Mechanism of Action of a Novel Series of Naphthyridine-Type Ribosome Inhibitors: Enhancement of tRNA Footprinting at the Decoding Site of 16S rRNA

The novel ribosome inhibitors (NRIs) are a broad-spectrum naphthyridineclass that selectively inhibits bacterial protein synthesis(P. J. Dandliker et al., Antimicrob. Agents Chemother. 47:3831-3839,2003). Footprinting experiments, using a range of NRIs and chemicalmodification agents on Escherichia coli ribosomes, revealedno evidence for direct protection of rRNA. In the presence oftRNA, however, we found that NRIs enhanced the known ribosomalfootprinting pattern of tRNA in a dose-dependent manner. Themost prominent increase in protection, at A1492/3 and A1413in helix-44 of 16S RNA, strictly required the presence of tRNAand poly(U), and the effect was correlated with the potencyof the inhibitor. Radioligand binding studies with inhibitor[³H]A-424902 showed that the compound binds to tRNA, eitherin its charged or uncharged form. The dissociation constantfor [³H]A-424902 binding to Phe-tRNA^Phe was determined to be1.8 µM, near its translation inhibition potency of 1.6µM in a cell-free S. pneumoniae extract assay. The compounddid not change the binding of radiolabeled tRNA to the 30S ribosomalsubunit. Taken together, these results imply that the NRIs exerttheir effects on protein synthesis by structurally perturbingthe tRNA/30S complex at the decoding site.

INTRODUCTION

Top

Introduction

Ribosomes are macromolecular protein-biosynthetic machineryagainst which many effective antibacterial agents act. The ribosomeis a proven antibacterial target (10, 37). Inhibitors that bindthe large (50S) ribosomal subunit include macrolides, lincosamides,streptogramins, chloramphenicol, oxazolidinones. These antibioticsusually target the central loop in domain V of 23S rRNA, affectingone or more steps in transpeptidation, translocation, peptidebond formation, or peptide elongation. The 30S inhibitors mainlyinclude aminoglycosides and tetracyclines that inhibit or alterthe translation step in protein synthesis by interfering withthe decoding process. The high-resolution X-ray crystal structuresof ribosomal subunits and their complexes with many ribosomeinhibitors have been determined recently, providing remarkableinsights into the details of drug-rRNA interactions (2, 3, 18,25, 33-35). Recently, we discovered a class of novel ribosomeinhibitors (NRIs) that exhibit broad-spectrum antibacterialactivity and the ability to inhibit the growth of importantpathogens such as Streptococcus pneumoniae, Haemophilus influenzae,Staphylococcus aureus, and Moraxella catarrhalis that are knownto be important in respiratory infections (4, 5). Analysis ofNRI-resistant mutants (5) indicated that a single mutation inthe ribosome is sufficient to confer resistance. This observationis consistent with the notion that the NRIs act by binding tothe ribosome, but a precise binding site of these inhibitorshas not yet been identified. Because NRI-resistant strains arenot resistant to known ribosome inhibitors such as macrolides,chloramphenicol, tetracycline, aminoglycosides, or oxazolidinones,we believe the NRI series interacts with the ribosome in a uniqueway, possibly at a unique site. In order to better understandthe NRI mechanism of action and potentially identify a ribosomebinding site, we undertook chemical footprinting studies, monitoredby primer extension, a powerful tool in mapping the drug interactionsites on ribosomes (11, 13, 14, 17, 19, 22). In the presentstudy, we show that the NRIs affect the tRNA interaction with16S rRNA at the decoding region that includes A1492/3 and A1408,A1413 in helix 44. These results imply that the NRIs affectthe tRNA interaction with the small ribosomal subunit at thedecoding site.

MATERIALS AND METHODS

Top

Materials and Methods

Materials. All uncharged tRNAs, dimethyl sulfate, and antibiotics werepurchased from Sigma Chemical Co. (St. Louis, MO), except forlinezolid, fusidic acid, and [³H]A-424902 (specific activity,9.78 Ci/mmol), which were synthesized at Abbott. Preparationsof tRNA^Phe and the charged Phe-tRNA were also obtained fromFrancisco Javier Triana-Alonso, (Centro de Investigaciones Biomedicas,Universidad de Carabobo Nucleo Aragua, Aragua, Venezuela). Avianmyeloblastosis virus reverse transcriptase was from Roche MolecularBiochemicals (Indianapolis, IN). ddNTP and dNTP were purchasedfrom Invitrogen, Inc. [ ${gamma}$ -³³P]ATP was obtained from Perkin-ElmerLife Sciences, Inc. (Boston, MA). The 70S ribosome was isolatedfrom Escherichia coli MRE600 cells using published procedures(1), except that a bead-beater method (26) with 0.1-mm silicabeads (Biospec Products, Inc., Bartlesville, OK) was used forbreaking the bacterial cells. The ribosomal 30S subunit waspurified from crude 70S ribosomes by sucrose-gradient centrifugation(32). The 30S ribosomal subunit was activated by heating inmodification buffer at 42°C for 20 min immediately beforethe experiment.

DMS footprinting. Methods of chemically probing the tRNA binding site on 16S rRNAwere based on the procedures described by Noller and coworkers(17, 31) with minor modifications. The sequence of the oligonucleotideprimer used for probing theA1408 to A1494 region in 16S rRNAwas: GAGGTGATCCAACCGCAGGTTCC (nucleotide [nt] 1516 to 1538).The primer was end labeled with [ ${gamma}$ -³³P]ATP by using polynucleotideT4 kinase (Invitrogen, Calsbad, CA), and the labeled productwas purified by gel-filtration by using a Micro-Select-D G-25kit (VWR Scientific Products, Bristol, CT). Chemical modificationof ribosome subunits with dimethyl sulfate (DMS) was carriedout in microcentrifuge tubes with 50-µl reaction mixturecontaining 50 pmol of ribosomal subunit and various concentrationsof test compound in modification buffer (80 mM sodium cocadylate[pH 7.2], 25 mM MgCl₂, 100 mM ammonium chloride). After 20 minincubation at 37°C, the mixture was treated with 2 µlof DMS (12.5% in ethanol) with 10 min of incubation at 37°C.The modification reaction was terminated by adding 25 µlof stop solution (1 M Tris-acetate [pH 7]; 1.5 M sodium acetate,1 M ß-mercaptoethanol and 0.1 M EDTA). The mixturewas cooled on ice for 10 min, and the oligonucleotides wereprecipitated by adding 180 µl of cold 95% ethanol. Theprecipitates were kept at –20°C for at least 30 minbefore being collected by 15 min of centrifugation at 4°C,and the samples were resuspended in 100 µl of Tris-EDTAbuffer. rRNA was isolated by using RNeasy Minikits (Qiagen,Inc., Valencia, CA), and the nucleotide concentration was determinedspectrophotometrically. The samples were diluted with waterto a final nucleotide concentration of 1 µg/µl priorto the primer extension reaction.

Primer extension. The rRNA modification sites were analyzed by primer extensionanalysis with avian myeloblastosis virus reverse transcriptase(Roche Molecular Biochemicals, Indianapolis, IN). Hybridizationreactions were carried out in 96-well PCR plates containingrRNA (3 µg) and 3 pmol ³³P-end-labeled primer in a finalvolume of 8 µl in hybridization buffer (50 mM HEPES [pH7.2] and 100 mM KCl) by using a PCR thermocycler (Perkin-Elmermodel 9600 GeneAmp PCR System), with an initial incubation at94°C for 2 min and then a linear ramp of the temperatureto 42°C in 30 min, followed by incubation at 42°C untilused. Primer extension was carried out in the same plate byadding 8 µl of a prewarmed solution of reverse transcriptase(8 U per well) and deoxynucleoside triphosphate (250 µMeach) in a buffer containing 130 mM Tris-HCl (pH 8.5), 10 mMMgCl₂, and 10 mM dithiothreitol, followed by incubation for30 min at 40°C. At the end of the incubation, 210 µlof stop solution (0.3 M sodium acetate [pH 5.5] in 74% ethanol)was added, and the mixture (enough for two repeats of the subsequentexperiments) was separated into two sets of microcentrifugetubes and stored at –80°C. Multichannel pipettes wereused for all of the liquid handling to increase throughput andto assure uniform reaction times. For electrophoretic determinationof the cDNA primer extension products, one set of the mixtureswas removed from the freezer and centrifuged for at least 45min at maximum speed. The supernatants were aspirated, and theprecipitates were dried for 5 min in a bench-top vacuum microcentrifuge.The dried products were dissolved in 10 µl of loadingbuffer (80% deionized formamide, 10 mM EDTA, 1 mg of xylenecyanol/ml, and 1 mg of bromophenol blue/ml). The samples (1µl per lane) were loaded onto Bio-Rad 6% polyacrylamidesequencing gels and electrophoresed for ca. 2 h until the bluetracking dye reached the bottom end of the gel. The gel, afterbeing blotted and dried on filter paper, was scanned on a PhosphorImager(Storm 860; Molecular Dynamics, Amersham Biosciences, Piscataway,NJ), and the cDNA bands were analyzed by using ImageQuant software.The band intensity at sites of our interests was quantitativelydetermined by using a densitometric analysis software (ScionImage for Windows; Scion Corp., Frederick, Maryland).

S. pneumoniae translation inhibition assay. The detailed procedures for the luciferase-readout translationassay using S. pneumoniae S30 extract have been described previously(5, 20).

Binding assays. The binding of radiolabeled NRIs to tRNA was performed by equilibriumdialysis using Dispo Dialyzer devices (Harvard Biosciences)that have a volume capacity of 50 µl on each side of a10-kDa cutoff membrane. An aliquot (50 µl) of bindingmixture consisting of 0.1 µM radiolabeled [³H]A-424902in binding buffer (20 mM HEPES [pH 7.6], 4.5 mM magnesium acetate,150 mM potassium acetate, 2 mM spermidine, 4 mM ß-mercaptoethanol)was placed on one side of the membrane. On the opposite sideof the membrane, it was placed with 10 µM Phe-tRNA inthe same volume of binding buffer. The dialysis was carriedout for 24 h at 4°C. For binding experiments at higher ligandconcentrations, unlabeled A-424902 was added to raise the totalligand concentrations up to 150 µM. Then, 25-µlaliquots were removed from each side of the membrane, and theamount of bound ligand was determined as the difference in radioactivitybetween the two sides. Free ligand concentrations were determinedfrom the radioactivity at the ligand side. All datum pointswere generated in duplicate. The binding data were presentedin a Klotz Plot (8) in which the molar binding ratio was plottedagainst the free ligand concentration (27, 30). The resultingbinding isotherm can be fitted with the Hill equation by usingSigmaPlot software (SPSS, Inc., Chicago, IL).

The binding of radiolabeled tRNA with 30S ribosomal subunitswas measured by using nitrocellulose filters as previously described(9). Deacylated tRNA^Phe was labeled by using T4 polynucleotidekinase and [ ${gamma}$ -³³P]ATP. Binding mixtures (in a final volume of50 µl) consisted of 1 µM activated 30S subunit,30 nM radiolabeled tRNA, cold tRNA (when higher total tRNA concentrationswere needed), 20 µg of poly(U), and various concentrationsof A-424902 (from 10 to 100 µM) in modification buffer.After 20 min of incubation at 37°C, the mixtures were dilutedto 1 ml with modification buffer, filtered through a nitrocellulosefilter (Millipore Co.), and washed twice with the 2 ml of thesame buffer. Filters were dried for 30 min under a heat lamp,and the retained radioactivity was determined by scintillationcounting.

RESULTS AND DISCUSSION

Top

Results and Discussion

NRIs alter the tRNA footprint on 16S rRNA. We carried out extensive chemical footprinting efforts on theentire E. coli 70S ribosome in an attempt to map the NRI interactionsites. Such efforts turned out to be fruitless since no footprintingsite was found on either subunit. Our preliminary finding thatthe drug bound to tRNA (see later section and Fig. 5) promptedus to examine the tRNA footprinting pattern on ribosomal subunitsin the presence of the inhibitor. We probed the known tRNA protectionsites against chemical footprinting on the entire 50S (15) and30S (16) ribosomal subunits. It was seen that the NRI compoundspromoted a tRNA protection effect and resulted in weaker footprintingbands, and this increase in protection was particularly evidentat sites on 16S rRNA. These included sites at A532, A790, A792,A794/5, A1408, A1411, and A1492/3 in 16S rRNA. To further investigatethe drug effects, we focused on probing the most prominent 16Ssites at A1408, A1411, and A1492/3 that consist of the A-sitedecoding region (Fig. 1), which has been shown to be the majortarget sites of many antibiotics (6, 7, 12, 14, 21, 23, 33-36).The drug effect on the increased tRNA protection at these adenosinesites can be studied conveniently by DMS probing alone. DMSmethylates adenine at N-1, guanine at N-7, and cytosine at N-3,but only the adenine and cytosine methylatons inhibit the progressof reverse transcriptase (31). Since the extent of the chemicalmodification was very limited, only those highly reactive adenineand cytosine were modified resulting in visible gel bands thatare radiolabeled cDNA molecules terminated at this particularmodified nucleotide. The intensity of the band is proportionalto the reactivity of the base. When the band intensity decreasesin the presence of a binding ligand, it can normally be interpretedas the ligand-interaction sites due to protection through directbinding or indirect allosteric effects. Also shown in thesegel autoradiograms (Fig. 2 to 4) are intense bands across allof the lanes; these are strong termination stops due to secondarystructures of the RNA template (31). Figure 2A shows the autoradiographdemonstrating the effect of A-424902, one of the most activeNRI analogs (see structure and potency values in Table 1), onthese tRNA protection sites. The results of densitometric analysisof band intensity at the sites of our interests are shown inFig. 2B (for the A1413 site) and Fig. 2C (for the A1492/3 sites).The increased tRNA protection effect, i.e., a sharper decreasein band intensities as a function of tRNA concentration in thepresence of the drug is obvious, and the effect is more distinctwith a subeffective level of poly(U) (0.4 µg/µl)at which the tRNA effect in the absence of the drug has notreached the maximum. At a higher poly(U) concentration (0.8µg/µl), the stronger tRNA protection effect evidentlymasks the drug effect. The dependence on tRNA concentrationcan be clearly seen in the presence of the drug: with a marginaleffect at 1 µM and a strong effect at >2 µM tRNA.It was interesting to see that the decrease in band intensityat A1492/3 paralleled that at A1413, located 5 nt away fromthe asymmetric internal loop below the lower stem (Fig. 1).It should be noted that such parallelism can only be observedfrom results with the use of tRNA (Table 2).

View larger version (17K):
[in this window]
[in a new window]
FIG. 5. Binding of [³H]A-424902 to Phe-tRNA as determined by equilibrium dialysis. Binding mixtures contained 500 pmol of Phe-tRNA on one side of the membrane and known amounts of the drug on both sides. The radiolabeled drug concentration was kept constant at 100 nM, and the concentration of unlabeled A-424902 was varied. The binding isotherm was fitted by using the simple Hill equation shown.

View larger version (25K):
[in this window]
[in a new window]
FIG. 1. Secondary structure of the A-site decoding region in 16S rRNA. The information shown here was obtained from references 7, 21, and 24.

View larger version (67K):
[in this window]
[in a new window]
FIG. 2. (A) Autoradiograph showing A-424902 induced alterations in the DMS reactivity of A1492/3 and A1413 in helix-44 of 16S rRNA in the presence of various amounts of tRNA and poly(U). E. coli 30S ribosomal subunits (50 pmol) were incubated with 50 µM drug for 20 min in a volume of 50 µl prior to DMS treatment as described in Materials and Methods. U, G, C, and A denote dideoxynucleotide sequencing lanes; K denotes unmodified rRNA. Positions with altered reactivity are indicated by arrows. Reverse transcriptase stops 1 nt ahead of the corresponding nucleotide in the sequencing lanes; therefore, a band in the modified RNA footprinting gel corresponds to the band one position up in the sequencing lanes. (B and C) Band intensities at the A1413 site and the A1492/3 sites were determined by densitometric analysis. The band intensity, expressed as the percentage of the intensity relative to that without tRNA, is plotted against tRNA concentrations. The results were obtained with (filled symbols) or without (open symbols) the compound A-424902, with poly(U) concentrations at 0 µg/µl (circles), 0.4 µg/µl (triangles), and 0.8 µg/µl (squares).

View larger version (92K):
[in this window]
[in a new window]
FIG. 4. Comparison of the effect of NRI, streptomycin, and paromomycin at low concentrations on DMS modification in the presence or absence of tRNA. The concentrations of tRNA^phe and poly(U), when present, were 7 µM and 0.4 µg/µl, respectively. Paromo, paromomycin; Strep, streptomycin; 505, A-362505; 816, A-358816. Other abbreviations are as defined in the legend to Fig. 2.

View this table:
[in this window]
[in a new window]
TABLE 1. Chemical structure and activities of naphthyridine-type ribosome inhibitors

View this table:
[in this window]
[in a new window]
TABLE 2. Effect of ribosome-targeted antibiotics and NRIs on tRNA protection at the decoding site in 16S rRNA

Figure 3 shows the increased tRNA protection induced by otherNRI compounds (see structure and translation inhibition potencyin Table 1). The data for tetracycline and streptomycin arealso included for comparison. The effect at A1492/3 and A1413is dose dependent and shows clearly an increased protectionat 10 µM for the more potent compounds A-424902, A-358816,and A-362505, whereas A-548501, an inactive compound (Table1), shows no protection effect. The only exception is A-438301,which is active in our bacterial translation assay (IC₅₀ = 9.2µM) but shows no effect on tRNA footprinting. Notably,A-438301 also behaves differently from the other NRIs in thatit does not compete with radiolabeled A-424902 for binding tothe Phe-tRNA^Phe (Table 1), indicating a different binding orinhibition mode. Consistent with the conclusion that the increasedprotection effect requires poly(U), no effect was observed whenpoly(U) was replaced by poly(A). Also shown in Fig. 3, tetracycline,a 30S subunit inhibitor that was shown to bind to helix-34 didnot show such increased protection effect up to 100 µM,whereas streptomycin, a helix-44 binder, showed a strong effectat 10 µM. The observation that the increased protectioneffect correlated with the inhibitory potency of the compoundsrenders an important piece of evidence that NRIs capabilityto alter the tRNA interaction with 16S rRNA at the decodingsite may be relevant to its mode of action.

View larger version (101K):
[in this window]
[in a new window]
FIG. 3. Effect of NRIs, tetracycline (Tet), and streptomycin (Strep) on DMS modification of bases in the decoding region of 16S rRNA and its dependence on tRNA and poly(U). "+" or "-" denote the presence or absence of tRNA^phe (6 µM) in the reaction mixture, respectively. The poly(A) and poly(U) concentrations were 0.4 µg/µl.

A comparison of the increased protection effects of NRIs withparomomycin and streptomycin at lower concentrations is shownin Fig. 4. In the presence of tRNA and poly(U) (see the lefthalf of Fig. 4), we saw increased protection at A1492/3 with1 µM paromomycin and streptomycin, with 4 µM A-358816,and with 10 µM A-362505. We also probed the same regionof rRNA to look for direct effects of the test compounds inthe absence of tRNA/poly(U). Figure 4 (right portion) illustratesthat the NRIs did not show such direct effects at any of thesesites. In contrast, streptomycin (1 µM) and paromomycin(4 µM) showed a distinct direct protection effect at A1413.Paromomycin (4 µM) also affected A1408 in the absenceof tRNA. In the absence of tRNA, none of the compounds had anyeffect at A1492/3.

In order to learn whether the pattern of increased protectioninduced by compounds in the NRI series was common to any otherribosomal inhibitors, we performed the same set of experimentswith a range of antibacterials. The results are summarized inTable 2. Of these inhibitors, none of the 50S binders, as expected,induced any change in the protection pattern in the 30S decodingregion either in the presence or absence of tRNA. Among the30S subunit inhibitors, results obtained in the presence oftRNA and poly(U) can be divided into three groups: (i) apramycin,gentamicin, kanamycin, neomycin, and paromomycin, which increasetRNA protection at all three sites (A1408, A1413, and A1492/3);(ii) streptomycin and hygromycin B, which do not affect tRNAprotection at A1408 but increase protection at both A1413 andA1492/3; and (iii) kasugamycin, spectinomycin, tetracycline,and puromycin, none of which bind to helix-44, which show noeffect at any of these sites. In the absence of tRNA and poly(U),inhibitors from groups i and ii have variable effects on theA-1413 and A1408 sites, but none of them has any effect at theA1492/3 sites. The group iii inhibitors again have no effectat any of these sites. Upon examining the patterns of increasedprotection by these drugs in Table 2, we found that the NRIsshare behavior with some of these other inhibitors but thatthe NRI patterns are distinct, a finding consistent with a differentmode of interaction. These data suggest that the NRIs most likelyinteract with the 30S ribosomal subunit but do so in a way thatis not identical to the other ribosome inhibitors shown in Table2. We caution that while these data may suggest that the NRIsinteract with helix 44, they are insufficient to definitivelymake this conclusion. In order to identify the NRI binding site,additional studies will be required.

Radioligand binding studies. The radioligand binding method is a powerful tool in investigatingsmall ligand interactions with macromolecules, exemplified bythe quinolone antibacterial binding to DNA and DNA gyrase (27-30).We synthesized here [³H]A-424902 to investigate NRI bindingto components in the bacterial translation machinery. We observedbinding of this labeled compound to both ribosomal subunits,but whether such bindings were specific or nonspecific remainsto be established (L. L. Shen, unpublished results). In thecourse of our studies, we also made the unexpected observationthat [³H]A-424902 interacted with tRNA in both its charged anduncharged forms and bound preferentially to tRNA^Phe (data notshown). We thus used Phe-tRNA^Phe as our model receptor to studythe drug binding in detail. Figure 5 shows the binding of [³H]A-424902to Phe-tRNA in the drug concentration range from 0.1 to 150µM. The binding isotherm is presented as a Klotz Plot(8) of molar binding ratio versus free drug concentration. Theisotherm can be fitted by using the Hill equation with noncooperativebinding (Hill constant = 1) and a dissociation constant equalto 1.8 µM. The molar binding ratio reaches a plateau atca. 1 NRI/tRNA at high drug concentrations (there is no furtherlarge increase in the molar binding ratio at between 10 and100 µM A-424902). In these experiments, the labeled drugconcentration was kept constant as the unlabeled A-424902 concentrationwas varied. The increased scatter in datum points at the higherligand concentrations was due to the low counts per minute bound(resulting from high dilution of radiolabeled A-424902 by coldA-424902). It is intriguing that the K_d value (1.8 µM)measured here for A-424902 is similar to the translation inhibitionIC₅₀ value (1.6 µM) for the inhibitor (Table 1). Thisprovided another piece of evidence indicating that the drugbinding to tRNA may be relevant to the inhibitory mechanism.Quinolone antibacterials have been shown to bind to nucleicacids, especially to single-stranded forms, as their mechanismof action (27, 30); it is therefore not surprising to see thatthe NRIs bind to tRNA, a nucleic acid species rich in single-strandedregions. Whether magnesium ions play a role in drug bindingthrough a chelating effect remains unclear. Since footprintingand translation assay require the divalent ion for the validityof the experiments, a test of the magnesium effect experimentallyis less likely. Besides, it is unclear whether the binding totRNA is directly or indirectly responsible for the inhibitionof ribosome function. Also, it needs to be confirmed that theexistence of a single drug binding site on tRNA truly reflectsthe binding mode in the tRNA-ribosome-mRNA complex. These questions,as well as the drug binding preference to tRNA^Phe, require furtherinvestigations.

We have also investigated the effect of A-424902 on the bindingof radiolabeled tRNA^Phe to 30S ribosomal subunits by using anitrocellulose filter-binding technique (9) under the same reactionconditions for footprinting. The results showed that A-424902did not affect quantitatively the binding of tRNA to 30S underthese experimental conditions.

The present study demonstrates that members of the NRI seriesinteract directly with tRNA and can alter the chemical footprintof tRNA on the ribosome. Although the footprinting behaviorfor the NRIs is similar to that of other 30S ribosome inhibitors,we note that no other drug classes behave in exactly the sameway. These findings are consistent with the notion that theNRIs are mechanistically distinct. Based upon our findings,it seems reasonable to conclude that the NRIs affect the tRNAfootprinting pattern at the decoding site on the 30S ribosomalsubunit without affecting the overall binding free energy betweentRNA and the ribosome.

FOOTNOTES

* Corresponding author. Mailing address: Abbott Laboratories, Department R47R, Bldg. AP10, 100 Abbott Park Rd., Abbott Park, IL 60064-6099. Phone: (847) 937-5983. Fax: (847) 938-1674. E-mail: linus.l.shen{at}abbott.com.

REFERENCES

Top