Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, May 2005, p. 1915-1926, Vol. 49, No. 5
0066-4804/05/$08.00+0 doi:10.1128/AAC.49.5.1915-1926.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Novozymes, Inc., 1445 Drew Ave., Davis, California 95616
Received 6 April 2004/ Returned for modification 11 July 2004/ Accepted 29 December 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In the present study, we used DNA microarray analysis to determine the global gene expression pattern of Bacillus subtilis in response to subinhibitory concentrations of protein synthesis inhibitors: chloramphenicol, erythromycin, and gentamicin. Chloramphenicol is known to block peptidyl transferase activity by hindering the binding of tRNA to the A site (24, 32). Erythromycin, a macrolide, is believed to block the tunnel that channels the nascent peptides away from the peptidyl transferase center, thereby preventing movement and release of the nascent peptide (32). Gentamicin is an aminoglycoside that binds to a conserved sequence of rRNA that is near the site of codon-anticodon recognition in the aminoacyl-tRNA site (A site) of the 30S ribosomal subunit. This interaction in turn interferes with proofreading steps that ensure translational fidelity (9, 44). Both chloramphenicol and erythromycin target the 50S ribosomal subunit and inhibit translation elongation, whereas gentamicin targets the 30S ribosomal subunit and affects translational accuracy. We would like to generate transcriptional profiles of cells treated with protein synthesis inhibitors or other classes of antibiotics to create a library of signature responses for the determination of modes of action of new antimicrobial compounds. Microbial transcriptional or translational profiles after treatment with antibiotics or drugs have been determined recently, and statistical or mathematical tools can be applied to predict modes of actions of different compounds (3, 6, 17). Genes highly induced or repressed by protein synthesis inhibitors can potentially be used as signature genes to identify new drugs that inhibit translation. B. subtilis is an ideal microorganism for microarray analysis because its genome has been sequenced (20). Gene expression responses to higher concentrations of inhibitors have been shown to cause a broader effect on cellular processes, thereby giving much more complex response patterns (14, 34). We applied subinhibitory concentrations (concentrations that cause little growth inhibition) of protein synthesis inhibitors with the goal of observing antibiotic-specific primary expression profiles and that growth-inhibition-related secondary responses would be underrepresented. Multiple concentrations of inhibitors were applied so that dose-specific effects could be examined. Furthermore, a time course of 5 to 60 min was applied so that the kinetics of the transcription response over time could be studied. Several common major functional classes of genes were affected by the protein synthesis inhibitors used. These classes include transport/binding proteins and lipoproteins, metabolism of carbohydrates and related molecules, and protein synthesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial growth conditions. Standard broth microdilution assays were performed to determine the MICs of B. subtilis against chloramphenicol, erythromycin, or gentamicin (27). Overnight cultures of B. subtilis 1A757 were diluted 1:100 in Mueller-Hinton medium and incubated at 37°C with shaking at 200 rpm. When cultures reached an optical density at 600 nm (OD600) of 0.2, chloramphenicol at 0.05x (0.2 µg/ml), 0.25x (1 µg/ml), or 0.4x (1.6 µg/ml) MIC; erythromycin at 0.1x (0.0125 µg/ml), 0.25x (0.03125 µg/ml), or 0.5x (0.0625 µg/ml) MIC; or gentamicin at 0.1x (0.0125 µg/ml), 0.25x (0.03125 µg/ml), or 0.4x (0.05 µg/ml) MIC was added to the cultures. Untreated cultures were used as controls. Samples were collected at 5, 15, 30, and 60 min after treatment for subsequent RNA isolation. The samples were processed immediately by centrifugation, and pellets were stored at 80°C. Growth and viability were monitored for at least 2.5 h posttreatment by measuring both the OD600 and CFU at several time points.
RNA isolation, probe preparation, and hybridization for DNA microarrays. RNA samples were extracted independently from two experiments, and isolation was performed with the FastRNA Blue Kit (Qbiogene, Carlsbad, CA) according to the manufacturer's instructions. Fluorescent probes were prepared by reverse transcription (RT) of 25 µg of total RNA to incorporate aminoallyl-dUTP into first strand cDNA. The amino-cDNA was then labeled by direct coupling to either Cy3 (cDNA from untreated sample) or Cy5 (cDNA from antibiotic-treated sample) monofunctional reactive dyes (Amersham Biosciences, Piscataway, NJ). DNA microarrays consisting of PCR-amplified B. subtilis 168 open reading frames (ORFs) or ORF-specific oligonucleotides (60-mers) at a 10 µM concentration in 3x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate; Compugen, Jamesburg, NJ) were also used as described previously (4, 5). All labeled cDNA probes were hybridized to oligonucleotide slides with the exception of one chloramphenicol-treated experiment that was hybridized to slides spotted with PCR products. Hybridizations were performed as previously described (4, 5). The corresponding cDNA samples for treatment and control were mixed and hybridized to the microarray slides in replicates of a total of six genomes. The slide images were scanned and edited by using an Axon 4000B scanner (Axon Instruments, Union City, CA).
DNA microarray data analysis and clustering analysis. The fluorescent signal ratios (Cy5/Cy3) were subjected to Lowess normalization with background correction in the GeneSpring software (Silicon Genetics, Redwood City, CA). The normalized data was then analyzed by a statistical technique, significance analysis for microarrays (SAM), to identify significantly up- or downregulated genes with the exclusion of invariant genes (39). SAM assigns a score to each gene on the basis of its change in expression relative to the standard deviation of repeated measurements for that gene. A "q value" assigned to each gene corresponds to the lowest false discovery rate at which the gene is called significant. The "one class response" was used, and the number of falsely significant genes was set to be less than one in SAM. The differentially expressed genes identified by SAM were further filtered to identify genes whose ratios of expression in treated versus untreated control were more than 1.5 or less than 0.67, indicating at least a 1.5-fold change of expression. Clustering analysis was performed by using best k-means provided in GeneSpring (reviewed in reference 36). We used the "best k-means" script in GeneSpring to determine the optimal number of the clusters for each analysis. The data used for clustering analysis was from treatment with each of the three concentrations of antibiotics over the time series (5, 15, 30, and 60 min). Genes used for clustering had to meet the following requirements: (i) genes had to be determined by SAM to be significantly variant; (ii) gene expression levels has to be above or below the cutoff range (1.5-fold); and (iii) the amount of up- or downregulation had to be consistent in two independent experiments and at least one condition. Expression ratios used for clustering analysis were average fluorescence intensity ratios from two independent experiments, each consisting of data from six microarray replicates (a total of 12 datum points per gene).
Real-time RT-PCR. Real-time RT-PCR was performed on an ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA) with the SYBR Green detection method (Applied Biosystems, Foster City, CA). Primers used for RT-PCR were as follows: rplF, TCCTGAAGAAGGCATCGAAATC and CGCGGATGTTAGCAGCAATAG; rbsB, CGGCTCAGGATTCCATAACATC and GCAGCAGGTTTTCCATGACAGT; groES, GGTGATCGCGTTGTCATTGA and TGCCACGATTTTGCCTTCTT; clpP, TGGCGATCTATGATACCATGCA and AGCGCATAGCGTTTGCCTT; cspB, TTCTCTGCTATTCAAGGCGAAG and AACGTTAGCAGCTTGTGGTCC; cspD, AGTTGAAGGCGGAGACGATGT and GGTCCACGATTACCTTCGACAA; yecA, CTTGTTTTTGGCAGCGTCTTG and GCGATGCAATTTCTCCATTCTC; and yvaN, CCAAACCTGCCACCATCAA and CCTGGCTTCATGCACTTCTTC.
The RT-PCRs contained serial dilutions of RNA templates, 500 nM concentrations of each pair of primers, 1x SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), and 0.24 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA)/µl.Reverse transcription was performed at 50°C for 30 min, followed by inactivation of reverse transcriptase and activation of AmpliTaq DNA polymerase at 95°C for 15 min. For each dilution triplicate reactions were prepared. Forty thermocycles were performed as follows: 94°C for 15 s, 55°C for 30 s, and 72°C for 30 s. The RNA samples were also subjected to RT-PCR amplification with the yecA or yvaN primers. The amount of PCR product at each cycle was recorded by measuring fluorescence generated by binding of the SYBR dye to double-stranded DNA. The amplification plot generated with untreated (time zero) samples was used as the reference curve to standardize amplification results generated from the untreated and antibiotic-treated samples. The results were then normalized to the data generated from the yecA or yvaN amplification for chloramphenicol and erythromycin or gentamicin-treated samples, respectively.
| RESULTS |
|---|
|
|
|---|
Microarray experimental design and data analysis. B. subtilis cultures were treated with subinhibitory concentrations of chloramphenicol, erythromycin, or gentamicin. Untreated cultures were used as control. Total RNA was extracted from each culture 5, 15, 30, and 60 min after treatment. Subinhibitory concentrations of inhibitors were used to avoid secondary responses caused by high concentrations of antibiotics. Multiple concentrations of antibiotics were tested to study dose-dependent effects. Furthermore, a time course of 5 to 60 min was applied so that the kinetics of the transcription response to time could be determined. RNA samples were used to prepare cDNA for subsequent Cy dye labeling and hybridization to microarrays. The control (no treatment) samples were labeled with Cy3, and treated samples were labeled with Cy5. The corresponding samples for each time point and treatment were mixed and hybridized to multiple microarray slides equivalent to at least six genomes.
The fluorescence intensity values, calculated by dividing the Cy5 signal by the Cy3 signal, were quantified, normalized, and assessed by SAM software to identify genes whose expression was significantly altered by treatment with antibiotics. The false discovery rate at which the gene is called significant was less than 0.5% for genes accepted to be significant with a few exceptions. The genes determined by SAM to be significant were then filtered to identify genes whose Cy5/Cy3 ratios were more than 1.5 or less than 0.67 (indicating more than a 1.5-fold change of expression).
Overview of transcriptional profiles of chloramphenicol-, erythromycin-, or gentamicin-treated B. subtilis cells. Treatment of B. subtilis with chloramphenicol, erythromycin, or gentamicin revealed a total of 856, 1,233, or 462 genes, respectively, up- or downregulated by at least 1.5-fold in two independent experiments and in at least one condition. Approximately 20% of the differentially expressed genes encode proteins with similarity to those with unknown functions in other organisms, whereas ca. 10% encode proteins with no homologs. Analysis of genes with known functions revealed that all three antibiotics primarily affected the transcription of genes from the following three categories: transport/binding protein genes, genes involved in protein synthesis, and genes involved in metabolism of carbohydrates and related molecules (Fig. 1). In addition, for all three antibiotics the frequencies of occurrence of genes in other functional categories whose expression was affected were similar. We also found subtle differences in abundance of genes in the major categories for chloramphenicol and erythromycin versus gentamicin. For example, there was a larger percentage of genes involved in transport/binding proteins and metabolism of amino acids for chloramphenicol- or erythromycin-treated cultures than for gentamicin-treated cultures. In contrast, larger percentages of genes involved in protein synthesis and metabolism of carbohydrates were affected by gentamicin than by chloramphenicol or erythromycin.
|
|
|
|
Expression of genes involved in purine and pyrimidine synthesis was altered upon treatment with either chloramphenicol or erythromycin. Genes involved in purine and pyrimidine synthesis were upregulated at 15 min upon treatment with chloramphenicol, whereas expression was downregulated at 60 min with erythromycin treatment at all concentrations. Expression levels of representative genes involved in purine and pyrimidine biosynthesis are listed in Table 1. We found that many genes involved in purine/pyrimidine biosynthesis were regulated similarly to protein synthesis genes when treated with 0.4x MIC of chloramphenicol (Table 1). The coregulation of genes involved in purine/pyrimidine biosynthesis and those in protein synthesis was also observed in B. subtilis cultures treated with 0.5x MIC of cephalothin (M. Maranta and D. S. Yaver, unpublished data).
Heat shock genes were upregulated by gentamicin, especially at later time points, in all three concentrations. Notably, a dose-dependent regulatory effect was observed for the expression of clpP at 60 min (Tables 1 and 2). Furthermore, an upregulation in the expression of heat shock genes was also observed due to treatment with streptomycin (another aminoglycoside, data not shown). In contrast, expression of heat shock genes was repressed by treatment with chloramphenicol (Tables 1 and 2), with maximum repression observed after 15 min due to treatment with 0.25x or 0.4x MIC. Heat shock genes appeared to be sparingly affected by treatment with erythromycin (data not shown). Finally, the expression of ykuC, which is similar to macrolide efflux protein, was induced by erythromycin at 15 min in a dose-dependent manner (Fig. 2, bottom panel).
Genes most highly induced with chloramphenicol, erythromycin, or gentamicin treatment. We analyzed genes that were highly induced due to antibiotic treatment at any concentration or time point. Genes highly induced by erythromycin included dctP, dppB, rpsF, ycnB, yonS, ysbA, ysbB, ytiP, and yvsH. These genes were usually upregulated at 15 or 60 min, with dctP most highly induced. Genes highly induced by chloramphenicol included gapB, mcpB, rbsB, yheH, yheI, yrzI, ysbA, and ysbB. Expression of these genes was upregulated after 15 min with treatment at various concentrations. Interestingly, yheI and yheH form an operon and encode ABC transporter-like proteins with similarity to multidrug efflux proteins (29). Genes highly induced by gentamicin include clpP, ysbA, ysbB, and yxiE. These genes were highly expressed at 60 min posttreatment. Expression of ysbA and ysbB were consistently highly induced by all three antibiotics tested and are located in an operon. They are currently annotated in the SubtiList website (http://genolist.pasteur.fr/SubtiList/) as unknown proteins or similar to proteins of unknown functions. We performed a homology search by using the blastp program and determined that ysbAB gene products are homologous to the lrgAB gene products in Staphylococcus aureus (15). The amino acid sequences of ysbA- and ysbB-encoding proteins are 44 and 57% identical to the LrgA and LrgB proteins, respectively, from S. aureus. The LrgAB proteins inhibit extracellular murein hydrolase activity (the enzymes that cleave structural components of the bacterial cell wall) as well as convey penicillin tolerance in S. aureus (15).
Genes with similar expression patterns with yheH or ysbAB were further analyzed by best k-means clustering analysis. The genes that clustered with yheH or ysbAB, and their relative expression levels are listed in Table 3. The yheH gene was highly induced after 15 min with chloramphenicol treatment at all concentrations tested. The ysbA and ysbB gene were induced after 30 min of treatment with any concentration of chloramphenicol or erythromycin. Finally, gentamicin treatment resulted in an induction of ysbA and ysbB at 60 min. The yheI gene was expressed similarly with yheH, which is in the same operon, at all chloramphenicol concentrations tested. The dctP gene, encoding a C4-dicarboxylate transport protein, displayed an expression profile similar to yheH with 0.4x MIC chloramphenicol treatment. Interestingly, the dctP gene also exhibited expression patterns similar to those for ysbA and ysbB when treated with higher concentrations (0.25x and 0.4x/0.5x) of chloramphenicol, erythromycin, or gentamicin. The ysbA and ysbB genes were also regulated similarly to yheH upon treatment with 0.4x MIC of chloramphenicol. In all erythromycin and gentamicin experiments, ysbA and ysbB had expression profiles similar to those of yolF and yxiE, respectively. The function of yolF is unknown, whereas yxiE is known to be induced by phosphate starvation (1). Homology searches with yolF and yxiE failed to reveal any similarity to known proteins (data not shown).
|
Expression of the lmrAB operon was induced at 15 min by at least twofold due to treatment with gentamicin or erythromycin at all concentrations. The lmrA gene encodes a negative regulator that autogenously represses the transcription of the operon, and the lmrB gene product is a drug efflux pump (19, 25, 43). The expression of the lmrAB operon was reduced after 15 min in erythromycin or gentamicin-treated cultures, probably due to repression by LmrA. Expression of lmrA and lmrB appeared to be unaffected by chloramphenicol treatment.
| DISCUSSION |
|---|
|
|
|---|
Intriguingly, the same three functional classes of genes that were affected by the protein synthesis inhibitors were also affected by antibiotics inhibiting cell wall, RNA, or DNA synthesis (M. Maranta, C. Amolo, H. Ge, and D. S. Yaver, unpublished data). This presents the possibility that altered transcriptional expression of genes in these categories is a universal response to general stress caused by treatment with antibiotics. However, expression profiles were distinct among the antibiotics with different mechanisms of action, indicating that specific transcriptional responses resulted from different antibiotic treatments.
The stringent response is a process that enhances survival during starvation stress and coincides with the rapid accumulation of guanosine 3'-5'-bispyrophosphate (ppGpp). The hallmark of the stringent response is the negative regulation of components of the translational apparatus including rRNAs, tRNAs, ribosomal proteins, and translation factors (10, 13). Several studies have shown that while transcriptional and translational inhibitors cause decreased synthesis of the stringent factor ppGpp in Escherichia coli, some aminoglycosides such as neomycin, streptomycin, or spectinomycin had little effect on the level of ppGpp (21, 26). A similar effect was observed in Haemophilus influenzae when transcriptional and proteomic analyses were performed in the presence of transcriptional and translational inhibitors (12). The authors of that study found that ribosomal protein synthesis rates were increased by treatment with most protein synthesis inhibitors. However, aminoglycoside such as streptomycin had little effect. These researchers further demonstrated that the transcriptional and translational responses to translational inhibitors were coordinately mediated by the synthesis of ppGpp. Proteomic studies in B. subtilis also showed that inhibitors of translation elongation (such as tetracycline, chloramphenicol, and erythromycin) induced the rate of synthesis of the stringently controlled ribosomal proteins and elongation factors, whereas aminoglycosides (such as gentamicin, kanamycin, and streptomycin), which interfere with ribosomal translation accuracy, did not (3). Consistently, we found that expression of ribosomal protein and elongation factor genes was induced by chloramphenicol and erythromycin, whereas genes coding for elongation factors were not affected by gentamicin. However, our results showed that gentamicin can trigger transcriptional induction of genes encoding ribosomal proteins even 5 min posttreatment (Table 1). A real-time RT-PCR experiment validated that one of the ribosomal protein genes, rplF, was indeed induced at the early time point (Table 2). Many ribosomal protein genes showed dynamic gene regulation after treatment with gentamicin (i.e., up at 5 min, down at 15 min, up at 30 min, and then down at 60 min) (Tables 1 and 2). This discrepancy could be due to our use of subinhibitory concentrations of antibiotic (versus the higher dosages used in the other studies) or to other differences in experimental conditions.
Other functional categories affected by both chloramphenicol and erythromycin included genes involved in metabolism of amino acids (Table 1). The similar expression profiles between genes encoding ribosomal proteins and genes involved in purine/pyrimidine biosynthesis due to treatment with chloramphenicol could be due to coregulation (i.e., repression of the stringent response). Genes involved in purine/pyrimidine biosynthesis were shown to be repressed under conditions that provoke stringent response, but regulation was relA independent (13).
Previous studies in E. coli showed that the H group antibiotics (such as aminoglycosides) induce heat shock response, whereas the C group antibiotics (such as erythromycin and chloramphenicol) induce cold shock and repress heat shock genes (7, 41). A recent study also confirmed that the heat shock response was triggered by treatment with kanamycin (33). A proteomic study in B. subtilis confirmed that aminoglycosides induced expression of heat shock proteins, but the authors did not observe induction of cold shock proteins by chloramphenicol or erythromycin (3). In our study, a few cold shock genes were induced by treatment with chloramphenicol or erythromycin in some of the experiments, but induction was not consistent for most cold shock genes (Table 2 and data not shown). A whole-genome transcriptional analysis of a gram-positive bacterium Streptococcus pneumoniae also showed that, although streptomycin induced heat shock genes, erythromycin and chloramphenicol did not alter heat shock gene expression (28). Our data are consistent with the Bacillus and Streptococcus studies in that gentamicin, as well as streptomycin, induced heat shock genes. The delayed induction (at 60 min) of the heat shock genes on treatment with gentamicin is consistent with studies by VanBogelen and Neidhardt in E. coli (41). These researchers found that, whereas temperature shifts resulted in an immediate induction of heat shock proteins, the addition of antibiotics such as aminoglycosides resulted in a much delayed heat shock response. In contrast to the studies described above, we show here that the expression of heat shock genes was repressed by chloramphenicol. These microarray results were validated by real-time RT-PCR analysis (Table 2). Again, the discrepancy could be due to experimental design and conditions. We could be observing a more primary effect, since altered expression of heat shock genes by treatment with chloramphenicol was observed after 15 min when the growth inhibitory effect was still minimal.
The effects of sublethal concentrations of translation inhibitors (chloramphenicol, erythromycin, tetracycline, and puromycin) on global transcription patterns of S. pneumoniae R6 was previously studied (28). These researchers found that genes from the major biological categories that were affected by translation inhibitors included genes involved in translation, transport and carrier proteins, and in amino acid biosynthesis. As mentioned above, we found similar classes of genes being regulated in chloramphenicol- and erythromycin-treated B. subtilis cultures.
We examined genes that were highly induced due to treatment with chloramphenicol, erythromycin, or gentamicin. Of particular interest were the yheIH and ysbAB operons. The expression of yheIH was highly induced by chloramphenicol after 15 min, whereas the expression of ysbAB was highly induced by all three antibiotics tested. The yheI and yheH genes were previously shown to encode ABC transporter-like proteins which were classified in subfamily 6 of B. subtilis ATP-binding proteins (29). Proteins in subfamily 6 are similar to multidrug resistance proteins of eukaryotes and prokaryotes. The YheI/YheH proteins might constitute four heterodimer ABC transporters. The ysbAB gene products are homologous to the lrgAB gene products in S. aureus. The LrgAB proteins confer negative control on extracellular murein hydrolase activity (the enzymes that cleave structural components of the bacterial cell wall), as well as decreased sensitivity to penicillin-induced killing in S. aureus (15). The lrgAB genes form an operon and encode for antiholin-like membrane proteins that were hypothesized to inhibit the formation of murein hydrolase transport channels (holin) in the bacterial membrane. Since ysbAB homologs function to inhibit cell wall cleavage (the murein hydrolase activity) and convey penicillin tolerance in S. aureus, it is slightly surprising to observe that ysbAB were induced by protein synthesis inhibitors. Our observation suggests that ysbA and ysbB may be involved in tolerance to protein synthesis inhibitors as well. Furthermore, the ysbAB genes were coregulated with yheH under 0.4x MIC chloramphenicol treatment, implying that they could share a similar function with the putative multidrug resistance protein. Sensitivity toward penicillin and protein synthesis inhibitors in B. subtilis strains overexpressing ysbAB is currently being studied.
We also investigated transcriptional regulators that were affected by chloramphenicol, erythromycin, and gentamicin. The pyrR gene, the transcription attenuation factor of the pyrR operon involved in pyrimidine biosynthesis, was induced after 15 min by all three protein synthesis inhibitors. As expected, the increased expression of the PyrR transcription attenuator leads to repression of the genes in the pyrR regulon after 15 min of antibiotic treatment. Expression of the lmrA gene, encoding a negative regulator of transcription of the lmrAB operon, was readily induced at 15 min by treatment with erythromycin or gentamicin. The lmrB gene, encoding a multidrug-resistant efflux protein, of the lmrAB operon was also induced at 15 min by erythromycin or gentamicin (25). Expression of the lmrAB operon was decreased after 15 min, possibly due to repression by the negative transcription regulator LmrA. Induction of lmrB may indicate a self-defense mechanism induced by treatment with erythromycin and gentamicin.
In summary, we determined the expression profiles of chloramphenicol-, erythromycin-, and gentamicin-treated B. subtilis cultures and showed that transcription of several major functional classes of genes was affected. Genes that were specifically affected by treatment with protein synthesis inhibitors could potentially be used as signature genes, along with signature genes from cultures treated with other antibiotics for determination of modes of action of new drugs.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
B-dependent general and
multiple stress response. J. Bacteriol.
184:459-467.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clin. Vaccine Immunol. | Clin. Microbiol. Rev. |
|---|---|
| J. Clin. Microbiol. | ALL ASM JOURNALS |