Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, November 2006, p. 3622-3630, Vol. 50, No. 11
0066-4804/06/$08.00+0 doi:10.1128/AAC.00410-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Unité des Agents Antibactériens, Institut Pasteur, 75724 Paris Cedex 15, France
Received 3 April 2006/ Returned for modification 3 June 2006/ Accepted 29 August 2006
|
|
|---|
|
|
|---|
Methicillin resistance in MRSA is due to the acquisition of the mecA gene, which encodes a penicillin-binding protein (PBP), PBP2a, that exhibits low ß-lactam affinity (15). PBPs are membrane-bound D,D-peptidases that catalyze the transpeptidation and/or transglycosylation reaction that cross-links the peptidoglycan of the bacterial cell wall.
Glycopeptide antibiotics vancomycin and teicoplanin bind to the C-terminal D-alanyl-D-alanine (D-Ala-D-Ala) of externally oriented pentapeptide peptidoglycan precursors and block the transglycosylation and transpeptidation reactions (26). VanA-type glycopeptide resistance in enterococci is due to synthesis of modified precursors terminating in D-Ala-D-lactate (D-Ala-D-Lac) in place of D-Ala-D-Ala (6) and is mediated by Tn1546 or closely related genetic elements (3, 13).
In 2002, the first two MSRA and vancomycin-resistant S. aureus (VRSA) strains, MI-VRSA and PA-VRSA, were isolated in the United States (20, 31). Although they both harbor a plasmid-borne Tn1546 element (33, 34), the two strains exhibit distinct phenotypes: MI-VRSA has a high level of resistance (HLR) to both glycopeptides, whereas PA-VRSA presents a low level of resistance (LLR) to the drugs (7, 32). We have shown that low-level resistance of the PA-VRSA strain is due to loss, at high frequency, of the vanA operon and to a longer lag phase before induction of resistance (22).
In 2004, a third VanA-type MRSA clinical isolate, NY-VRSA, with an LLR phenotype, was detected in New York (17). As already observed for PA-VRSA, automated susceptibility testing methods failed at detecting vancomycin resistance in this strain (17, 33). Since then, a fourth HLR VanA-type MRSA was isolated and called VRSA-5 (Michigan Department of Community Health; posting date, 3 March 2005; www.michigan.gov/mdchlab).
Synergistic activity of the combination of vancomycin and oxacillin against MRSA strain COL, in which a vanA-carrying plasmid was transferred, has been demonstrated (27). We have studied the organization and extent of heterologous expression of the vanA gene cluster in strains NY-VRSA and VRSA-5. We have also evaluated the outcome of combinations of ß-lactams and glycopeptides on these two strains and on the two other available clinical isolates of VanA-type MRSA.
|
|
|---|
Filter mating. Transfer of vancomycin resistance from NY-VRSA to Enterococcus faecalis JH2-2 and E. faecium BM4105 was attempted by filter mating (11) with selection on agar containing rifampin (20 µg/ml), fusidic acid (10 µg/ml), and one of the following: vancomycin (6 µg/ml), gentamicin (32 µg/ml), kanamycin (500 µg/ml), or erythromycin (10 µg/ml).
Growth rate studies. Induction of resistance by vancomycin was studied by determination of growth rates under various conditions. NY-VRSA and VRSA-5 were grown overnight at 37°C in BHI broth with or without vancomycin (6 µg/ml). The cultures were diluted 1:20 into 20 ml of BHI with or without vancomycin (6 µg/ml) and then grown at 37°C with shaking, and the optical density at 600 nm was monitored.
PCR analysis. Glycopeptide resistance of the vanA genotype was confirmed by PCR as described previously (10). Glycopeptide-susceptible derivatives of NY-VRSA and VRSA-5 as well as the parental strains were identified as S. aureus by amplification of an internal portion of the thermonuclease nuc gene, using total DNA as a template and specific primers (5). PCR mapping of the vanA operon of NY-VRSA and VRSA-5 was performed by using primers specific for every gene of the cluster (3) (Fig. 1).
![]() View larger version (17K): [in a new window] |
FIG. 1. Comparison of Tn1546 elements. (Top) PCR map of Tn1546. Arrowheads indicate the direction of DNA synthesis with primers P1 to P18 (3). Horizontal bars depict the PCR products. IRL and IRR, inverted repeat left and right, respectively. (Bottom) Organization of the Tn1546 element in NY-VRSA. Primers Z1 and Z2 were used for inverse PCR. Hc, HinCII; Hp, HpaI. Open arrows represent coding sequences and indicate the direction of transcription.
|
D,D-peptidase activities. The D,D-peptidase enzymatic activities were assayed in the absence or presence of glycopeptide (vancomycin or teicoplanin at 4 µg/ml) as described previously (2, 22).
Contour-clamped homogeneous electric field gel electrophoresis. Genomic DNA of S. aureus NY-VRSA and VRSA-5 embedded in agarose plugs was digested with SmaI, and the resulting fragments were separated by pulsed-field gel electrophoresis as described previously (9).
Synergy testing. Three methods were used to assess synergism between glycopeptides and oxacillin, and three independent experiments were performed with each method.
(i) Disk diffusion and MIC determination by E-test. Vancomycin (30 µg), teicoplanin (30 µg), and oxacillin (5 µg) disks were placed on plates containing either vancomycin (8 µg/ml) or oxacillin (8 µg/ml for MI-VRSA, NY-VRSA, and VRSA-5 and 2 µg/ml for PA-VRSA) or no antibiotic and were inoculated with the VRSA strains. After incubation for 24 h at 30°C or 37°C, the inhibition zone diameters were measured. Disks containing glycopeptides and oxacillin were also deposited on plates inoculated with each strain at distances corresponding approximately to the sum of the radii of the inhibition zones of the drugs when tested alone, and the patterns obtained were analyzed after overnight incubation at 30°C or 37°C (23). Vancomycin and oxacillin MICs were determined at 30°C and 37°C by E-test on BHI agar or on agar containing oxacillin (8 µg/ml, except for PA-VRSA, which received 2 µg/ml) or vancomycin (8 µg/ml).
(ii) Checkerboard.
Combinations of glycopeptides and oxacillin were tested by the checkerboard method against the four VRSA isolates in BHI broth. The concentration of glycopeptides and oxacillin ranged from 0.25 µg/ml to 1x MIC and from 0.06 µg/ml to 1x MIC, respectively. The final inoculum was approximately 107 CFU/ml. Incubations were performed at 30°C and 37°C for 24 h in a final volume of 2 ml. The fractional inhibitory concentration (FIC) index for each antibiotic in every combination was calculated with the following equation: FIC of drug A (vancomycin or teicoplanin) + FIC of drug B (oxacillin) = (MIC of drug A in combination with oxacillin/MIC of drug A alone) + (MIC of oxacillin in combination with drug A/MIC of oxacillin). Synergism was defined as an FIC index of
0.5, indifference as an FIC index between 0.5 and 2, and antagonism as an FIC index of >2 (23).
(iii) Time-kill curves. Time-kill curves were determined for every strain with an inoculum of 107 CFU/ml and antibiotic concentrations following a double-fold dilution from 1/2x to 1/64x MIC (from 1 to 32 µg/ml for glycopeptides and from 0.5 to 32 µg/ml for oxacillin). Bacterial counts were taken at 0, 3, 4, 5, 6, and 24 h by plating 0.1-ml aliquots (diluted or undiluted) onto BHI agar. The plates were incubated for 24 h at 30°C or 37°C. Bactericidal activity was defined as a reduction of at least 1,000-fold in the bacterial counts relative to the inoculum.
|
|
|---|
![]() View larger version (40K): [in a new window] |
FIG. 2. Analysis of SmaI-digested genomic DNA of VanA-type S. aureus NY-VRSA and VRSA-5. Bacteriophage concatemers were used as molecular size markers (Biolabs), and the sizes are indicated at the left.
|
Sequencing of the PCR product obtained with the P11-P12 primers and total DNA of NY-VRSA as a template revealed the presence of a copy of IS1251 (1,499 bp) (14) inserted in the vanS-vanH intergenic region at the same position (position 5820 of Tn1546), in the same orientation, and flanked by the same ATAATTTT 8-bp duplication of target DNA as in PA-VRSA (Fig. 1) (8).
To determine the sequence upstream from the P9 primer located in orf2, fragments obtained by digestion of total NY-VRSA DNA with HinCII were cloned in pUC18, and the recombinant plasmids were subjected to PCR amplification using M13 reverse sequencing and the P6 primers. A fragment of 1,749 bp was obtained, and its sequence was determined. An open reading frame of 809 bp, corresponding to IS1216V (13), was found, but it was in opposite orientation relative to the transposon (Fig. 1). This insertion sequence is also present in PA-VRSA but at a different position. A 184-bp sequence, corresponding to a fragment of orf2 including the portion complementary to the P6 primer, was found downstream from IS1216V, whereas 756 bp without significant homology with known sequences were present upstream from IS1216V. The presence of this unknown sequence in NY-VRSA was confirmed by PCR using a primer (NY-3, 5'TCTCTGCAACTGGAATGCCT) specific for the 756-bp fragment and P6. The sequence downstream from vanZ was determined by inverse PCR. Total DNA of NY-VRSA was digested with HpaI, the resulting fragments were ligated with T4 DNA ligase, and inverse PCR was performed using primers Z1 (5'AAGCTAGCAATCCTCTAGA) and Z2 (5'AGTGCTGAGGAATTGGTCT) (Fig. 1). A 700-bp fragment, with no homology with known sequences, was obtained. The presence of the latter sequence in NY-VRSA was also confirmed by PCR with a primer (NY-5, 5'GTAATTACATTGTACGCT) specific for the 700-bp fragment and Z2 (Fig. 1).
Expression of the vanA gene cluster in NY-VRSA and VRSA-5. The cytoplasmic peptidoglycan precursors of S. aureus NY-VRSA and VRSA-5 grown with 4 µg/ml of vancomycin or teicoplanin or without antibiotic were analyzed as described previously (19, 22). The late precursors synthesized by NY-VRSA and VRSA-5 were qualitatively similar to those of MI-VRSA and PA-VRSA, but the relative proportions obtained with NY-VRSA were slightly different from those found with the three other strains after induction with vancomycin (22). Although the relative proportions of peptidoglycan precursors synthesized by PA-VRSA and NY-VRSA differed, both strains exhibited a similar low level of resistance to glycopeptides (Table 1). Thus, a smaller proportion of precursors ending in D-Lac are synthesized by NY-VRSA in the presence of vancomycin, in comparison with that of PA-VRSA as well as those of the two other MRSA strains (22), is not reflected in the level of resistance to glycopeptides. As already reported for PA-VRSA (22), low-level resistance of NY-VRSA could be related to loss, at a high frequency, of the van operon (see below).
|
View this table: [in a new window] |
TABLE 1. Cytoplasmic peptidoglycan precursors and D,D-peptidase (VanX and VanY) activities in extracts from NY-VRSA and VRSA-5 strainsa
|
Analysis of the vanA gene cluster, of the peptidoglycan precursors, and of the VanX and VanY activities associated with glycopeptide resistance indicated that the vanA operon was fully functional in both strains. Thus, the difference in phenotypic expression of glycopeptide resistance in the two isolates cannot be accounted for by differences in the expression of the resistance genes.
Stability of glycopeptide resistance. Inheritance of the vanA operon in NY-VRSA and VRSA-5 was tested by replica plating. NY-VRSA derivatives susceptible to vancomycin (MIC, 2 µg/ml) were obtained in three independent experiments at high frequencies, ranging from 45% to 48%, similar to those observed with PA-VRSA (22), whereas a single glycopeptide-susceptible clone (0.3%) was obtained with VRSA-5. Amplification of the vanA gene with specific primers was positive for parental NY-VRSA and VRSA-5 and negative for susceptible derivatives (24 and 1 colonies tested, respectively). Loss of glycopeptide resistance in VRSA-5 at very low frequency could be due to transposon or plasmid instability, whereas loss of resistance at a high rate in NY-VRSA is most likely due to plasmid segregation by inefficient replication. The Tn1546-like element in the latter strain has been stabilized by deletion of orf1 and part of orf2 that are required for the movements of the element. The apparent glycopeptide phenotypic susceptibility of two of the VanA-type MRSA strains, PA-VRSA and NY-VRSA, represents a significant public health problem; since resistance is inducible, it can confidently be predicted that treatment of an infection due to such a strain with vancomycin or teicoplanin will lead to clinical failure. In addition, lack of detection will delay implementation of the required hygiene measures to avoid spread of these isolates.
Inducibility of vancomycin resistance. Inducibility of resistance in NY-VRSA and VRSA-5 was studied in liquid medium. After overnight culture at 37°C in BHI with or without vancomycin (6 µg/ml), growth of a subculture in the presence of vancomycin resulted in a long lag phase of at least 8 h for NY-VRSA that was not observed with VRSA-5 (Fig. 3).
![]() View larger version (26K): [in a new window] |
FIG. 3. Growth of S. aureus NY-VRSA (A) and VRSA-5 (B) in the absence (VAN 0) or in the presence of 6 µg/ml vancomycin (VAN 6) after overnight culture with or without vancomycin (6 µg/ml). The lines indicate ratio of the vancomycin (VAN) concentration in the overnight culture/vancomycin concentration in the culture medium.
|
Oxacillin-glycopeptide synergism. Marked synergy between oxacillin and vancomycin has been reported for MRSA COLVA, a derivative of strain COL harboring a vanA-bearing staphylococcal plasmid (27). Laboratory strain COL does not contain any chromosome- or plasmid-borne regulatory gene that controls transcription of the methicillin resistance structural mecA gene for PBP2a in most clinical isolates (35). It was therefore of interest to test if synergy between glycopeptide and ß-lactam-resistant strains occurs in all the available VanA-type MRSA strains. Several in vitro techniques, such as checkerboard, time-kill curve, E-test, and double disk diffusion, have been described to study the synergism between antibiotics. However, the results obtained by the first two methods were not always consistent (18). Thus, the activity of combinations of glycopeptides and oxacillin against the four VRSA isolates was tested by the four methods and, in each case, in three independent experiments.
Drug interaction was first assessed by placing a vancomycin disk or an E-test strip on agar containing oxacillin at a subinhibitory concentration (8 µg/ml for MI-VRSA, NY-VRSA, and VRSA-5 and 2 µg/ml for PA-VRSA) inoculated with a VRSA strain. After incubation at 37°C, a major size increase of the inhibition zone around the vancomycin disk was observed (Fig. 4, left column), and a decrease in vancomycin resistance of more than 128 times was observed by E-test (Fig. 4, right column; Table 2). Similar results were obtained with teicoplanin (data not shown). In the reverse experiment, a major decrease in resistance to oxacillin (>128 times) was observed when an E-test strip was laid onto BHI agar containing glycopeptide concentrations easily achievable in patients (vancomycin, 8 µg/ml [Fig. 4, right column; Table 2]; teicoplanin, 8 µg/ml [data not shown]). Synergism was also demonstrated when disks impregnated with glycopeptides or oxacillin were placed at an appropriate distance (23); enhancement at the junction of the inhibition zones was observed with the four strains (Fig. 5).
![]() View larger version (103K): [in a new window] |
FIG. 4. Oxacillin-glycopeptide synergism against VRSA-5 as tested by (left) disk diffusion and (right) E-test. Top panel, BHI agar; middle panel, BHI plus oxacillin (8 µg/ml); bottom panel, BHI plus vancomycin (8 µg/ml). OXA, oxacillin (5 µg); VAN, vancomycin (30 µg); TEC, teicoplanin (30 µg); PEN, penicillin (6 µg); ERY, erythromycin (15 µg); SPT, spectinomycin (100 µg).
|
|
View this table: [in a new window] |
TABLE 2. MICs of vancomycin and oxacillin for VRSA strains determined by E-test
|
![]() View larger version (56K): [in a new window] |
FIG. 5. Oxacillin-glycopeptide synergism in VRSA tested by disk diffusion. OXA, oxacillin (5 µg); VAN, vancomycin (30 µg); TEC, teicoplanin (30 µg). The name of the strain is indicated above the assay.
|
Synergistic activity of vancomycin (Fig. 6) or teicoplanin (data not shown) and oxacillin was then studied by the checkerboard technique. The FIC indexes ranged from 0.008 to 0.024 (synergism is defined as a FIC index of
0.5). A bacteriostatic synergism was observed for vancomycin and oxacillin concentrations equal to or greater than 4 µg/ml for the LLR strains and 8 µg/ml for the HLR strains, concentrations that are easily achievable in the sera of patients. Curiously, and in contrast with our data, lack of synergism was observed for strain MI-VRSA by the checkerboard technique when performed on solid medium (16).
![]() View larger version (13K): [in a new window] |
FIG. 6. Study of vancomycin and oxacillin combinations by the checkerboard method. Isobolograms plotted on an arithmetic scale indicate synergism between the antibiotics.
|
2 µg/ml for LLR strains and
8 µg/ml for HLR strains) with oxacillin (
2 µg/ml for LLR strains and
8 µg/ml for HLR strains) (Table 3). The antibiotic concentrations that had a synergistic effect are achievable in therapy, and higher concentrations did not lead to an increase in the bactericidal effect.
![]() View larger version (16K): [in a new window] |
FIG. 7. Time-kill curves for NY-VRSA and VRSA-5 strains. OXA, oxacillin; VAN, vancomycin.
|
|
View this table: [in a new window] |
TABLE 3. Bactericidal activity of combinations of vancomycin and oxacillin against NY-VRSA and VRSA-5 strains
|
Effect of growth conditions on methicillin resistance expression. Expression of methicillin resistance in S. aureus depends on environmental factors such as temperature and osmolarity (4). Determination of MICs and all synergy experiments were repeated at 30°C and/or by incorporating NaCl into the growth medium. As previously reported, better phenotypic expression of oxacillin resistance was observed at 30°C or after addition of NaCl (4%) (data not shown) to the culture medium. Vancomycin resistance was not affected at 30°C and was weakly reduced (by 1 dilution) when NaCl was added. Synergism studies by the time-kill and checkerboard methods gave results at 30°C similar to those at 37°C (data not shown). However, detection of the synergy by disk diffusion at 30°C was less obvious (data not shown).
Strong synergistic activity of glycopeptides and oxacillin, when associated, was consistently observed against the four clinical isolates. PBP2a has transpeptidase activity and exhibits low affinity for all ß-lactams. High-level resistance to methicillin in MRSA requires the cooperativity of PBP2a and PBP2 (24, 25), which is a bifunctional S. aureus PBP with both transpeptidase and transglycosylase activities (21). In the presence of ß-lactam in the culture medium, the cooperation between the transpeptidase activity of PBP2a and the penicillin-insensitive transglycosylase activity of PBP2 appears essential for growth and cell wall biosynthesis (24). PBP2 is required for expression of high-level vancomycin resistance in the COLVA strain (28). In order to account for the loss of oxacillin resistance in the presence of sub-MIC concentrations of vancomycin in this strain, it has been proposed that the pentadepsipeptide cell wall precursors are not substrates for PBP2A, which is the transpeptidase that remains active in the presence of oxacillin (27). Our data indicate that this apparently holds true for the MI-VRSA, PA-VRSA, and VRSA-5 strains that synthesize large amounts of pentadepsipeptide precursors in the presence of glycopeptides in the culture medium (Table 1) (22). In NY-VRSA exhibiting a low level of resistance to vancomycin for a VanA-type strain, the dramatic consequences on cell survival of addition of a glycopeptide and of oxacillin to the growth medium could be the consequence of two phenomena: PBP2a cannot process late peptidoglycan precursors ending in D-Ala-D-Lac, and the binding of vancomycin to the remaining (ca. 20%) precursors terminating in D-Ala-D-Ala prevents the transglycosylation reaction. It has also been demonstrated that vancomycin could (i) induce a decrease in transcription of PBP2A and (ii) be associated with inactivation or deletion of the mecA gene (1, 29, 30).
Our data confirm efficient heterologous expression of the glycopeptide resistance genes from enterococci in S. aureus. They also suggest, most surprisingly, that combination of a glycopeptide with a ß-lactam might be useful for the treatment of infections due to VanA-type MRSA strains that are resistant to both low and high levels of both drug classes. However, this hypothesis remains to be confirmed in vivo in an animal model.
Published ahead of print on 5 September 2006. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»