AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, L. A.
Right arrow Articles by White, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, L. A.
Right arrow Articles by White, P. A.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, February 2005, p. 794-797, Vol. 49, No. 2
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.2.794-797.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The aadB Gene Cassette Is Associated with blaSHV Genes in Klebsiella Species Producing Extended-Spectrum ß-Lactamases

Louisa A. Jones,1,2 Christopher J. McIver,1,2,3 Mi-Jurng Kim,2 William D. Rawlinson,1,2,3 and Peter A. White1,2*

School of Biotechnology and Biomolecular Sciences, Faculty of Science,2 School of Medical Sciences, Faculty of Medicine, the University of New South Wales,3 Virology Division, Department of Microbiology, SEALS, Prince of Wales Hospital, Randwick, Sydney, New South Wales, Australia1

Received 30 March 2004/ Returned for modification 26 June 2004/ Accepted 25 October 2004


    ABSTRACT
 Top
 Abstract
 Text
 References
 
Integrons were detected in 37 (72.5%) of 51 Klebsiella spp. producing extended-spectrum beta-lactamases by PCR with primers that targeted integrase genes and cassette regions. PCR and amplicon sequencing of the cassette regions revealed aadB and aadA2 gene cassettes that confer resistance to a range of aminoglycosides. aadB was associated with a class 1 integron on a 28-kb plasmid, pES1, that also contained blaSHV-12 and IS26.


    TEXT
 Top
 Abstract
 Text
 References
 
Multiple-antibiotic-resistant Klebsiella spp. are important nosocomial pathogens (6, 18) and commonly express extended-spectrum ß-lactamase (ESBL) enzymes belonging to the SHV family, encoded by blaSHV genes (7, 8, 15, 19). In a previous study, we noted that a number of ESBL-producing Klebsiella spp. in Sydney, Australia, were resistant to gentamicin by virtue of an aadB gene cassette (conferring resistance to gentamicin, tobramycin, and kanamycin) contained within a class 1 integron (25). Recently, integrons have been recognized as significant contributors to the acquisition of antibiotic resistance in gram-negative bacteria (5, 9, 11, 25). In the present study, we explored the association of blaSHV genes and integrons in a collection of 51 ESBL-producing clinical isolates collected over a 10-year period in Sydney, Australia. Genetic linkage between integron-borne gentamicin resistance genes and blaSHV genes was investigated.

Bacterial strains and antibiotic susceptibility testing. ESBL-producing Klebsiella spp. comprising 45 K. pneumoniae and 6 K. oxytoca from 20 different wards in three hospitals in Sydney, Australia, were collected from 1989 to 1999. Susceptibility to antimicrobial agents was determined by using the calibrated dichotomous sensitivity method (1), available at http://www.med.unsw.edu.au/pathology-cds/, to a panel of 20 antibiotics in seven different classes (Table 1). The diversity of the isolates was calculated by using Simpson's index with antibiotic profiles. The probability of selecting two strains with different profiles was 95.4%. All 51 isolates were resistant to ampicillin, cephalexin, and cefotaxime; 47.1% of bacteria were resistant to amikacin and trimethoprim, while 84.3% were resistant to kanamycin, 82.4% were resistant to tobramycin, and 72.5% were resistant to gentamicin (Table 1). All isolates tested were susceptible to cefotetan and imipenem. Multiresistant ESBL-producing bacteria, particularly those that are resistant to aminoglycosides, have been reported with increasing frequency (6, 7, 14, 22). From a therapeutic perspective, the varied scope of antibiotic resistance displayed by the isolates of this study highlights the difficulties faced by those treating infections with these bacteria.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Resistance determinants and phenotypes of 51 ESBL-producing Klebsiella spp.a

 
Integron screening. To determine if resistance in the Klebsiella collection was conferred by integrons, DNA was extracted and screened by PCR as previously described with primers that anneal to conserved regions of integron-encoded integrase genes intI1, intI2, and intI3 (25) (Fig. 1). Integron cassette regions were amplified with primers that target the conserved flanking regions (24) (Fig. 1). Thirty-seven of 51 ESBL-producing strains (72.5%) contained one or more class 1 integrons as determined by an analysis of integrase PCR amplicons by restriction fragment length polymorphism with HinfI (Promega) and RsaI (Promega) (25). Class 2 and 3 integrons were not detected among these strains. Gene cassettes within integron cassette regions were characterized by restriction fragment length polymorphism and sequencing (24, 25). Of the 37 integron-positive strains, 20 contained two integrons and 16 contained one integron (Table 1). The cassette region from the remaining integron-positive strain could not be amplified (Table 1). Each cassette region amplified contained a single gene cassette. Three types of gene cassettes were found (Table 1), the most common being aadB (conferring resistance to gentamicin, tobramycin, and kanamycin) (4). This cassette was found in 33 (89.1%) of 37 bacteria containing integrons (Table 1). The presence of aadB correlated with phenotypic resistance to gentamicin, tobramycin, and kanamycin in all 33 strains with this gene cassette. Interestingly, 20 strains with aadB (54.0% of integron-positive bacteria) also contained a second integron with aadA2 (conferring resistance to streptomycin and spectinomycin) (3). The integron with aadA2 correlated with streptomycin resistance in all strains containing this gene cassette (Table 1). Three strains contained a single integron with an aadA1 cassette (also conferring resistance to streptomycin and spectinomycin) (21) (Table 1). No further gene cassettes were identified, a finding which implied that resistances not accounted for by integron-borne gene cassettes were encoded by non-integron-associated resistance genes.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. Structure of two drug-resistant regions of pES1 isolated from Klebsiella oxytoca INS23K. Binding sites for primers used to screen the collection of 51 ESBL-producing Klebsiella spp. for integrase genes (primer pair hep35-hep36), class 1 cassette regions (primer pair hep58-hep59), IS26 (primer pair hep121-hep122), and blaSHV (primer pair A-B) are shown. The dashed line indicates the regions sequenced in this study; the lengths of those regions are shown. (A) The 5'-CS, aadB cassette, and 3'-CS were amplified by PCR with a combination of primers, and the products were sequenced. Analysis of the assembled 2,366-bp sequence revealed a class 1 integron with its associated intI1 gene (open box) and attI1 site (hatched box). The resistance genes identified, aadB (conferring resistance to gentamicin, tobramycin, and kanamycin), qacE{Delta}1, and sul1, are shown as thick black lines, and the aadB-associated 59-base element is shown as a filled box. The 2,366-bp nucleotide sequence differs by two nucleotides from the sequence of pDGO100 that contains integron In7 (GenBank accession number L06418; position 203 to 2,568). (B) The blaSHV-12 gene was amplified with primers A and B and sequenced. Sau3A fragments from pES1 were cloned into pUC18. pVRL98 was selected with cefotaxime and contained a 6-kb fragment of pES1. Approximately 1,400 bp of the 6-kb fragment were sequenced to revealed IS26 and the downstream blaSHV-12. IR indicates the position of the 14-bp terminal inverted repeats of IS26. The sequence matches that found in GenBank (accession number X84314; position 629 to 2,382), with the exception of a single point mutation that accounts for the difference between the SHV2a and SHV-12 enzymes at amino acid residue 240.

 
Detection of blaSHV by PCR. The blaSHV gene is commonly associated with ESBL activity in Klebsiella spp. (7, 8, 19); hence, isolates were screened by PCR for blaSHV genes with primers A (5' CACTCAAGGATGTATTGTG 3') and B (5' TTAGCGTTGCCAGTGCTCG 3') (14), which amplify a 883-bp product (Fig. 1). Fifty of 51 strains (98%) were PCR positive (Table 1), demonstrating the widespread prevalence of blaSHV genes in Klebsiella spp. in Australia.

Horizontal transfer of the aadB gene cassette. The high incidence of the aadB gene cassette suggested that a common resistance element, which could also harbor a blaSHV gene, may be prevalent in the collection. To determine whether the integron carrying aadB was located on a transferable plasmid, transconjugation assays were performed on two strains, K. oxytoca INS22K and K. oxytoca INS23K, chosen on the basis of susceptibility to nalidixic acid. Conjugal transfer of kanamycin resistance was observed at average frequencies of between 3.8 x 10–7 and 6.1 x 10–6 transconjugants/donor. Antibiotic susceptibility testing of the transconjugants revealed phenotypic resistance to cephalexin, cefotaxime, ticarcillin-clavulanate potassium (Timentin), ampicillin, gentamicin, kanamycin, tobramycin, sulfonamide, trimethoprim, and nalidixic acid. Donor strains were additionally resistant to tetracycline, norfloxacin, chloramphenicol, and nitrofurantoin, indicating that the majority of the resistance genes were trans- ferred.

Plasmid extractions of the transconjugants isolated a plasmid (designated pES1) approximately 28 kb in size, while plasmid extractions of both donor strain INS22K and donor strain INS23K revealed the presence of pES1 and an additional plasmid (designated pES2) of approximately 4 kb in size (data not shown).

Resistance genes identified for pES1. PCR screening of pES1 extracted from transconjugants revealed a class 1 integron with an aadB gene cassette. The presence of both a 3' conserved segment (3'-CS) and a 5'-CS was confirmed by PCR amplification and sequencing (Fig. 1). Sulfonamide resistance was conferred by the presence of a sulfonamide resistance gene, sul1, found within the 3'-CS (20). The aadB gene cassette accounts for the gentamicin, kanamycin, and tobramycin resistance profile of the transconjugants. Transconjugants displayed ESBL activity by the characteristic "keyhole" interaction, in the form of a keyhole between cefotaxime and amoxicillin-clavulanate potassium (Augmentin), which was demonstrable by a disk diffusion susceptibility test (1). Transconjugants were screened by PCR for blaSHV genes as described above (14), and the products were sequenced. Sequencing revealed that pES1 harbored blaSHV-12. The presence of this gene accounts for the resistance to cephalexin, ampicillin, and cefotaxime seen in the transconjugants. Thus, a class 1 integron carrying aadB, sul1, and a blaSHV-12 gene was identified on pES1, and these genes together account for its multiple-resistance phenotype. Future research will focus on mapping the distance between aadB and blaSHV-12 and sequencing the intervening region. Our findings could help explain the recently reported nosocomial outbreak of multiresistant K. pneumoniae in The Netherlands (7), where 25 of 30 ESBL-producing bacteria (83.3%) were shown to carry blaSHV-5 and aadB. Consistent with our findings, eight strains also harbored aadA2 (7). The present study provides a possible explanation for the joint presence of aadB and blaSHV, colocated on a single transmissible plasmid in Klebsiella spp. The genetic determinant mediating trimethoprim resistance for pES1 was not identified.

blaSHV genes on transmissible plasmids are associated with integrons and IS26 elements. To isolate resistance genes carried on pES1, Sau3A fragments were cloned into pUC18 and transformants were selected on Luria-Bertani agar containing ampicillin (50 µg/ml) and subsequently selected on Luria-Bertani agar-cefotaxime (0.5 µg/ml) plates. This procedure led to the isolation of a plasmid, pVRL98, containing a fragment approximately 6 kb in size. Sequencing revealed a blaSHV-12 gene and an upstream insertion sequence, IS26 (Fig. 1). BLAST searches revealed that the fragment displayed identity to several plasmids from diverse locations worldwide (12, 13, 15, 17, 23). These plasmids all contain genes that encode for either SHV-2a or SHV-5 and that differ from SHV-12 (identified on pES1) by only one amino acid each, and all plasmids contain IS26. Moreover, class 1 integrons encoding aminoglycoside resistance have been reported for two of these plasmids (17, 23). The fact that IS26 is commonly found upstream of SHV-encoding genes suggests that it is involved in the creation of antibiotic resistance islands by promoting the integration of resistance genes (2, 8, 10).

Prevalence of IS26 and blaSHV in the ESBL-producing Klebsiella spp. Primers hep121 (5' AGCGGTAAATCGTGGAGTGA 3') and hep122 (5' TTGTCGCTTCTTTACTCGCC 3') were designed for a region 35 bp upstream of the blaSHV-12 gene and for a portion of the IS26 tnpA gene to determine the prevalence of this sequence in the collection of Klebsiella spp. (Fig. 1). PCR screening resulted in the amplification of a positive 250-bp product in 44 of 51 strains (86.2%). It is worthy to note that the seven IS26-negative strains were among the oldest in the collection, mostly dating from before 1991, and none harbored an integron. All 20 strains that harbored both aadA2 and aadB gene cassettes and all 13 strains with a single aadB cassette had a blaSHV gene with its associated upstream IS26 (Table 1), suggesting that these strains are likely to harbor a plasmid with features similar to those of pES1.

Conclusion. We and others (7) have demonstrated the close association of the aadB gene cassette with blaSHV genes in ESBL-producing Klebsiella, and in the present study, we show that both resistance genes are located on a single 28-kb conjugative plasmid. Our findings and those of others (12, 15-17, 23) also demonstrate that an IS26 insertion element upstream of a blaSHV gene is commonly associated with conjugative plasmids in ESBL-producing organisms. Klebsiella pneumoniae strains carrying IS26 upstream of blaSHV-12 or blaSHV-2a have also been recently reported in Korea (8). Taken together, these findings suggest that the multiresistant phenotype of ESBL-producing Klebsiella spp. is likely to be mediated by a conjugative plasmid that contains an integron, IS26, and either blaSHV-2a, blaSHV-5, or blaSHV-12. The potential of the integron-encoded site-specific recombination system to capture new cassettes means that continued selection of pES1-like plasmids is likely. Further studies concerning the evolution and dissemination of these plasmids are therefore warranted.


    ACKNOWLEDGMENTS
 
We thank Sydney Bell, Porl Reinbott, Jeannette Pham and Barrie Gatus, Antibiotic Reference Laboratory, Department of Microbiology (SEALS), Prince of Wales Hospital, for the provision of strains used in this study.


    FOOTNOTES
 
* Corresponding author. Mailing address: School of Biotechnology and Biomolecular Sciences, Faculty of Science, University of New South Wales, Sydney 2052, Australia. Phone: 61 9385 3780. Fax: 61 9385 1591. E-mail: p.white{at}unsw.edu.au. Back


    REFERENCES
 Top
 Abstract
 Text
 References
 

  1. Bell, S. M., B. J. Gatus, and J. N. Pham. 1999. Antibiotic susceptibility testing by the CDS method. A concise laboratory manual. The Antibiotic Reference Laboratory, South Eastern Area Laboratory Services, Arthur Productions, Sydney, New South Wales, Australia.
  2. Berg, D. E., and M. M. Howe (ed.). 1989. Mobile DNA. American Society for Microbiology, Washington, D.C.
  3. Bito, A., and M. Susani. 1994. Revised analysis of aadA2 gene of plasmid pSa. Antimicrob. Agents Chemother. 38:1172-1175.[Abstract/Free Full Text]
  4. Cameron, F. H., D. J. Groot Obbink, V. P. Ackerman, and R. M. Hall. 1986. Nucleotide sequence of the AAD(2") aminoglycoside adenylyltransferase determinant aadB. Evolutionary relationship of this region with those surrounding aadA in R538-1 and dhfrII in R388. Nucleic Acids Res. 14:8625-8635.
  5. Chang, C., L. Chang, Y. Chang, T. Lee, and S. Chang. 2000. Characterisation of drug gene cassettes asssociated with class 1 integrons in clinical isolates of Escherichia coli from Taiwan, ROC. J. Med. Microbiol. 49:1097-1102.[Abstract/Free Full Text]
  6. Correia, M., F. Boavida, F. Grosso, M. J. Salgado, L. M. Lito, J. M. Cristino, S. Mendo, and A. Duarte. 2003. Molecular characterization of a new class 3 integron in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 47:2838-2843.[Abstract/Free Full Text]
  7. Gruteke, P., W. Goessens, J. van Gils, P. Peerbooms, N. Lemmens-den Toom, M. van Santen-Verheuvel, A. van Belkum, and H. Verbrugh. 2003. Patterns of resistance associated with integrons, the extended-spectrum ß-lactamase SHV-5 gene, and a multidrug efflux pump of Klebsiella pneumoniae causing a nosocomial outbreak. J. Clin. Microbiol. 41:1161-1166.[Abstract/Free Full Text]
  8. Kim, J., H. S. Shin, S. Y. Soel, and D. T. Cho. 2002. Relationship between blaSHV-12 and blaSHV-2a in Korea. J. Antimicrob. Chemother. 49:261-267.[Abstract/Free Full Text]
  9. Lee, J. C., J. Y. Oh, J. W. Cho, J. C. Park, J. M. Kim, S. Y. Seol, and D. T. Cho. 2001. The prevalence of trimethoprim-resistance-conferring dihydrofolate reductase genes in urinary isolates of Escherichia coli in Korea. J. Antimicrob. Chemother. 47:599-604.[Abstract/Free Full Text]
  10. Mahillon, J., and M. Chandler. 1998. Insertion sequences. Microbiol. Mol. Biol. Rev. 62:725-774.[Abstract/Free Full Text]
  11. Martinez-Freijo, P., A. C. Fluit, F. J. Schmitz, V. S. C. Grek, J. Verhoef, and M. E. Jones. 1998. Class 1 integrons in Gram-negative isolates from different European hospitals and association with decreased susceptibility to multiple antibiotic compounds. J. Antimicrob. Chemother. 42:689-696.[Abstract/Free Full Text]
  12. Naas, T., L. Philippon, L. Poirel, E. Ronco, and P. Nordmann. 1999. An SHV-derived extended-spectrum ß-lactamase in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 43:1281-1284.[Abstract/Free Full Text]
  13. Neusch-Inderbinen, M., H. Hachler, and F. H. Kayser. 1996. New system based on site-directed mutagenesis for highly accurate comparison of resistance levels conferred by SHV ß-lactamases. Antimicrob. Agents Chemother. 39:1726-1730.
  14. Pitout, J. D. D., K. S. Thompson, N. Hanson, A. F. Ehrhardt, P. Coudron, and C. C. Sanders. 1998. Plasmid-mediated resistance to expanded spectrum cephalosporins among Enterobacter aerogenes strains. Antimicrob. Agents Chemother. 42:596-600.[Abstract/Free Full Text]
  15. Podbielski, A., J. Schonling, B. Melzer, K. Warnatz, and H. G. Leusch. 1991. Molecular characterisation of a new plasmid-encoded SHV-type ß-lactamase (SHV-2 variant) conferring high-level cefotaxime resistance upon Klebsiella pneumoniae. J. Gen. Microbiol. 137:569-578.[Medline]
  16. Preston, K. E., M. A. Kacica, R. J. Limberger, W. A. Archinal, and R. A. Venezia. 1997. The resistance and integrase genes of pACM1, a conjugative multiple-resistance plasmid, from Klebsiella oxytoca. Plasmid 37:105-118.[CrossRef][Medline]
  17. Preston, K. E., C. C. A. Radomski, and R. A. Venezia. 1999. The cassettes and 3' conserved segment of an integron from Klebsiella oxytoca plasmid pACM1. Plasmid 42:104-114.[CrossRef][Medline]
  18. Prodinger, W. M., M. Fille, A. Bauernfeind, I. Stemplinger, S. Amann, B. Pfausler, Lass-Florl, and M. P. Dierich. 1996. Molecular epidemiology of Klebsiella pneumoniae producing SHV-5 ß-lactamase: parallel outbreaks due to multiple plasmid transfer. J. Clin. Microbiol. 34:564-568.[Abstract]
  19. Spanu, T., F. Luzzaro, M. Perilli, G. Amicosante, A. Toniolo, G. Fadda, and T. I. E. Group. 2002. Occurrence of extended-spectrum ß-lactamases in members of the family Enterobacteriaceae in Italy: implications for resistance to ß-lactams and other antimicrobial drugs. Antimicrob. Agents Chemother. 46:196-202.[Abstract/Free Full Text]
  20. Stokes, H. W., and R. M. Hall. 1989. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol. Microbiol. 3:1669-1683.[Medline]
  21. Sundstrom, L., P. Radstrom, G. Swedberg, and O. Skold. 1988. Site-specific recombination promotes linkage between trimethoprim and sulfonamide resistance genes. Sequence characterization of dhfrV and sulI and a recombination active locus of Tn21. Mol. Gen. Genet. 213:191-201.[CrossRef][Medline]
  22. van Belkum, A., W. Goessens, C. van der Schee, N. Lemmens-den Toom, M. C. Vos, J. Cornelissen, E. Lugtenburg, S. de Marie, H. Verbrugh, B. Lowenberg, and H. Endtz. 2001. Rapid emergence of ciprofloxacin-resistant Enterobacteriaceae containing multiple gentamicin resistance-associated integrons in the Netherlands. Emerg. Infect. Dis. 7:862-871.[Medline]
  23. Villa, L., C. Pezzella, F. Tosini, P. Visca, A. Petrucca, and A. Carattoli. 2000. Multiple-antibiotic resistance mediated by structurally related IncL/M plasmids carrying an extended-spectrum ß-lactamase gene and a class 1 integron. Antimicrob. Agents Chemother. 44:2911-2914.[Abstract/Free Full Text]
  24. White, P. A., C. J. McIver, Y. M. Deng, and W. D. Rawlinson. 2000. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 182:265-269.[CrossRef][Medline]
  25. White, P. A., C. J. McIver, and W. D. Rawlinson. 2001. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob. Agents Chemother. 45:2658-2661.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, February 2005, p. 794-797, Vol. 49, No. 2
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.2.794-797.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, L. A.
Right arrow Articles by White, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, L. A.
Right arrow Articles by White, P. A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS