates were then transferred to a 96-well microtiter plate, luciferin was added, and light emission (expressed as relative light units [RLU]) was measured using a plate luminometer. The residual RLU (percentage of RLU corresponding to a drug concentration divided by the one obtained from wells without antiviral) was calculated for each drug concentration and was plotted against the drug concentration present in each of the wells. All experiments were performed at least twice using four replicates per drug concentration. Results were considered valid when the correlation coefficient (R²) was greater than 0.95. As a point of comparison, the susceptibility profile of selected mutant viruses was also studied using a standardized plaque reduction assay (21).

Sequence alignment. A multiple-sequence alignment of human herpesvirus polymerases was performed with PileUp (GCG Wisconsin package, version 10.3) using standard parameters. Sequences of the other seven human herpesvirus polymerases were then compared to that of HCMV with the Gap function (GCG) using proposed parameters. All sequence alignments were verified manually using a GCG SeqLab editor. Finally, the PrettyBox function (GCG) was used to generate Fig. 1.

View larger version (126K): [in this window] [in a new window]

FIG. 1. Sequence alignment of selected portions of human herpesvirus DNA polymerases. Three noncontiguous segments (A to C) of DNA polymerases are illustrated. Black and gray shading indicate identity and similarity, respectively, with the consensus sequence (not shown). Identity or similarity involving fewer than four of the eight DNA polymerases was not considered. Conserved regions of the DNA polymerases are indicated by boxes under the alignment. Mutations identified in this study are represented by capital letters over the alignment. Mutations that have been shown to confer drug resistance in HCMV (*) (7, 12, 13, 17, 28, 35, 40) and HSV () (1, 17) as well as mutations that have been associated with natural polymorphism in HCMV (|) (7, 8, 12, 15) are also noted. HCMV strain AD169 (GenBank accession number M14709), HSV-1 strain SC16 (X04771), HSV-2 strain 186 (M16321), varicella-zoster virus (VZV) strain Dumas (X04370), Epstein-Barr virus (EBV) strain B95-8 (V01555), HHV-6 strain U1102 variant A (X83413), HHV-7 strain JI (U43400), and HHV-8 (U75698) were used as representative members of the eight human herpesviruses in this alignment.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Characterization of the reporter cell line. The U373/proUL54 cell line was obtained by stable transfection of a linearized plasmid containing the Luc reporter gene under the control of an HCMV inducible promoter. To verify that the antiviral used in the susceptibility assay would not modulate by itself the expression of the reporter gene, a constant amount of the laboratory strain AD169 was added to each well of a 96-well plate containing the reporter cell line. The virus was then incubated in the presence of serial concentrations of GCV (0 to 256 µM) for 24, 48, and 72 h, and the levels of expression of the reporter gene were assessed as described in Materials and Methods. The levels of Luc expression observed were more than twice as high at 48 and 72 h as those observed at 24 h (data not shown). At all three time points, expression levels were unaltered by any concentration of GCV (0 to 256 µM) in the culture medium, indicating that GCV transferred with the virus in cell culture supernatants should not affect Luc gene expression in the susceptibility assay (see below). To verify the specificity of activation of the HCMV promoter, cell-free viruses of herpes simplex virus type 1 (HSV-1, strain KOS) and type 2 (HSV-2, strain MS2) were directly inoculated onto the reporter cell line U373/proUL54. Analyses of Luc expression showed no activation of the specific HCMV promoter by these two viruses despite the presence of full cytopathic effects (i.e., expression levels were no different than those observed in mock-infected cells).

The luciferase-expression reduction assay (LRA). First attempts to perform susceptibility testing by directly inoculating U373/proUL54 cells were unsuccessful, i.e., there were persistent levels of Luc activity even at high drug concentrations, possibly due to rapid activation of the HCMV promoter by the viral inoculum despite successful inhibition of viral replication. Using the two-step approach described in Materials and Methods, i.e., infection of HFFs followed by transfer of cell-free virus to the reporter cell line, we obtained reproducible results. The intra- and interassay coefficients of variability for the GCV-susceptible strain (AD169) were 11.2% and 13.6%, respectively, whereas they were 9.9% and 12.2% for the GCV-resistant strain selected at 50 µM GCV (50 GCV-1). A twofold change in 50% inhibitory concentrations (IC₅₀s) compared to the parental AD169 strain was considered significant (7, 12).

Characterization of mutants selected with GCV. Plaque-purified resistant HCMV viruses were successfully obtained from AD169 exposed to 10, 50, 300, 1,000, and 3,000 µM GCV (Table 1). UL97 and UL54 gene sequences revealed that the two independently plaque-purified viruses analyzed at each GCV concentration had identical genotypes. Two UL97 (M460I and L595S) and four UL54 (L545S, V812L, P829S and D879G) mutations were selected over time (Table 1). Notably, the first mutation to be selected was at codon 545 (LS) of the HCMV DNA Pol gene, and it conferred resistance to GCV and CDV. Each subsequent increase in GCV IC₅₀s was associated with the emergence of additional UL54 and UL97 mutations in plaque-purified viruses, with the final virus (3,000 GCV-1) being highly resistant to both GCV (>400-fold increase in IC₅₀) and CDV (>50-fold increase in IC₅₀). Sequential emergence of UL54 mutations (V812L, P829S, D879G) led to HCMV with low levels of FOS resistance.

View this table: [in this window] [in a new window]

TABLE 1. Genotypic and phenotypic characterization of viruses selected and plaque purified with ganciclovir

Characterization of mutants selected with FOS. In the case of FOS, two independent viral lines of AD169 were passaged in the presence of increasing concentrations of the antiviral (Table 2). Different UL54 mutations were selected in the two derived viruses, i.e., three UL54 mutations (N408D, T552N, and L957F) in one case and five (K500N, S585A, N757K, L802V, and L926V) in the other case. Viruses selected in the presence of 3,000 µM FOS were highly resistant to FOS and also, to a lesser degree, to GCV and CDV.

View this table: [in this window] [in a new window]

TABLE 2. Genotypic and phenotypic characterization of viruses selected and plaque purified with foscarnet

Alignment of herpesvirus polymerases. The alignment of conserved regions (corresponding to residues 295 to 988 of HCMV) of other human herpesviruses with that of HCMV revealed a sequence identity varying from 42.5% (53.1% sequence similarity) for HSV-1 to 50.1% (61.2% sequence similarity) for human herpesvirus 6 (HHV-6). Figure 1 indicates the location of specific HCMV UL54 mutations found in this study and the conserved amino acids among all herpesviruses.

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present study, we describe a new reporter cell line to evaluate phenotypic changes associated with the sequential emergence of UL97 and/or UL54 mutations in highly drug-resistant mutants obtained by passaging the laboratory HCMV strain AD169 in presence of either GCV or FOS.

The reporter cell line we have developed shows several interesting features. First, it is specific to HCMV replication with no expression of Luc induced by infection of the cell line with two other herpesviruses (HSV-1 and -2). Second, the expression of Luc was directly correlated with increasing amounts of HCMV, without any influence of the drug (GCV) present in the culture medium. Taken together, these features make our reporter cell line an objective susceptibility assay for HCMV. Using such an assay, we were able to discriminate between various levels of drug resistance conferred by the sequential emergence of multiple mutations in two viral genes. Also, we found a good correlation between IC₅₀ changes obtained by the LRA and the standard plaque reduction assay (Table 1). Another advantage of the reporter cell assay consists of its 96-microwell plate format allowing the use of a multichannel pipettor, which should reduce variability and allow for eventual automation.

One limitation of this assay is the requirement for considerable amounts of cell-free virus, first to inoculate the fibroblast cells and next to activate the specific HCMV promoter in the reporter cell line. Thus, the use of this assay in its current form for susceptibility testing of cell-associated clinical isolates remains limited. On the other hand, such a phenotypic test will be of great benefit for objectively determining susceptibility levels of recombinant viruses derived from AD169 as well as other laboratory reference strains (6, 7, 9, 10, 12, 26, 28, 37) and for establishing virtual drug phenotypes.

An interesting result of our study is that prolonged exposure to either GCV or FOS leads to resistance to all DNA Pol inhibitors tested, although levels of resistance were generally higher for the drug used during the selection process. Whether or not such a result should be expected in the clinical setting remains unclear. Of note, many mutations selected during this in vitro study have been observed in clinical specimens of patients failing therapy (5, 17, 35). Single DNA Pol mutations conferring resistance to all three antivirals have also been reported (7, 13, 35).

Confirmation of a drug resistance phenotype conferred by a specific mutation can only be achieved by the generation of recombinant viruses. Indeed, some mutations selected in our study may not necessarily confer drug resistance but instead may represent compensatory mutations or random polymorphism. However, the use of a homogenous parental strain (AD169) combined with the fact that an incremental increase in drug resistance was mostly associated with the emergence of one additional mutation reinforce the role of the selected mutations in the drug resistance phenotype. Finally, as illustrated in Fig. 1, most of the HCMV or HSV mutations that have been shown to confer drug resistance mainly affect highly conserved residues among herpesvirus DNA Pol, which was also the case for most of the mutations identified in our study.

In the case of mutants selected in the presence of GCV (Table 1), four of the six observed mutations (UL97 mutations M460I and L595S; UL54 mutations L545S and V812L) have been found in clinical isolates (3, 5, 10, 33) and studied by the use of marker transfer experiments (6, 10, 12, 13, 26). In general, the emergence of these mutations during in vitro selection resulted in phenotypic modifications predicted by marker transfer experiments (Table 1). One of the two unreported mutations (P829S in UL54) emerged as the single new alteration compared to the previous plaque-purified virus and seems to confer additional resistance to GCV and CDV. Moreover, as illustrated in Fig. 1, this residue appears to be strictly conserved among all human herpesviruses, which suggests a potential role of this amino acid in the enzyme function. The role of the other unknown UL54 mutation (D879G) is more problematic as it emerged at the same time as the V812L mutation known to confer resistance to all three antivirals (13) and lies in a highly polymorphic region (8, 15).

In the case of viruses selected in the presence of FOS, the two viral lines from AD169 evolved to produce completely different HCMV mutants (Table 2). In the FOS-1 viral line, the first mutation to emerge was T552N in conserved region -C. As indicated by the mutant virus susceptibility profile, this mutation may be involved in resistance to all three antivirals, with greater effects on FOS susceptibility. Interestingly, the second mutation to emerge in this viral line (N408D) has been previously studied by marker transfer experiments and was shown to affect only susceptibility to GCV and CDV (12), as also indicated by our results (Table 2). It is therefore possible, in the present case, that mutation N408D plays a role as a compensatory change to T552N. Finally, the emergence of mutation L957F in the virus purified in the presence of 3,000 µM FOS resulted in an important decrease in susceptibility to all three antivirals (Table 2). As shown in Fig. 1, mutation L957F affects an amino acid strictly conserved among herpesvirus polymerases.

The sequence of events that occurred in viral line FOS-2 is also of interest. The first two mutations that were selected, K500N and S585A, occurred in conserved region -C. One of them, S585A, is located at the 3' end of conserved region -C. Other mutations that have been studied in this part of the HCMV DNA Pol, such as D588E (12) and D588N (28, 35), were all associated with FOS resistance. The other mutation, K500N, is located at the other extremity of conserved region -C. Mutations L501I (12) and T503I (7), located at close proximity, were shown by marker transfer experiments to affect GCV and CDV susceptibilities. The next mutation to emerge in viral line FOS-2, L802V, affected a residue that has previously been studied using marker transfer experiments, although with a different substitution (L802M). The two different groups that studied mutation L802M reported a FOS resistance phenotype, whereas results regarding GCV susceptibility were discordant (9, 12). In our laboratory-derived mutants, the emergence of the L802V mutation apparently affected, albeit moderately, susceptibility to GCV and CDV with little effect on FOS resistance (Table 2). Finally, two unreported mutations, N757K and L926V, both emerged in our virus purified in the presence of 3,000 µM FOS (Table 2). The first one (N757K) is located next to residue 756, for which different substitutions (E756D/K/Q) were found to have differential effects on GCV and CDV susceptibilities, although they were all associated with FOS resistance (7, 40). Thus, it is plausible that mutation N757K also has a role in conferring FOS resistance. Whether or not the other unknown mutation (L926V) has any influence on drug susceptibility is somehow harder to predict, as it sits in a variable region of the DNA Pol of herpesviruses (Fig. 1).

In conclusion, our results, obtained using a new phenotypic assay, confirm that the emergence of UL54 mutations can occur as the initial event leading to GCV resistance, as reported in a few clinical case reports (14, 20, 28, 31, 35, 38). Thus, even though it may represent a rare event (14, 19, 33), the possible emergence of a UL54 mutation in the absence of a UL97 mutation should not be overlooked. We also demonstrated that prolonged exposure to a single antiviral can lead to sequential emergence of multiple UL54 mutations, resulting in high levels of resistance to all available HCMV DNA Pol inhibitors. Additional studies using recombinant viruses are still required to confirm the precise role of some UL54 mutations selected in our study.

 
This work was supported by a Canadian Institutes of Health Research (CIHR) grant (no. MOP-62794) to G.B.

 
* Corresponding author. Mailing address: CHUQ-CHUL, Room RC-709, 2705 Blvd. Laurier, Sainte-Foy, Québec, Canada G1V 4G2. Phone: (418) 654-2705. Fax: (418) 654-2715. E-mail: Guy.Boivin{at}crchul.ulaval.ca.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Bestman-Smith, J., and G. Boivin. 2003. Drug resistance patterns of recombinant herpes simplex virus DNA polymerase mutants generated with a set of overlapping cosmids and plasmids. J. Virol. 77:7820-7829.[Abstract/Free Full Text]
2
2. Boeckh, M., W. Leisenring, S. R. Riddell, R. A. Bowden, M.-L. Huang, D. Myerson, T. Stevens-Ayers, M. E. D. Flowers, T. Cunningham, and L. Corey. 2003. Late cytomegalovirus disease and mortality in recipients of allogeneic hematopoietic stem cell transplants: importance of viral load and T-cell immunity. Blood 101:407-414.[Abstract/Free Full Text]
3
3. Boivin, G., C. Gilbert, A. Gaudreau, I. Greenfield, R. Sudlow, and N. A. Roberts. 2001. Rate of emergence of cytomegalovirus (CMV) mutations in leukocytes of patients with acquired immunodeficiency syndrome who are receiving valganciclovir as induction and maintenance therapy for CMV retinitis. J. Infect. Dis. 184:1598-1602.[CrossRef][Medline]
4
4. Boivin, G., J. Handfield, G. Murray, E. Toma, R. Lalonde, J. G. Lazar, and M. G. Bergeron. 1997. Quantitation of cytomegalovirus (CMV) DNA in leukocytes of human immunodeficiency virus-infected subjects with and without CMV disease by using PCR and the SHARP Signal Detection System. J. Clin. Microbiol. 35:525-526.[Abstract]
5
5. Cherrington, J. M., M. D. Fuller, P. D. Lamy, R. Miner, J. P. Lalezari, S. Nuessle, and W. L. Drew. 1998. In vitro antiviral susceptibilities of isolates from cytomegalovirus retinitis patients receiving first- or second-line cidofovir therapy: relationship to clinical outcome. J. Infect. Dis. 178:1821-1825.[CrossRef][Medline]
6
6. Chou, S., A. Erice, M. C. Jordan, G. M. Vercellotti, K. R. Michels, C. L. Talarico, S. C. Stanat, and K. K. Biron. 1995. Analysis of the UL97 phosphotransferase coding sequence in clinical cytomegalovirus isolates and identification of mutations conferring ganciclovir resistance. J. Infect. Dis. 171:576-583.[Medline]
7
7. Chou, S., N. S. Lurain, K. D. Thompson, R. C. Miner, and W. L. Drew. 2003. Viral DNA polymerase mutations associated with drug resistance in human cytomegalovirus. J. Infect. Dis. 188:32-39.[CrossRef][Medline]
8
8. Chou, S., N. S. Lurain, A. Weinberg, G. Y. Cai, P. L. Sharma, and C. S. Crumpacker. 1999. Interstrain variation in the human cytomegalovirus DNA polymerase sequence and its effect on genotypic diagnosis of antiviral drug resistance. Antimicrob. Agents Chemother. 43:1500-1502.[Abstract/Free Full Text]
9
9. Chou, S., G. Marousek, S. Guentzel, S. E. Follansbee, M. E. Poscher, J. P. Lalezari, R. C. Miner, and W. L. Drew. 1997. Evolution of mutations conferring multidrug resistance during prophylaxis and therapy for cytomegalovirus disease. J. Infect. Dis. 176:786-789.[Medline]
10
10. Chou, S., R. H. Waldemer, A. E. Senters, K. S. Michels, G. W. Kemble, R. C. Miner, and W. L. Drew. 2002. Cytomegalovirus UL97 phosphotransferase mutations that affect susceptibility to ganciclovir. J. Infect. Dis. 185:162-169.[CrossRef][Medline]
11
11. Chrisp, P., and S. P. Clissold. 1991. Foscarnet. A review of its antiviral activity, pharmacokinetic properties and therapeutic use in immunocompromised patients with cytomegalovirus retinitis. Drugs 41:104-129.[Medline]
12
12. Cihlar, T., M. Fuller, and J. Cherrington. 1998. Characterization of drug resistance-associated mutations in the human cytomegalovirus DNA polymerase gene by using recombinant mutant viruses generated from overlapping DNA fragments. J. Virol. 72:5927-5936.[Abstract/Free Full Text]
13
13. Cihlar, T., M. D. Fuller, A. S. Mulato, and J. M. Cherrington. 1998. A point mutation in the human cytomegalovirus DNA polymerase gene selected in vitro by cidofovir confers a slow replication phenotype in cell culture. Virology 248:382-393.[CrossRef][Medline]
14
14. Erice, A., C. Gil-Roda, J. L. Perez, H. H. Balfour, K. J. Sannerud, M. N. Hanson, G. Boivin, and S. Chou. 1997. Antiviral susceptibilities and analysis of UL97 and DNA polymerase sequences of clinical cytomegalovirus isolates from immunocompromised patients. J. Infect. Dis. 175:1087-1092.[Medline]
15
15. Fillet, A. M., L. Auray, S. Alain, K. Gourlain, B. M. Imbert, F. Najioullah, G. Champier, S. Gouarin, J. Carquin, N. Houhou, I. Garrigue, A. Ducancelle, D. Thouvenot, and M. C. Mazeron. 2004. Natural polymorphism of cytomegalovirus DNA polymerase lies in two nonconserved regions located between domains delta-C and II and between domains III and I. Antimicrob. Agents Chemother. 48:1865-1868.[Abstract/Free Full Text]
16
16. Forrest, D. M., E. Seminari, R. S. Hogg, B. Yip, J. Raboud, L. Lawson, P. Phillips, M. T. Schechter, M. V. O'Shaughnessy, and J. S. Montaner. 1998. The incidence and spectrum of AIDS-defining illnesses in persons treated with antiretroviral drugs. Clin. Infect. Dis. 27:1379-1385.[Medline]
17
17. Gilbert, C., J. Bestman-Smith, and G. Boivin. 2002. Resistance of herpesviruses to antiviral drugs: clinical impacts and molecular mechanisms. Drug Resist. Updat. 5:88-114.[CrossRef][Medline]
18
18. Gilbert, C., and G. Boivin. 2005. Human cytomegalovirus resistance to antiviral drugs. Antimicrob. Agents Chemother. 49:873-883.[Free Full Text]
19
19. Jabs, D. A., B. K. Martin, M. S. Forman, J. P. Dunn, J. L. Davis, D. V. Weinberg, K. K. Biron, F. Baldanti, and H. Hu. 2001. Longitudinal observations on mutations conferring ganciclovir resistance in patients with acquired immunodeficiency syndrome and cytomegalovirus retinitis: The Cytomegalovirus and Viral Resistance Study Group Report Number 8. Am. J. Ophthalmol. 132:700-710.[CrossRef][Medline]
20
20. Kuo, I. C., Y. Imai, C. Shum, D. F. Martin, B. D. Kuppermann, and T. P. Margolis. 2003. Genotypic analysis of cytomegalovirus retinitis poorly responsive to intravenous ganciclovir but responsive to the ganciclovir implant. Am. J. Ophthalmol. 135:20-25.[CrossRef][Medline]
21
21. Landry, M. L., S. Stanat, K. Biron, D. Brambilla, W. Britt, J. Jokela, S. Chou, W. L. Drew, A. Erice, B. Gilliam, N. Lurain, J. Manischewitz, R. Miner, M. Nokta, P. Reichelderfer, S. Spector, A. Weinberg, B. Yen-Lieberman, and C. Crumpacker. 2000. A standardized plaque reduction assay for determination of drug susceptibilities of cytomegalovirus clinical isolates. Antimicrob. Agents Chemother. 44:688-692.[Abstract/Free Full Text]
22
22. Larder, B. 2001. Mechanisms of HIV-1 drug resistance. AIDS 15(Suppl. 5):S27-S34.
23
23. Lea, A. P., and H. M. Bryson. 1996. Cidofovir. Drugs 52:225-230.[Medline]
24
24. Limaye, A. P., L. Corey, D. M. Koelle, C. L. Davis, and M. Boeckh. 2000. Emergence of ganciclovir-resistant cytomegalovirus disease among recipients of solid-organ transplants. Lancet 356:645-649.[CrossRef][Medline]
25
25. Limaye, A. P., G. Raghu, D. M. Koelle, J. Ferrenberg, M. L. Huang, and M. Boeckh. 2002. High incidence of ganciclovir-resistant cytomegalovirus infection among lung transplant recipients receiving preemptive therapy. J. Infect. Dis. 185:20-27.[CrossRef][Medline]
26
26. Lurain, N. S., L. E. Spafford, and K. D. Thompson. 1994. Mutation in the UL97 open reading frame of human cytomegalovirus strains resistant to ganciclovir. J. Virol. 68:4427-4431.[Abstract/Free Full Text]
27
27. Matthews, T., and R. Boehme. 1988. Antiviral activity and mechanism of action of ganciclovir. Rev. Infect. Dis. 10(Suppl. 3):S490-S494.
28
28. Mousavi-Jazi, M., L. Schloss, W. L. Drew, A. Linde, R. C. Miner, J. Harmenberg, B. Wahren, and M. Brytting. 2001. Variations in the cytomegalovirus DNA polymerase and phosphotransferase genes in relation to foscarnet and ganciclovir sensitivity. J. Clin. Virol. 23:1-15.[CrossRef][Medline]
29
29. Nguyen, Q., R. Champlin, S. Giralt, K. Rolston, I. Raad, K. Jacobson, C. Ippoliti, D. Hecht, J. Tarrand, M. Luna, and E. Whimbey. 1999. Late cytomegalovirus pneumonia in adult allogeneic blood and marrow transplant recipients. Clin. Infect. Dis. 28:618-623.[Medline]
30
30. Palella, F. J., Jr., K. M. Delaney, A. C. Moorman, M. O. Loveless, J. Fuhrer, G. A. Satten, D. J. Aschman, and S. D. Holmberg. 1998. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. N. Engl. J. Med. 338:853-860.
31
31. Seo, S. K., A. Regan, T. Cihlar, D. C. Lin, F. Boulad, D. George, V. K. Prasad, T. E. Kiehn, and B. Polsky. 2001. Cytomegalovirus ventriculoencephalitis in a bone marrow transplant recipient receiving antiviral maintenance: clinical and molecular evidence of drug resistance. Clin. Infect. Dis. 33:e105-108.[CrossRef][Medline]
32
32. Sia, I. G., and R. Patel. 2000. New strategies for prevention and therapy of cytomegalovirus infection and disease in solid-organ transplant recipients. Clin. Microbiol. Rev. 13:83-121.[Abstract/Free Full Text]
33
33. Smith, I. L., J. M. Cherrington, R. E. Jiles, M. D. Fuller, W. R. Freeman, and S. A. Spector. 1997. High-level resistance of cytomegalovirus to ganciclovir is associated with alterations in both the UL97 and DNA polymerase genes. J. Infect. Dis. 176:69-77.[Medline]
34
34. Smith, I. L., I. Taskintuna, F. M. Rahhal, H. C. Powell, E. Ai, A. J. Mueller, S. A. Spector, and W. R. Freeman. 1998. Clinical failure of CMV retinitis with intravitreal cidofovir is associated with antiviral resistance. Arch. Ophthalmol. 116:178-185.[Abstract/Free Full Text]
35
35. Springer, K. L., S. Chou, S. Li, R. H. Giller, R. Quinones, J. E. Shira, and A. Weinberg. 2005. How evolution of mutations conferring drug resistance affects viral dynamics and clinical outcomes of cytomegalovirus-infected hematopoietic cell transplant recipients. J. Clin. Microbiol. 43:208-213.[Abstract/Free Full Text]
36
36. Stenberg, R. M. 1993. Immediate-early genes of human cytomegalovirus: organisation and function, p. 330-359. In E. S. Huang (ed.), Molecular aspects of human cytomegalovirus diseases. Springer-Verlag, Heidelberg, Germany.
37
37. Sullivan, V., C. L. Talarico, S. C. Stanat, M. Davis, D. M. Coen, and K. K. Biron. 1992. A protein kinase homologue controls phosphorylation of ganciclovir in human cytomegalovirus-infected cells. Nature 358:162-164.[CrossRef][Medline]
38
38. Tatarowicz, W. A., N. S. Lurain, and K. D. Thompson. 1992. A ganciclovir-resistant clinical isolate of human cytomegalovirus exhibiting cross-resistance to other DNA polymerase inhibitors. J. Infect. Dis. 166:904-907.[Medline]
39
39. Timmerman, L. A., N. A. Clipstone, S. N. Ho, J. P. Northrop, and G. R. Crabtree. 1996. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383:837-840.[CrossRef][Medline]
40
40. Weinberg, A., D. A. Jabs, S. Chou, B. K. Martin, N. S. Lurain, M. S. Forman, and C. Crumpacker. 2003. Mutations conferring foscarnet resistance in a cohort of patients with acquired immunodeficiency syndrome and cytomegalovirus retinitis. J. Infect. Dis. 187:777-784.[CrossRef][Medline]

---

Antimicrobial Agents and Chemotherapy, December 2005, p. 4860-4866, Vol. 49, No. 12
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.12.4860-4866.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Chevillotte, M., Schubert, A., Mertens, T., von Einem, J. (2009). Fluorescence-Based Assay for Phenotypic Characterization of Human Cytomegalovirus Polymerase Mutations Regarding Drug Susceptibility and Viral Replicative Fitness. Antimicrob. Agents Chemother. 53: 3752-3761 [Abstract] [Full Text]  
• Fukui, Y., Shindoh, K., Yamamoto, Y., Koyano, S., Kosugi, I., Yamaguchi, T., Kurane, I., Inoue, N. (2008). Establishment of a Cell-Based Assay for Screening of Compounds Inhibiting Very Early Events in the Cytomegalovirus Replication Cycle and Characterization of a Compound Identified Using the Assay. Antimicrob. Agents Chemother. 52: 2420-2427 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gilbert, C. Articles by Boivin, G. Search for Related Content PubMed PubMed Citation Articles by Gilbert, C. Articles by Boivin, G.