AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siebor, E.
Right arrow Articles by Neuwirth, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siebor, E.
Right arrow Articles by Neuwirth, C.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, July 2005, p. 3097-3098, Vol. 49, No. 7
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.7.3097-3098.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

LETTER TO THE EDITOR

One New LEN Enzyme and Two New OKP Enzymes in Klebsiella pneumoniae Clinical Isolates and Proposed Nomenclature for Chromosomal ß-Lactamases of This Species


    LETTER
 Top
 Letter
 References
 
Three families of chromosomally encoded beta-lactamases have been identified so far in Klebsiella pneumoniae clinical isolates: SHV (7), LEN (1), and very recently, OKP (5). These enzymes are closely related to OHIO-1 (10). We determined the sequences of the bla genes of nine isolates of K. pneumoniae producing a penicillinase with an isoelectric point different from 7.6, the pI of the most commonly encountered SHV-1 (6). The strains were susceptible to cephalosporins (except for one isolate that also produced CTX-M-3). The bla gene was amplified with primers Pro3-F (9) and Gra2-R (8). Sequencing of the entire bla gene was performed with the use of additional primers: P1-F (2), P1-Rev (CAAGGTGTTTTTCGCTGA), and P3-F (CCACTACCCCGGCCAGCATG) (this study). Primers Pro3-F, Gra2-R, P1-F, P1-Rev, and P3-F were located at positions 132 to 151, 1060 to 1041, 509 to 526, 526 to 509, and 725 to 744 of blaSHV-1 (GenBank accession number AF124984), respectively. A new blaLEN gene and two new blaOKP genes were detected. The blaLEN variant (GenBank accession number AY743416) encoded a novel enzyme, LEN-10 (pI between 7.1 and 7.2), which differed from LEN-2 by three amino acids: Asp24Tyr, Val88Leu, and Val114Thr.

The OKP-5 and OKP-6 beta-lactamases had a pI of 7.1 (GenBank accession number AY512506 for blaOKP-5 and AY850171 for blaOKP-6). Figure 1 showed the alignment of the amino acid sequences of the OKP enzymes. Like the other members of the family, OKP-5 and OKP-6 differed from SHV-1 and LEN-1 by 27 to 33 amino acids. It is noteworthy that three substitutions occurred within the first 16 amino acids. Unfortunately, this region was not sequenced in the case of the four OKP variants described so far, because the primers used by the authors do not encompass the beginning of the sequence of the bla gene (5).



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 1. Alignment of the amino acid sequences of OKP-1, OKP-2, OKP-3, OKP-4 (truncated sequences) (5), OKP-5, and OKP-6 (this study). The amino acid position is shown above the sequence. The consensus sequence (C) is shown below the other sequences. In the consensus sequence, asterisks indicate positions of amino acid substitutions. Gaps introduced to maximize alignment are indicated by dashes.

 
Our results confirm the diversity of class A chromosomal beta-lactamase genes among K. pneumoniae isolates. Haeggman et al. noticed in their study that the pIs of the OKP beta-lactamases (7.8, 8.1, 7.0, and 6.5) are different from the pIs of the chromosomal SHV (7.6) and LEN (7.1) enzymes and therefore proposed using the pI as the first tool to identify the beta-lactamase family of K. pneumoniae (5). The new LEN-10 enzyme had a pI somewhat different from 7.1, indicating the possibility of variation in the pIs among the members of this family. Moreover, OKP-5 and OKP-6 had a pI of 7.1, identical to that of multiple LEN variants. These two observations undermine the proposal of Haeggman et al.

We propose grouping the LEN and the OKP enzymes in a single new family "K. pneumoniae-specific chromosomal ß-lactamases," excluding SHV on the basis of the following major observations. (i) LEN and OKP enzymes have been characterized only in K. pneumoniae isolates, unlike SHV-1. (ii) The blaLEN and blaOKP genes are chromosomally located, whereas blaSHV-1 is sometimes carried by a plasmid (3, 4). (iii) LEN and OKP have been unable to evolve the ability to hydrolyze extended-spectrum cephalosporins.

In conclusion, this work pointed out the necessity of obtaining the complete sequence of the bla gene with the appropriate primers to identify the phylogenic group of a K. pneumoniae chromosomal beta-lactamase.


    REFERENCES
 Top
 Letter
 References
 

  1. Arakawa, Y., M. Ohta, N. Kido, Y. Fujii, T. Komatsu, and N. Kato. 1986. Close evolutionary relationship between the chromosomally encoded ß-lactamase gene of Klebsiella pneumoniae and the TEM ß-lactamase gene mediated by R plasmids. FEBS Lett. 207:69-74.[CrossRef][Medline]
  2. Babini, G. S., and D. M. Livermore. 2000. Are SHV ß-lactamases universal in Klebsiella pneumoniae? Antimicrob. Agents Chemother. 44:2230.[Free Full Text]
  3. Bradford, P. A. 2001. Extended-spectrum ß-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14:933-951.[Abstract/Free Full Text]
  4. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for ß-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233.[Medline]
  5. Haeggman, S., S. Lofdahl, A. Paauw, J. Verhoef, and S. Brisse. 2004. Diversity and evolution of the class A chromosomal ß-lactamase gene in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 48:2400-2408.[Abstract/Free Full Text]
  6. Labia, R., M. Barthelemy, and J. M. Masson. 1976. Multiplicity of ß-lactamases: a problem of isoenzymes. C. R. Acad. Sci. D 283:1597-1600.
  7. Mercier, J., and R. C. Levesque. 1990. Cloning of SHV-2, OHIO-1, and OXA-6 ß-lactamases and cloning and sequencing of SHV-1 ß-lactamase. Antimicrob. Agents Chemother. 34:1577-1583.[Abstract/Free Full Text]
  8. Rasheed, J. K., G. J. Anderson, H. Yigit, A. M. Queenan, A. Domenech-Sanchez, J. M. Swenson, J. W. Biddle, M. J. Ferraro, G. A. Jacoby, and F. C. Tenover. 2000. Characterization of the extended-spectrum ß-lactamase reference strain, Klebsiella pneumoniae K6 (ATCC 700603), which produces the novel enzyme SHV-18. Antimicrob. Agents Chemother. 44:2382-2388.[Abstract/Free Full Text]
  9. Rice, L. B., L. L. Carias, A. M. Hujer, M. Bonafede, R. Hutton, C. Hoyen, and R. A. Bonomo. 2000. High-level expression of chromosomally encoded SHV-1 ß-lactamase and an outer membrane protein change confer resistance to ceftazidime and piperacillin-tazobactam in a clinical isolate of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 44:362-367.[Abstract/Free Full Text]
  10. Shlaes, D. M., C. Currie-McCumber, A. Hull, I. Behlau, and M. Kron. 1990. OHIO-1 ß-lactamase is part of the SHV-1 family. Antimicrob. Agents Chemother. 34:1570-1576.[Abstract/Free Full Text]
Eliane Siebor
André Péchinot
Jean-Marie Duez
Catherine Neuwirth*

Laboratoire de Bactériologie
Hôpital Universitaire du Bocage
BP 77908
21079 Dijon Cedex, France

* Phone: 33-3 80 29 32 60, Fax: 33-3 80 29 36 67, E-mail: catherine.neuwirth{at}chu-dijon.fr


Antimicrobial Agents and Chemotherapy, July 2005, p. 3097-3098, Vol. 49, No. 7
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.7.3097-3098.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siebor, E.
Right arrow Articles by Neuwirth, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siebor, E.
Right arrow Articles by Neuwirth, C.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS