Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, July 2005, p. 3070-3072, Vol. 49, No. 7
0066-4804/05/$08.00+0 doi:10.1128/AAC.49.7.3070-3072.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Differences in the DNA Sequences in the Upstream Attenuator Region of erm(A) in Clinical Isolates of Streptococcus pyogenes and Their Correlation with Macrolide/Lincosamide Resistance
Stella Z. Doktor* and
Virginia Shortridge
Infectious Diseases Research, Abbott Laboratories, Abbott Park, Illinois
Received 20 January 2005/
Returned for modification 27 March 2005/
Accepted 17 April 2005
 |
ABSTRACT
|
|---|
The regulatory regions of 52 erm(A) [formerly erm(TR)] clinical Streptococcus pyogenes isolates were studied. Differences in the upstream regulatory region of erm(A) correlated with macrolide/lincosamide resistance patterns. Nine macrolide/lincosamide/streptogramin B-resistant isolates had changes in the leader sequence of erm(A) including base changes, insertions, or deletions. Isolates were also emm typed.
 |
TEXT
|
|---|
One methylase conferring macrolide resistance in streptococci is encoded by erm(A) [erm(TR)] in Streptococcus pyogenes. The regulatory region consists of two leader peptides containing a number of inverted repeats that can act in attenuator regulation, analogous to that found in erm(C) (4, 11). Little has been published regarding the regulation in S. pyogenes of erm(A), first found in Staphylococcus aureus.
The regulatory regions of 52 erm(A)-containing clinical isolates of Streptococcus pyogenes, collected between 1996 and 2003 from patients with pharyngitis, were studied to correlate differences in the upstream region of erm(A) with macrolide/lincosamide resistance patterns. Most exhibited typical inducible phenotypes (erythromycin intermediate/resistant and clindamycin susceptiblea subset tested were D-test positive). Nine isolates were erythromycin and clindamycin resistant and were classified as constitutive (macrolide/lincosamide/streptogramin B [MLSb] phenotype). The emm type, a molecularly based characterization correlated to M type, DNA sequencing, and MICs for erythromycin, clindamycin, and telithromycin, were done as previously described and according to NCCLS guidelines using the broth microdilution method, respectively (1, 2, 3, 10; www.cdc.gov/ncidod/biotech/strep/emmtypes.htm). The D-test to verify inducible phenotype was done on a subset of clindamycin-susceptible isolates according to NCCLS methods (2). Resistance mechanisms for isolates were determined as described previously for erm(B), mef(A), and erm(A) (8, 9). Isolates containing only erm(A) were sequenced through the regulatory region using the following primers selected from GenBank sequence AF002716 (7): FermAus pyo, GGAGGAGTTAAATATGTG; ermAus, GTCCTTTTCCTGACCCAA. Primer erm A4 (ATTCGCATGCTTCAGCACCTG) was used with FermAus pyo to determine if any amino acid substitutions were present in the 5' end of erm(A). GenBank sequence AF007216 was used as the reference wild-type sequence. The mRNA secondary structure published by Fines et al. was used as a guide with the first base of GenBank sequence AF002716, referred to as "1" to deduce potential stem-loop structures (4).
Table 1 summarizes the characteristics of the isolates studied. Twenty-eight inducibly expressed strains that had no changes in the upstream region relative to the AF002716 sequence were referred to as wild type. Fourteen inducible emm 77 isolates had single point mutations in the upstream region (C140T, C130A, and T119A).
Nine MLSb isolates were identified. Changes in the leader sequence of erm(A) were identified by DNA sequencing in eight of the isolates. One MLSb, telithromycin-susceptible isolate had a single base "A" insertion between positions 114 and 115. This "A" insertion resulted in a frame shift and a stop codon three amino acids downstream. Leader peptide 2 would be prematurely truncated at nine amino acids.
Four constitutively expressed isolates were telithromycin resistant. Three emm 75 isolates had a 44-base duplication/insertion corresponding to bases 188 to 231, duplicating the erm(A) ribosomal binding site and start sites. One emm 12 isolate had a 68-b-p deletion corresponding to bases 88 to 155, essentially deleting the entire leader peptide 2 region. Both of these mutations may expose the normally sequestered erm(A) ribosomal binding site (Fig. 1 and 2). Similar tandem duplications or deletions were previously identified in constitutively expressed erm(C)- and erm(A)-containing clinical isolates of S. aureus (5, 6, 13).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1. Possible structure formed by inverted repeats (IR1 to IR4) on erm(A) transcript and 44-base duplication and insertion. Duplicated and inserted bases are in italics.
|
|
Point mutations were also associated with MLSb, telithromcyin-susceptible phenotypes. One emm 11 isolate had two changes in the upstream regulatory region, A187C and T206C. An emm 1, MLSb isolate had two changes in the upstream region at T119A and G205A. T119A was associated with inducible expression when found alone but was associated with the MLSb phenotype when coupled with a base change at position 205. Similar point mutations were identified in constitutively expressed erm(A) in Staphylococcus intermedius (12).
One telithromcyin-susceptible, MLSb emm 58 isolate had a single base change, C145T. This base, in the coding region of leader peptide 2, introduced a stop codon in leader peptide 2, thereby truncating the peptide from 19 amino acids to 17.
The final MLSb emm 94 isolate was also telithromycin susceptible. The presence of erm(A) was confirmed by PCR but could not be evaluated with the standard primers. Primers designed from the AF002716 sequence at positions 35 to 52 in leader 1, 82 to 99 and 121 to 140 in leader 2, 165 to 183 between leader 2 and erm(A), and 189 to 208 upstream of erm(A) were used to help assess the regulatory region of the isolate. The 5'-most primer resulting in product was at position 165 to 183. The DNA sequence showed that the erm(A) stem-loop sequence and erm(A) were still intact. Therefore, a deletion of leader peptide 1 and leader peptide 2 sequence was inferred by PCR and sequencing data.
Twenty-five of the S. pyogenes isolates studied had the G409T change, corresponding to amino acid change A67S in the Erm A protein; 23 were inducible by erythromycin, with the wild-type upstream region. No apparent relationship between the A67S amino acid change and MIC of either macrolides or lincosamides was established.
An amino acid substitution in Erm A, N100S, corresponding to a single base change, A512G, was associated with a high erythromycin MIC (8 to 64 times higher than that for wild-type-inducible isolates) and clindamycin susceptibility in two isolates. The significance of the N100S amino acid change corresponding to base substitution A512G, if any, for macrolide resistance needs to be further investigated.
In this collection of 52 erm(A)-containing S. pyogenes isolates, 9 emm types were identified. Forty (77%) of the isolates were emm 77, emm 58, or emm 44/61. We described 10 upstream region types among the 52 S. pyogenes isolates. Forty-three of the isolates (or 83%) exhibited the typical inducible macrolide/lincosamide phenotype. We identified three differences (C140T, C130A, and T119A) in the regulatory region of erm(A) that did not appear to significantly affect regulation. We found seven different regulatory region mutations in nine isolates associated with the MLSb phenotype. The mutations were a 44-base duplication and insertion; a 68-base deletion; point mutation C145T; point mutations A187C and T206C; point mutations T119A and G205A; a single base insertion at position 114; and the apparent deletion of leader peptides 1 and 2. This study showed that mutations in the regulatory region of erm(A) can be correlated to constitutive or MLSb expression of erm(A) methylase and the resulting resistance to macrolides, lincosamides, and/or ketolides.
(This work was presented in part at the 43rd Annual ICAAC, Chicago, Ill., 2003 [abstr. C2-79]).
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: AP10-103, Dept. R4MJ, 100 Abbott Park Rd., Abbott Park, IL 60064. Phone: (847) 935-8044. Fax: (847) 938-1674. E-mail: stella.z.doktor{at}abbott.com. 
Present address: bioMerieux Inc., 595 Anglum Road, Hazelwood, MO 63042. 
 |
REFERENCES
|
|---|
- Beall, B., R. Facklam, and T. Thompson. 1996. Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci. J. Clin. Microbiol. 34:953-958.[Abstract]
- Clinical and Laboratory Standards Institute. 2005. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 6th ed., vol. M7-A6. Approved standard. Performance standards for antimicrobial susceptibility testing; 15th informational supplement. M100-S15. Clinical and Laboratory Standards Institute (NCCLS), Wayne, Pa.
- Doktor, S., J. M. Beyer, R. K. Flamm, and V. D. Shortridge. 2005. A comparison between emm typing and ribotyping using three restriction enzymes to characterize clinical isolates of Streptococcus pyogenes. J. Clin. Microbiol. 43:150-155.[Abstract/Free Full Text]
- Fines, M., M. Gueudin, A. Ramon, and R. Leclerq. 2001. In vitro selection of resistance to clindamycin related to alterations in the attenuator of the erm(TR) gene of Streptococcus pyogenes UCN1 inducibly resistant to erythromycin. J. Antimicrob. Chemother. 48:411-416.[Abstract/Free Full Text]
- Schmitz, F.-J., J. Pertridou, N. Astfalk, K. K
hrer, S. Scheuring, and S. Schwarz. 2002. Molecular analysis of constitutively expressed erm(C) genes selected in vitro by incubation in the presence of the noninducers quinupristin, telithromycin or ABT-773. Microb. Drug Resist. 8:171-177.[CrossRef][Medline]
- Schmitz, F.-J., J. Pertridou, N. Astfalk, S. Scheuring, K. K
hrer, J. Verhoef, A. Fluit, and S. Schwarz. 2001. Structural alterations in the translational attenuator of constitutively expressed erm(A) genes in Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1603-1604.[Free Full Text]
- Seppälä, H., M. Skurnik, H. Soini, M. Roberts, and P. Huovinen. 1998. A novel erythromycin resistance methylase gene (ermTR) in Streptococcus pyogenes. Antimicrob. Agents Chemother. 42:257-262.[Abstract/Free Full Text]
- Shortridge, V. D., G. Doern, A. Brueggemann, J. Beyer, and R. Flamm. 1999. Prevalence of macrolide resistance mechanisms in Streptococcus pneumoniae isolates from a multicenter antibiotic resistance surveillance study conducted in the United States in 1994-1995. Clin. Infect. Dis. 29:1186-1188.[CrossRef][Medline]
- Shortridge, V. D., R. Flamm, N. Ramer, J. Beyer, and S. Tanaka. 1996. Novel mechanism of macrolide resistance in Streptococcus pneumoniae. Diagn. Microbiol. Infect. Dis. 26:73-78.[CrossRef][Medline]
- Shortridge, V. D., P. Zhong, P. Cao, J. M. Beyer, L. S. Almer, N. C. Ramer, S. Z. Doktor, and R. K. Flamm. 2002. Comparison of in vitro activities of ABT-773 and telithromycin against macrolide-susceptible and -resistant streptocci and staphylococci. Antimicrob. Agents Chemother. 46:783-786.[Abstract/Free Full Text]
- Weisblum, Bernard. 1995. Insights into Erythromycin Action from Studies of Its Activity as Inducer of Resistance. Antimicrob. Agents Chemother. 39:797-805.[Medline]
- Werckenthin, C., and S. Schwarz. 2000. Molecular analysis of the transnational attenuator of a constitutively expressed erm(A) gene from Staphylococcus intermedius. J. Antimicrobial. Chemother. 46:785-788.[Abstract/Free Full Text]
- Werckenthin, C., S. Schwarz, and H. Westh. 1999. Structural alterations in the translational attenuator of constitutively expressed ermC genes. Antimicrob. Agents Chemother. 43:1681-1685.[Abstract/Free Full Text]
Antimicrobial Agents and Chemotherapy, July 2005, p. 3070-3072, Vol. 49, No. 7
0066-4804/05/$08.00+0 doi:10.1128/AAC.49.7.3070-3072.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Malhotra-Kumar, S., Mazzariol, A., Van Heirstraeten, L., Lammens, C., de Rijk, P., Cornaglia, G., Goossens, H.
(2008). Unusual resistance patterns in macrolide-resistant Streptococcus pyogenes harbouring erm(A). J Antimicrob Chemother
0: dkn432v1-5
[Abstract]
[Full Text]
-
Yoon, E.-J., Kwon, A.-R., Min, Y.-H., Choi, E.-C.
(2008). Foggy D-shaped zone of inhibition in Staphylococcus aureus owing to a dual character of both inducible and constitutive resistance to macrolide-lincosamide-streptogramin B. J Antimicrob Chemother
61: 533-540
[Abstract]
[Full Text]
-
Camilli, R., Del Grosso, M., Iannelli, F., Pantosti, A.
(2008). New Genetic Element Carrying the Erythromycin Resistance Determinant erm(TR) in Streptococcus pneumoniae. Antimicrob. Agents Chemother.
52: 619-625
[Abstract]
[Full Text]
-
Tazi, A., Reglier-Poupet, H., Raymond, J., Adam, J.-M., Trieu-Cuot, P., Poyart, C.
(2007). Comparative evaluation of VITEK 2(R) for antimicrobial susceptibility testing of group B Streptococcus. J Antimicrob Chemother
59: 1109-1113
[Abstract]
[Full Text]
-
Amezaga, M. R., McKenzie, H.
(2006). Molecular epidemiology of macrolide resistance in {beta}-haemolytic streptococci of Lancefield groups A, B, C and G and evidence for a new mef element in group G streptococci that carries allelic variants of mef and msr(D). J Antimicrob Chemother
57: 443-449
[Abstract]
[Full Text]
-
Culebras, E., Rodriguez-Avial, I., Betriu, C., Picazo, J. J.
(2005). Differences in the DNA sequence of the translational attenuator of several constitutively expressed erm(A) genes from clinical isolates of Streptococcus agalactiae. J Antimicrob Chemother
56: 836-840
[Abstract]
[Full Text]