AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wootton, M.
Right arrow Articles by Walsh, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wootton, M.
Right arrow Articles by Walsh, T. R.
Antimicrobial Agents and Chemotherapy, August 2005, p. 3598-3599, Vol. 49, No. 8
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.8.3598-3599.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

LETTER TO THE EDITOR

Strain-Specific Expression Levels of pbp4 Exist in Isolates of Glycopeptide-Intermediate Staphylococcus aureus (GISA) and Heterogeneous GISA


   LETTER
Top
 Letter
References
 
A common characteristic of glycopeptide-intermediate-resistant Staphylococcus aureus (GISA) is a thickened cell wall, containing fewer cross-links and hence an abundance of D-Ala-D-Ala termini of the pentapeptide. A further phenomenon observed in GISA has been lowered or nonexistent expression of pbp4, which has both transpeptidase and D,D-carboxypeptidase activity, cleaving terminal D-alanine residues from uncross-linked muropeptides (3). Reduced expression of pbp4 may contribute to production of thickened and altered peptidoglycan and the intermediate resistance to glycopeptides exhibited in these strains.

Expression of pbp4 and/or activity of PBP4 has been studied mainly in laboratory-derived strains and less well in clinical GISA isolates. Initial penicillin-binding protein (PBP) studies showed an increase in PBP4 levels (as well as those of other PBPs) in one out of three laboratory-derived GISA isolates (4). However, in a vancomycin-resistant mutant (VM), a teicoplanin-resistant mutant (TNM), and a vancomycin- and teicoplanin-resistant mutant (TM), no detectable PBP4 was found (9), and other laboratory-generated vancomycin-resistant "step mutants" showed decreased PBP4 levels with increasing vancomycin MICs (10). More recently, three clinical GISA strains (including Mu50) were reported to have undetectable PBP4 levels, a fourth was found to contain lowered PBP4 levels (1), and a further clinical GISA strain exhibited a reduction in both PBP3 and PBP4 levels (6).

Nine clinical GISA strains (Mu50, Michigan [MI], New Jersey [NJ], SL, SW307, GL3700, GL3759, LIM3, and PC3) belonging to two clonal groups (New York/Japanese and Brazilian/Portuguese), 11 heterogeneous GISA (hGISA) strains (Mu3, SW309, AGN, NW1018, SL6096, LIM1, PC1, SMH2, LLE, 23SH, and DF) belonging to five clonal groups (Brazilian/Portuguese, Australia, UK EMRSA 2 + 6, Iberian, and UK EMRSA 15), and 7 glycopeptide-susceptible S. aureus (GSSA) strains belonging to three clonal groups (UK EMRSA 15, UK EMRSA 2 + 6, and Brazilian/Portuguese) (2) were studied in triplicate assays, using reverse transcriptase PCR with customized primers (CTGTAAGCACTGCTAGAGAC/CGTTGCTTCTCGCCACCAAG) and gel electrophoresis, to evaluate the expression levels of pbp4 in exponential-phase growth.

Three GISA strains (MI, GL3759, and SL) and one hGISA strain (AGL) exhibited 80% reductions in pbp4 expression, while three other GISA strains (Mu50, NJ, and SW307) and two hGISA strains (Mu3 and NW1018) exhibited 20% reductions in pbp4 expression, compared with the expression levels in GSSA strains (Fig. 1).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1. pbp4 expression levels in GISA, hGISA, and GSSA strains. Lanes 1 to 6, GISA strains (MI, NJ, GL3700, GL3759, SL, and SW307); lanes 7 to 13, hGISA strains (DF, 23SH, AGL, SL6096, NW1018, SW309, and SMH2); lanes 14 to 19, GSSA strains; lanes 20 and 21, LLA/LLE; lanes 22 and 23, PC1/PC3; lanes 24 and 25, LIM1/LIM3; lane 26, GSSA; lanes 27 and 28, Mu50/Mu3.

 
The expression of pbp4 appears to vary according to the strain. The band intensities of the related strain set LLA (GSSA) and LLE (hGISA) decreased slightly with increasing vancomycin-intermediate resistance. However, in two other clinically related hGISA and GISA strain sets (PC1/PC3 and LIM1/LIM3), no variation in expression was observed (Fig. 1, compare lanes 22 and 23 and lanes 24 and 25).

Although expression of pbp4 appears to be reduced or nonexistent in the few strains previously studied, this study reveals that not all GISA strains show reduced pbp4 expression. Also, the variety in pbp4 expression is not indicative of any particular clonal type. In this study, pbp4 expression levels in four clinical GISA strains correlated well with those of the same strains studied previously (NJ, Mu50, MI, and Mu3) (1).

Although loss of pbp4 gene function was attributed to formation of a premature stop codon in TNM and duplication of a 51-nucleotide segment in TM and VM (9), these mutations were not found in 41 clinical isolates with low-level teicoplanin resistance, suggesting either that pbp4 expression is unchanged in clinical GISA isolates or that if activity levels of PBP4 are lower, the decrease reflects other changes to the pbp4 gene or its expression (5).

It is possible therefore that the different pbp4 expression levels seen in clinical GISA strains are strain specific or that posttranslational modification occurs. Nonetheless, lowered PBP4 levels may play a role in vancomycin-intermediate resistance in some strains, explaining the fewer cross-links seen in the peptidoglycan of those strains and the higher levels of un-cross-linked pentapeptide chains containing D-Ala-D-Ala termini (6, 7, 8).


   REFERENCES
Top
 Letter
 References
 

  1. Finan, J. E., G. L. Archer, M. J. Pucci, and M. W. Climo. 2001. Role of penicillin-binding protein 4 in expression of vancomycin resistance among clinical isolates of oxacillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:3070-3075.[Abstract/Free Full Text]
  2. Howe, R. A., A. Monk, M. Wootton, T. R. Walsh, and M. C. Enright. 2004. Vancomycin susceptibility within methicillin-resistant Staphylococcus aureus lineages. Emerg. Infect. Dis. 10:855-857.[Medline]
  3. Kozarich, J. W., and J. L. Strominger. 1978. A membrane enzyme from Staphylococcus aureus which catalyzes transpeptidase, carboxypeptidase, and penicillinase activities. J. Biol. Chem. 253:1272-1278.[Abstract/Free Full Text]
  4. Moreira, B., S. Boyle-Vavra, B. L. M. de Jonge, and R. S. Daum. 1997. Increased production of penicillin-binding protein 2, increased detection of other penicillin-binding proteins, and decreased coagulase activity associated with glycopeptide resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 41:1788-1793.[Abstract]
  5. Park, Y.-J., E.-J. Oh, S.-O. Lee, and B. K. Kim. 2001. Absence of mutation in the region (nt 710-1010) of pbp4 gene in clinical isolates of Staphylococcus aureus with low-level teicoplanin resistance. Diagn. Microbiol. Infect. Dis. 39:271-273.[Medline]
  6. Reipert, A., K. Ehlert, T. Kast, and G. Bierbaum. 2003. Morphological and genetic differences in two isogenic Staphylococcus aureus strains with decreased susceptibilities to vancomycin. Antimicrob. Agents Chemother. 47:568-576.[Abstract/Free Full Text]
  7. Sieradzki, K., and A. Tomasz. 1998. Suppression of glycopeptide resistance in a highly teicoplanin-resistant mutant of Staphylococcus aureus by transposon inactivation of genes involved in cell wall synthesis. Microb. Drug Resist. 4:159-168.[Medline]
  8. Sieradzki, K., and A. Tomasz. 1998. Extensive changes in cell wall structure and biosynthesis in a highly teicoplanin-resistant mutant (TNM) of methicillin-resistant Staphylococcus aureus (MRSA). Abstr. 38th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C-144.
  9. Sieradzki, K., M. G. Pinho, and A. Tomasz. 1999. Inactivated pbp4 in highly glycopeptide-resistant laboratory mutants of Staphylococcus aureus. J. Biol. Chem. 274:18942-18946.[Abstract/Free Full Text]
  10. Sieradzki, K., and A. Tomasz. 1999. Gradual alterations in cell wall structure and metabolism in vancomycin-resistant mutants of Staphylococcus aureus. J. Bacteriol. 181:7566-7570.[Abstract/Free Full Text]
M. Wootton*
B.C.A.R.E.
Southmead Hospital
Bristol, United Kingdom

P. M. Bennett
Department of Pathology and Microbiology
University of Bristol
Bristol, United Kingdom

A. P. MacGowan
B.C.A.R.E.
Southmead Hospital
Bristol, United Kingdom

T. R. Walsh
Department of Pathology and Microbiology
University of Bristol
Bristol, United Kingdom

* Phone: 44 117 9287526, Fax: 44 117 9287896, E-mail: mandy.wootton{at}bristol.ac.uk.

Antimicrobial Agents and Chemotherapy, August 2005, p. 3598-3599, Vol. 49, No. 8
0066-4804/05/$08.00+0     doi:10.1128/AAC.49.8.3598-3599.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wootton, M.
Right arrow Articles by Walsh, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wootton, M.
Right arrow Articles by Walsh, T. R.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS