Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, October 2006, p. 3325-3329, Vol. 50, No. 10
0066-4804/06/$08.00+0 doi:10.1128/AAC.00548-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Laboratory Medicine, Children's Hospital and Regional Medical Center, Seattle, Washington,1 Department of Laboratory Medicine, the University of Washington School of Medicine, Seattle, Washington,2 Division of Gastroenterology, Department of Pediatrics, Children's Hospital and Regional Medical Center, Seattle, Washington,3 Mucosal and Vaccine Research Center, VA Medical Center, Minneapolis, Minnesota,4 Department of Medicine, University of Minnesota, Minneapolis, Minnesota,5 Virginia Mason Medical Center, Seattle, Washington,6 Foodborne and Diarrheal Diseases Branch, Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia,7 Department of Pediatrics, University of Washington School of Medicine, Seattle, Washington,8 Departments of Pediatrics and Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri9
Received 2 May 2006/ Returned for modification 2 July 2006/ Accepted 18 July 2006
|
|
|---|
|
|
|---|
Children are an easily defined population in which to determine if resistance to certain classes of antimicrobial agents can occur in unexposed individuals. Fluoroquinolones (e.g., ciprofloxacin), although extensively used in adults, are not approved for routine childhood administration because of concern about cartilage toxicity (10). Consequently, pediatric usage of fluoroquinolones, except for the treatment of selected illnesses, such as cystic fibrosis, is quite unusual in North America. Gram-negative bacilli, which are potential pathogens, are intrinsically susceptible to fluoroquinolones. Because children are rarely exposed to fluoroquinolones, gram-negative bacilli resistant to this class of antimicrobial agents in the fecal microflora of children probably emerged via selective pressure exerted in a different setting or host, before these individuals ingested the organisms. To attempt to determine if such resistant bacteria exist in the feces of children within the general population who have no history of relevant antimicrobial exposure, we conducted a prospective analysis of stools from children who had not been directly exposed to fluoroquinolones.
|
|
|---|
The stools were refrigerated at the pediatric office for up to 4 hours before being processed. This study was approved by the Children's Hospital and Regional Medical Center (the sponsoring academic institution) and the Virginia Mason Medical Center Institutional Review Boards.
Antibiotic resistance screening.
To isolate ciprofloxacin-resistant gram-negative bacteria, stools were plated on MacConkey agar containing ciprofloxacin (1 mg per liter), prepared by adding antibiotic to autoclaved, cooling MacConkey agar base (Becton-Dickinson, Sparks, Maryland). If there was growth on these plates after overnight incubation at 35°C, a single resulting colony ("index ciprofloxacin-resistant bacteria") was selected at random and its identity was determined by conventional tube biochemical assays, Vitek GNI+ (bioMérieux, Inc., Hazelwood, MO), API 20E (bioMérieux), and the Rapid NF Plus System (Remel, Inc., Lenexa, KS). The identities of presumptive Stenotrophomonas maltophilia and Achromobacter xylosoxidans isolates were confirmed by partial 16S rRNA gene sequencing (22). MICs to ciprofloxacin and moxifloxacin were determined using the Etest (AB Biodisk, Solna, Sweden) (27) according to the manufacturer's recommendations. An isolate was considered resistant to ciprofloxacin or moxifloxacin if its MIC for these agents was
4 mg per liter. Index ciprofloxacin-resistant bacteria were stored in Luria-Bertani broth (26) with 15% glycerol and ciprofloxacin (1 mg per liter) at 80°C.
To determine the proportion of total gram-negative bacteria excreted by the subjects that were resistant to ciprofloxacin, all stool specimens were plated on MacConkey agar containing no antibiotics. After overnight incubation at 35°C, five lactose-fermenting colonies (as available) were selected at random ("coisolated lactose-fermenting bacteria") and frozen in Luria-Bertani broth with 15% glycerol at 80°C until they were analyzed further. These coisolated lactose-fermenting bacteria were subsequently tested for ciprofloxacin resistance if they had been recovered from a patient whose stool yielded ciprofloxacin-resistant Escherichia coli.
Index bacteria determined to be ciprofloxacin-resistant E. coli were O:H serotyped at the Centers for Disease Control and Prevention by standard agglutination methods. The primer pairs 5'ACGTACTAGGCAATGACTGG3'-5'AGAACTCGCCGTCGATAGAAC3' and 5'TGTATGCGATGTCTGAACTG3'-5'CTCAATAGCAGCTCGGAATA3' were used to amplify gyrA and parC, respectively, from boiled lysates of ciprofloxacin-resistant E. coli. These amplicons, which include regions that can contain mutations associated with quinolone resistance (7), were then sequenced bidirectionally.
Index resistant E. coli were tested for susceptibilities to ampicillin, ampicillin-clavulinic acid, aztreonam, cefazolin, cefepime, ceftazidime, ceftriaxone, cefuroxime, ciprofloxacin, gentamicin, meropenem, piperacillin-tazobactam, and trimethoprim-sulfamethoxazole, using first the Vitek GNS-122 system (bioMérieux) for screening and then a standard antimicrobial disk diffusion test for confirmation. Susceptibilities of A. xylosoxidans to other antibiotic agents were tested by the disk diffusion method only. The MICs of ciprofloxacin and moxifloxacin for all quinolone-resistant organisms were determined by the Etest method (AB Biodisk, Solna, Sweden). The antibiotic susceptibilities of S. maltophilia to a battery of five other antibiotic agents (ceftazidime, chloramphenicol, doxycycline, ticarcillin-clavulinic acid, and trimethoprim-sulfamethoxazole) were also determined by the Etest method. The results generated from both the disk diffusion tests and the MIC Etests were interpreted using the criteria suggested by the Clinical and Laboratory Standards Institute (3, 4).
Index ciprofloxacin-resistant E. coli isolates were assigned to one of four main phylogenetic groups (A, B1, B2, or D) (12) by multiplex PCR (2). They were also tested for 47 virulence genes, including 34 virulence-associated genes of extraintestinal pathogenic E. coli and 13 papA (structural-subunit) alleles, using established PCR-based assays (15, 16). Appropriate positive and negative controls were included. An aggregate virulence score was calculated for each isolate as the number of virulence genes detected. E. coli isolates were additionally classified as extraintestinal and pathogenic if they contained at least two of the following five genes: papA or papC, sfa/foc, afa/dra, iutA, and kpsMII (14). Index and coisolated ciprofloxacin-resistant E. coli isolates were tested for clonal relatedness by pulsed-field gel electrophoresis, following XbaI digestion (1).
The statistical significances of differences between proportions were determined using the two-tailed Fisher's exact test.
|
|
|---|
32 mg per liter, with the E. coli isolates demonstrating the highest degrees of resistance (Table 1). All seven resistant E. coli isolates contained Ser83Leu and Asn87Asp mutations in gyrA and a Ser83Ile mutation in parC; two also contained a Glu84Val mutation in parC. The resistant E. aerogenes isolate had a Ser83Ile mutation in gyrA. |
View this table: [in a new window] |
TABLE 1. Summary of resistant microfloraa
|
On plain MacConkey agar plates, stools from six of the seven children with ciprofloxacin-resistant E. coli yielded at least one additional lactose-fermenting colony that also proved to be a ciprofloxacin-resistant E. coli isolate. All such coisolated ciprofloxacin-resistant E. coli isolates were indistinguishable from the corresponding index resistant isolates, according to XbaI pulsed-field gel electrophoresis patterns.
The spectrum of antimicrobial resistance in the 13 resistant organisms was not limited to fluoroquinolones. Five of the seven index E. coli isolates were fully resistant to trimethoprim-sulfamethoxazole; three were also resistant to narrow- and broad-spectrum cephalosporins. None of the 13 children whose stool specimens yielded ciprofloxacin-resistant gram-negative bacilli either used a fluoroquinolone or resided in a household where a fluoroquinolone was used during the 4 weeks before specimen collection, based on recall. We detected no influence of other antibiotics on the detection of a quinolone-resistant organism. Fifty-three (11.6%) of the 455 children used antibiotics during the 4 weeks before stool collection, including 2 (15.4%) of the 13 children with ciprofloxacin-resistant gram-negative bacilli in their stools (P = 0.65). Eighty-nine (19.6%) of the children lived in households where at least one other household member used antibiotics during this interval, including 3 (23.1%) of the 13 children excreting ciprofloxacin-resistant gram-negative bacilli (P = 0.72).
|
|
|---|
Even though gram-negative bacilli are members of the commensal gastrointestinal microflora, these organisms can cause serious extraintestinal infections in both healthy and immunocompromised hosts (20). Fluoroquinolones are often used to treat extraintestinal infections with gram-negative bacteria. Though our study focused on children, the findings of ciprofloxacin-resistant gram-negative bacilli in antibiotic-naïve children seems likely to also be relevant to adults who have not been exposed to these antimicrobial agents.
The pathogenic potentials of the resistant organisms identified in this study are uncertain, but it is of concern that most of the ciprofloxacin-resistant E. coli isolates had characteristics that implicate them as uropathogens. Thus, these resistant organisms should not be dismissed as merely harmless members of the commensal microflora. It is also noteworthy that the resistant E. coli isolates, when present, were usually quantitatively predominant within the facultative coliform microflora, rather than a minority clone, as demonstrated by their presence among five arbitrarily picked colonies of gram-negative fecal bacteria that grew on nonselective media. The apparent urovirulence potentials of these E. coli isolates contrast with previous surveys, in which ciprofloxacin-resistant E. coli isolates from humans contained few such pathogenicity-associated loci (14, 16, 17).
Our finding of ciprofloxacin-resistant gram-negative lactose-fermenting bacteria other than E. coli also has potential clinical implications. For example, because fluoroquinolones are used to treat S. maltophilia infections (5, 9), fluoroquinolone resistance in this species could lead to therapeutic failures if the resistant organisms were to cause infection.
It is not possible from our data to determine the source of acquisition of these resistant enteric bacteria. However, it is plausible that the source was food (28, 29, 31). In the United States, fluoroquinolones (e.g., enrofloxacin) have been used in cattle since 1998 and in chickens and turkeys from 1995 to 2005. Their use provides a selective advantage to bacteria that are resistant to these agents and potentially contributes to dissemination of these resistant bacteria to humans through the food supply. Bacteria resistant to enrofloxacin are typically resistant to ciprofloxacin. It is therefore conceivable that the resistance in these human source strains was derived from the use of these antimicrobial agents in food animals. Provocatively, in Australia, where fluoroquinolones are banned in food animals, domestically acquired fluoroquinolone-resistant Campylobacter infections are quite rare (30). It is also possible that sources for the resistant bacteria isolated in this study could have been family members who received a fluoroquinolone more than 4 weeks before the children's stool samples were submitted (because it is not known how long such organisms persist in human fecal microflora) or people in the community outside the subjects' households. Indeed, daycare studies have demonstrated nonfamilial transmission of E. coli isolates resistant to trimethoprim (8, 25). Some of the children in our study who were <1 year of age and whose stools contained resistant organisms might have consumed exclusively breast milk or infant formula and not been exposed directly to food-borne bacteria.
The possibility that the use of antimicrobial agents in food animals has contributed to the selection of antibiotic-resistant bacteria and their dissemination to humans through the food supply is a concern raised by several previous studies. For example, human infections with fluoroquinolone-resistant Campylobacter jejuni have been attributed to the use of fluoroquinolones in poultry production (6, 14). Additionally, the recent widespread emergence of multidrug-resistant uropathogenic E. coli and the rising incidence of fluoroquinolone-resistant urinary E. coli (19, 23) demonstrate the risk fluoroquinolone-resistant gram-negative bacilli pose to the general population (13, 14, 16, 18).
We note that our study has several limitations. First, recall biases could have influenced, either positively or negatively, reports of recent antibiotic use in the households. Second, we were selective in the quantity of data we were able to accrue, and we propose that future studies address potentially relevant factors, such as dietary questions, household size, daycare attendance, and breast milk consumption. Third, the 1-month period for exposure assessment, while seemingly reasonable for this exploratory study, might have been too limited. A recent study demonstrated long-term carriage of tetracycline-resistant E. coli in stools of infants (21), which raises the possibility of selective events occurring at times well before sampling. Fourth, we were unable to confirm compliance with our request that stools be submitted once from each subject. Fifth, we were unable to monitor how many stools were submitted from children within the same household, though our large sample size mitigates biases introduced by intrafamily repeat submissions. Sixth, in this open U.S. population, in a study in which specimens were submitted anonymously, we were unable to use pharmacy databases to confirm medication use or nonuse. Despite these limitations, we have demonstrated that children who were highly unlikely to have been exposed to fluoroquinolones shed in their stools bacteria that had acquired resistance to these antibiotics. Acquisition of an antimicrobial-resistant gastrointestinal microflora by persons in the community who had not been exposed to antimicrobial agents poses considerable challenges. Further research should determine the prevalence, and spectrum, of antibiotic resistance in human reservoirs in the community. Such investigations ideally should also address the age-specific duration and intensity of shedding of the resistant organisms, mechanisms of development of resistance in these organisms, and molecular comparisons of antimicrobial-resistant human, food, and animal isolates to clarify the sources of the resistant isolates encountered in humans. These data will be helpful in confirming or refuting the potential association between the use of antimicrobial agents in food animals and intestinal carriage of antibiotic-resistant fecal organisms by non-antibiotic-exposed humans.
Sources of financial support included Centers for Disease Control and Prevention Contract CCU015040 (design and conduct of the study; collection, management, analysis and interpretation of the data; and preparation, review, and approval of the manuscript); National Institutes of Health grant AI47499 (P.I.T.) (design and conduct of the study; collection, management, analysis, and interpretation of the data); the Office of Research and Development, Medical Research Service, Department of Veterans Affairs (collection, management, analysis, and interpretation of the data); and the National Research Initiative (NRI) Competitive Grants Program/U.S. Department of Agriculture grant 00-35212-9408 (J.R.J.) (collection, management, analysis, and interpretation of the data).
We acknowledge Megan Menard, Connie Clabots, Brian Johnston, Abby Gajewski, and Cheryl Bopp for technical assistance and Jennifer Falkenhagen, James Dowd, and Beth Wolf for assistance with manuscript preparation.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»