Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2006, p. 3953-3955, Vol. 50, No. 11
0066-4804/06/$08.00+0 doi:10.1128/AAC.00915-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Prevalence in the United States of aac(6')-Ib-cr Encoding a Ciprofloxacin-Modifying Enzyme
Chi Hye Park,1
Ari Robicsek,2
George A. Jacoby,3
Daniel Sahm,4 and
David C. Hooper1*
Massachusetts General Hospital, Boston, Massachusetts,1
Evanston Northwestern Healthcare, Evanston, Illinois,2
Lahey Clinic, Burlington, Massachusetts,3
Focus BioInova, Herndon, Virginia4
Received 24 July 2006/
Returned for modification 13 August 2006/
Accepted 24 August 2006

ABSTRACT
Among 313
Enterobacteriaceae from the United States with a ciprofloxacin
MIC of

0.25 µg/ml and reduced susceptibility to ceftazidime,
aac(6'
)-Ib was present in 50.5% of isolates, and of these, 28%
carried the
cr variant responsible for low-level ciprofloxacin
resistance.
aac(6'
)-Ib-cr was geographically widespread, stable
over time, most common in
Escherichia coli, equally prevalent
in ciprofloxacin-susceptible and -resistant strains, and not
associated with
qnr genes.

TEXT
Quinolone resistance is traditionally mediated by chromosomal
mutations in bacterial topoisomerase genes, genes regulating
expression of efflux pumps, or both (
4,
5). In addition,
qnr genes responsible for plasmid-borne quinolone resistance have
been found in clinical isolates of
Enterobacteriaceae (
7). These
genes encode pentapeptide repeat proteins that block the action
of ciprofloxacin on bacterial DNA gyrase and topoisomerase IV
(
11). Recently, a new mechanism of transferable quinolone resistance
was reported: enzymatic inactivation of certain quinolones.
The
cr variant of
aac(6'
)-Ib encodes an aminoglycoside acetyltransferase
that confers reduced susceptibility to ciprofloxacin by
N-acetylation
of its piperazinyl amine (
9). Aac(6')-Ib-cr has two amino acid
changes, Trp102Arg and Asp179Tyr, which together are necessary
and sufficient for the enzyme's ability to acetylate ciprofloxacin.
When both
qnrA and
aac(6'
)-Ib-cr are present in the same cell,
the level of resistance is increased fourfold more than that
conferred by
qnrA alone, with an MIC of ciprofloxacin of 1.0
µg/ml, a value near the clinical breakpoint for susceptibility.
In addition, the presence of
aac(6'
)-Ib-cr alone increased substantially
the frequency of selection of chromosomal mutants upon exposure
to ciprofloxacin (
9).
The three known qnr genes, qnrA, qnrB (6), and qnrS (3), and their variants have widely penetrated clinical isolates of Enterobacteriaceae from the United States and are present in a substantial minority of ceftazidime-resistant organisms (10). Among clinical Escherichia coli isolates collected in Shanghai, China, in 2000 to 2001, 51% had the cr variant of aac(6')-Ib (9). No previous survey, however, has evaluated clinical isolates in the United States for the presence of aac(6')-Ib-cr.
Test isolates were drawn from the Focus Diagnostics collection of Enterobacteriaceae from the years 1999, 2000, 2001, and 2004. This same strain set was previously surveyed for qnr genes (10), allowing a direct comparison of the distribution of qnr genes and aac(6')-Ib-cr. No isolates were available from 2003, and only an incomplete set was available from 2002. Between January and March of each study year, participating clinical microbiology laboratories from each of the nine continental U.S. census regions provided 6,979 nonrepeat clinical isolates of requested enterobacterial genera without regard to antibiotic resistance phenotype. All Klebsiella pneumoniae, Enterobacter, and E. coli isolates with a ceftazidime MIC of
16 µg/ml and a ciprofloxacin MIC of
0.25 µg/ml were selected from this collection for study. Of 323 such isolates, 313 (97%) were available. Thirty-one (29%) of 106 K. pneumoniae isolates, 54 (34%) of 160 Enterobacter isolates, and none of 47 (0%) E. coli isolates were ciprofloxacin susceptible (MIC
1.0 µg/ml).
aac(6')-Ib was amplified by PCR with primers 5'-TTGCGATGCTCTATGAGTGGCTA and 5'-CTCGAATGCCTGGCGTGTTT to produce a 482-bp product. Primers were chosen to amplify all known aac(6')-Ib variants. PCR conditions were 94°C for 45 s, 55°C for 45 s, and 72°C for 45 s for 34 cycles. Strains positive and negative for aac(6')-Ib were included as controls. All positives were further analyzed by digestion with BstF5I (New England Biolabs, Ipswich, MA) and/or direct sequencing of the PCR products with primer 5' CGTCACTCCATACATTGCAA to identify aac(6')-Ib-cr, which lacks the BstF5I restriction site present in the wild-type gene. Screening for qnrA, qnrB, and qnrS was carried out by multiplex PCR amplification as previously described (10).
MICs were determined by a broth microdilution method for ceftazidime, ciprofloxacin, trimethoprim-sulfamethoxazole, and gentamicin. Susceptibility interpretations were defined according to the Clinical and Laboratory Standards Institute (2). Statistical analysis used SPSS 14.0 software package (SPSS, Chicago, IL). A Mantel-Haenszel
2 test was used for the comparison of dichotomous variables and trend analysis.
aac(6')-Ib-cr was detected in 15 (32%) of 47 E. coli isolates, 17 (16%) of 106 K. pneumoniae isolates, and 12 (7.5%) of 160 Enterobacter isolates collected during the study period (Table 1). There was no statistically significant change in the overall prevalence of aac(6')-Ib-cr over time, although aac(6')-Ib-cr was detected in a slightly smaller proportion of isolates in 2004 than in the prior years studied.
The Middle Atlantic region provided the largest number of isolates
meeting inclusion criteria and the largest number of
aac(6'
)-Ib-cr-positive
K. pneumoniae and
E. coli isolates (Table
2). The Pacific region
had the highest prevalence of
aac(6'
)-Ib-cr (22%) overall, but
aac(6'
)-Ib-cr-positive isolates of
K. pneumoniae were found
in all but three census regions, and isolates of
Enterobacter and
E. coli were found in all but four. Overall, there was no
geographic clustering of
aac(6'
)-Ib-cr, but in comparison to
other regions, the prevalence of
Enterobacter isolates was higher
in New England (4/14, 29% versus 8/146, 5.5%) (
P = 0.005), and
the prevalence of
E. coli was higher in the Pacific region (5/7,
72% versus 10/40, 25%) (
P = 0.03).
There was no relationship between
aac(6'
)-Ib-cr prevalence and
patient age, patient gender, or inpatient status. There was
also no relationship between the presence of
qnrA, -
B, or -
S genes and
aac(6'
)-Ib-cr. qnr genes were present in 7 of 44 (15.9%)
aac(6'
)-Ib-cr-positive strains compared to 66 of 269 (24.5%)
aac(6'
)-Ib-cr-negative strains (
P = 0.26 by a two-tailed Fisher's
exact test), indicating that the
qnr genes and
aac(6'
)-Ib-cr can circulate independently (Table
3).
We analyzed the relationship between
aac(6'
)-Ib-cr and susceptibility
to ciprofloxacin, gentamicin, and trimethoprim-sulfamethoxazole.
Among all isolates, the
aac(6'
)-Ib-cr allele was present in
almost equal proportions of ciprofloxacin-susceptible (MIC,
0.25 to 1.0 µg/ml) and -resistant (MIC

2.0 µg/ml)
isolates, and neither ciprofloxacin nor trimethoprim-sulfamethoxazole
resistance was associated with
aac(6'
)-Ib-cr prevalence. In
E. coli isolates, however, the risk of harboring
aac(6'
)-Ib-cr was significantly associated with gentamicin resistance (odds
ratio, 5.78; 95% confidence interval, 1.1 to 29.6). Thirteen
(42%) of 31 gentamicin-resistant isolates harbored
aac(6'
)-Ib-cr,
in contrast to 2 (12%) of 16 gentamicin-susceptible isolates
(Table
3), an unexpected association since
aac(6'
)-Ib-cr confers
resistance to kanamycin but not to gentamicin (
10).
Among ceftazidime-nonsusceptible enteric bacteria collected between 2000 and 2004 from across the United States, the prevalence of aac(6')-Ib-cr was 44/313 (14%). The distribution of this variant, however, differed among species. It was detected most often in E. coli isolates, next most often in K. pneumoniae isolates, and least often in Enterobacter isolates (Table 1), a relative prevalence that is the reverse of that for the qnr genes (12). The reason for these differences is not yet understood, since it is known that some plasmids can carry both aac(6')-Ib-cr and qnrA (10).
The most striking finding of our study was the wide penetration of the aac(6')-Ib-cr allele. In nearly one-third of cases in which an allele of aac(6')-Ib was identified, it was the cr variant. Although this variant gene was not reported until 2006, it was already present in more than half of multidrug-resistant E. coli isolates in Shanghai, China, in 2000 to 2001 (13), and it is now present in the majority of census regions of the United States. The various antibiograms and the range of species of the isolates studied suggest that the dissemination of aac(6')-Ib-cr does not occur through clonal spread or the spread of a single plasmid. The diversity of plasmids on which this gene circulates is not yet known, but its presence as part of an integron cassette (1, 9) suggests that it could be widely mobile among plasmids.
Our analysis also indicated that there was no association between the aac(6')-Ib-cr gene and qnr genes. This result is consistent with our previous results showing that E. coli strains from Shanghai carrying aac(6')-Ib-cr are substantially more prevalent than those carrying qnrA, although a few strains carried both genes on plasmids that transferred higher levels of quinolone resistance than plasmids carrying either gene alone (9, 13).
The overall proportion of isolates harboring aac(6')-Ib-cr was stable over time. Although the cr variant of aac(6')-Ib encodes an enzyme that had slightly reduced efficiency in acetylation of kanamycin (9), it is not yet known whether there are any additional biological costs of this variant over other variants of aac(6')-Ib. Selection pressures from the use of aminoglycosides that are enzyme substrates (kanamycin, tobramycin, and amikacin) and the use of quinolones with a piperazinyl amine that is subject to N-acetylation by the cr variant enzyme would be predicted to promote gene prevalence but have not yet been studied in clinical settings. It is interesting to speculate that future shifts in the choice of quinolones used to those that are not substrates for Aac(6')-Ib-cr might reduce selection pressures for this variant but not for the qnr genes.

ACKNOWLEDGMENTS
This work was supported in part by grants AI57576 (to D.C.H.)
and AI43312 (to G.A.J.) from the National Institutes of Health,
U.S. Public Health Service.

FOOTNOTES
* Corresponding author. Mailing address: Division of Infectious Diseases, Massachusetts General Hospital, 55 Fruit Street, Boston, MA 02114-2696. Phone: (617) 643-3856. Fax: (617) 726-7416. E-mail:
dhooper{at}partners.org.

Published ahead of print on 5 September 2006. 

REFERENCES
1 - Casin, I., F. Bordon, P. Bertin, A. Coutrot, I. Podglajen, R. Brasseur, and E. Collatz. 1998. Aminoglycoside 6'-N-acetyltransferase variants of the Ib type with altered substrate profile in clinical isolates of Enterobacter cloacae and Citrobacter freundii. Antimicrob. Agents Chemother. 42:209-215.[Abstract/Free Full Text]
2 - Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial susceptibility testing; 15th informational supplement. CLSI/NCCLS M100-S15. Clinical and Laboratory Standards Institute, Wayne, Pa.
3 - Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K. Sakae. 2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:801-803.[Abstract/Free Full Text]
4 - Hooper, D. C. 1999. Mechanisms of quinolone resistance. Drug Resist. Updates 2:38-55.[CrossRef][Medline]
5 - Hooper, D. C. 2000. Mechanisms of action and resistance of older and newer fluoroquinolones. Clin. Infect. Dis. 31:S24-S28.
6 - Jacoby, G. A., K. E. Walsh, D. M. Mills, V. J. Walker, H. Oh, A. Robicsek, and D. C. Hooper. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178-1182.[Abstract/Free Full Text]
7 - Martínez-Martínez, L., A. Pascual, and G. A. Jacoby. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797-799.[CrossRef][Medline]
8 - Nordmann, P., and L. Poirel. 2005. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 56:463-469.[Abstract/Free Full Text]
9 - Robicsek, A., J. Strahilevitz, G. A. Jacoby, M. Macielag, D. Abbanat, K. Bush, and D. C. Hooper. 2006. Fluoroquinolone modifying enzyme: a novel adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 12:83-88.[CrossRef][Medline]
10 - Robicsek, A., J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 50:2872-2874.[Abstract/Free Full Text]
11 - Tran, J. H., and G. A. Jacoby. 2002. Mechanism of plasmid-mediated quinolone resistance. Proc. Natl. Acad. Sci. USA 99:5638-5642.[Abstract/Free Full Text]
12 - Wang, M., D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2004. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob. Agents Chemother. 48:1295-1299.[Abstract/Free Full Text]
13 - Wang, M., J. H. Tran, G. A. Jacoby, Y. Zhang, F. Wang, and D. C. Hooper. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47:2242-2248.[Abstract/Free Full Text]
Antimicrobial Agents and Chemotherapy, November 2006, p. 3953-3955, Vol. 50, No. 11
0066-4804/06/$08.00+0 doi:10.1128/AAC.00915-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Sidjabat, H. E., Paterson, D. L., Adams-Haduch, J. M., Ewan, L., Pasculle, A. W., Muto, C. A., Tian, G.-B., Doi, Y.
(2009). Molecular Epidemiology of CTX-M-Producing Escherichia coli Isolates at a Tertiary Medical Center in Western Pennsylvania. Antimicrob. Agents Chemother.
53: 4733-4739
[Abstract]
[Full Text]
-
Lister, P. D., Wolter, D. J., Hanson, N. D.
(2009). Antibacterial-Resistant Pseudomonas aeruginosa: Clinical Impact and Complex Regulation of Chromosomally Encoded Resistance Mechanisms. Clin. Microbiol. Rev.
22: 582-610
[Abstract]
[Full Text]
-
Strahilevitz, J., Jacoby, G. A., Hooper, D. C., Robicsek, A.
(2009). Plasmid-Mediated Quinolone Resistance: a Multifaceted Threat. Clin. Microbiol. Rev.
22: 664-689
[Abstract]
[Full Text]
-
Dionisi, A. M., Lucarelli, C., Owczarek, S., Luzzi, I., Villa, L.
(2009). Characterization of the Plasmid-Borne Quinolone Resistance Gene qnrB19 in Salmonella enterica Serovar Typhimurium. Antimicrob. Agents Chemother.
53: 4019-4021
[Abstract]
[Full Text]
-
Gunell, M., Webber, M. A., Kotilainen, P., Lilly, A. J., Caddick, J. M., Jalava, J., Huovinen, P., Siitonen, A., Hakanen, A. J., Piddock, L. J. V.
(2009). Mechanisms of Resistance in Nontyphoidal Salmonella enterica Strains Exhibiting a Nonclassical Quinolone Resistance Phenotype. Antimicrob. Agents Chemother.
53: 3832-3836
[Abstract]
[Full Text]
-
Bratu, S., Landman, D., George, A., Salvani, J., Quale, J.
(2009). Correlation of the expression of acrB and the regulatory genes marA, soxS and ramA with antimicrobial resistance in clinical isolates of Klebsiella pneumoniae endemic to New York City. J Antimicrob Chemother
64: 278-283
[Abstract]
[Full Text]
-
Radhouani, H., Poeta, P., Igrejas, G., Goncalves, A., Vinue, L., Torres, C.
(2009). Antimicrobial resistance and phylogenetic groups in isolates of Escherichia coli from seagulls at the Berlengas nature reserve. Vet Rec.
165: 138-142
[Abstract]
[Full Text]
-
Gonzalez-Lopez, J. J., Coelho, A., Larrosa, M. N., Lavilla, S., Bartolome, R., Prats, G.
(2009). First Detection of Plasmid-Encoded blaOXY {beta}-Lactamase. Antimicrob. Agents Chemother.
53: 3143-3146
[Abstract]
[Full Text]
-
Cano, M. E., Rodriguez-Martinez, J. M., Aguero, J., Pascual, A., Calvo, J., Garcia-Lobo, J. M., Velasco, C., Francia, M. V., Martinez-Martinez, L.
(2009). Detection of Plasmid-Mediated Quinolone Resistance Genes in Clinical Isolates of Enterobacter spp. in Spain. J. Clin. Microbiol.
47: 2033-2039
[Abstract]
[Full Text]
-
Cerquetti, M., Garcia-Fernandez, A., Giufre, M., Fortini, D., Accogli, M., Graziani, C., Luzzi, I., Caprioli, A., Carattoli, A.
(2009). First Report of Plasmid-Mediated Quinolone Resistance Determinant qnrS1 in an Escherichia coli Strain of Animal Origin in Italy. Antimicrob. Agents Chemother.
53: 3112-3114
[Abstract]
[Full Text]
-
Kim, E. S., Jeong, J.-Y., Jun, J.-B., Choi, S.-H., Lee, S.-O., Kim, M.-N., Woo, J. H., Kim, Y. S.
(2009). Prevalence of aac(6')-Ib-cr Encoding a Ciprofloxacin-Modifying Enzyme among Enterobacteriaceae Blood Isolates in Korea. Antimicrob. Agents Chemother.
53: 2643-2645
[Abstract]
[Full Text]
-
Pu, X.-Y., Pan, J.-C., Wang, H.-Q., Zhang, W., Huang, Z.-C., Gu, Y.-M.
(2009). Characterization of fluoroquinolone-resistant Shigella flexneri in Hangzhou area of China. J Antimicrob Chemother
63: 917-920
[Abstract]
[Full Text]
-
Sjolund-Karlsson, M., Folster, J. P., Pecic, G., Joyce, K., Medalla, F., Rickert, R., Whichard, J. M.
(2009). Emergence of Plasmid-Mediated Quinolone Resistance among Non-Typhi Salmonella enterica Isolates from Humans in the United States. Antimicrob. Agents Chemother.
53: 2142-2144
[Abstract]
[Full Text]
-
Jacoby, G. A., Gacharna, N., Black, T. A., Miller, G. H., Hooper, D. C.
(2009). Temporal Appearance of Plasmid-Mediated Quinolone Resistance Genes. Antimicrob. Agents Chemother.
53: 1665-1666
[Abstract]
[Full Text]
-
Merens, A., Matrat, S., Aubry, A., Lascols, C., Jarlier, V., Soussy, C.-J., Cavallo, J.-D., Cambau, E.
(2009). The Pentapeptide Repeat Proteins MfpAMt and QnrB4 Exhibit Opposite Effects on DNA Gyrase Catalytic Reactions and on the Ternary Gyrase-DNA-Quinolone Complex. J. Bacteriol.
191: 1587-1594
[Abstract]
[Full Text]
-
Warburg, G., Korem, M., Robicsek, A., Engelstein, D., Moses, A. E., Block, C., Strahilevitz, J.
(2009). Changes in aac(6')-Ib-cr Prevalence and Fluoroquinolone Resistance in Nosocomial Isolates of Escherichia coli Collected from 1991 through 2005. Antimicrob. Agents Chemother.
53: 1268-1270
[Abstract]
[Full Text]
-
Ma, J., Zeng, Z., Chen, Z., Xu, X., Wang, X., Deng, Y., Lu, D., Huang, L., Zhang, Y., Liu, J., Wang, M.
(2009). High Prevalence of Plasmid-Mediated Quinolone Resistance Determinants qnr, aac(6')-Ib-cr, and qepA among Ceftiofur-Resistant Enterobacteriaceae Isolates from Companion and Food-Producing Animals. Antimicrob. Agents Chemother.
53: 519-524
[Abstract]
[Full Text]
-
Garcia-Fernandez, A., Fortini, D., Veldman, K., Mevius, D., Carattoli, A.
(2009). Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella. J Antimicrob Chemother
63: 274-281
[Abstract]
[Full Text]
-
Kim, H. B., Park, C. H., Kim, C. J., Kim, E.-C., Jacoby, G. A., Hooper, D. C.
(2009). Prevalence of Plasmid-Mediated Quinolone Resistance Determinants over a 9-Year Period. Antimicrob. Agents Chemother.
53: 639-645
[Abstract]
[Full Text]
-
Park, Y.-J., Yu, J. K., Kim, S.-I., Lee, K., Arakawa, Y.
(2009). Accumulation of Plasmid-Mediated Fluoroquinolone Resistance Genes, qepA and qnrS1, in Enterobacter aerogenes Co-producing RmtB and Class A {beta}-lactamase LAP-1. Annals of Clinical & Laboratory Science
39: 55-59
[Abstract]
[Full Text]
-
Cui, S., Li, J., Sun, Z., Hu, C., Jin, S., Li, F., Guo, Y., Ran, L., Ma, Y.
(2009). Characterization of Salmonella enterica isolates from infants and toddlers in Wuhan, China. J Antimicrob Chemother
63: 87-94
[Abstract]
[Full Text]
-
Morgan-Linnell, S. K., Becnel Boyd, L., Steffen, D., Zechiedrich, L.
(2009). Mechanisms Accounting for Fluoroquinolone Resistance in Escherichia coli Clinical Isolates. Antimicrob. Agents Chemother.
53: 235-241
[Abstract]
[Full Text]
-
Sabtcheva, S., Kaku, M., Saga, T., Ishii, Y., Kantardjiev, T.
(2009). High Prevalence of the aac(6')-Ib-cr Gene and Its Dissemination among Enterobacteriaceae Isolates by CTX-M-15 Plasmids in Bulgaria. Antimicrob. Agents Chemother.
53: 335-336
[Full Text]
-
Jones, G. Ll., Warren, R. E., Skidmore, S. J., Davies, V. A., Gibreel, T., Upton, M.
(2008). Prevalence and distribution of plasmid-mediated quinolone resistance genes in clinical isolates of Escherichia coli lacking extended-spectrum {beta}-lactamases. J Antimicrob Chemother
62: 1245-1251
[Abstract]
[Full Text]
-
Yang, H., Chen, H., Yang, Q., Chen, M., Wang, H.
(2008). High Prevalence of Plasmid-Mediated Quinolone Resistance Genes qnr and aac(6')-Ib-cr in Clinical Isolates of Enterobacteriaceae from Nine Teaching Hospitals in China. Antimicrob. Agents Chemother.
52: 4268-4273
[Abstract]
[Full Text]
-
Shi, W., Qin, J., Mi, Z.
(2008). A Klebsiella pneumoniae sputum culture isolate from China carrying blaOXA-1, blaCTX-M-55 and aac(6')-Ib-cr. J Med Microbiol
57: 1588-1589
[Full Text]
-
Adams-Haduch, J. M., Paterson, D. L., Sidjabat, H. E., Pasculle, A. W., Potoski, B. A., Muto, C. A., Harrison, L. H., Doi, Y.
(2008). Genetic Basis of Multidrug Resistance in Acinetobacter baumannii Clinical Isolates at a Tertiary Medical Center in Pennsylvania. Antimicrob. Agents Chemother.
52: 3837-3843
[Abstract]
[Full Text]
-
Jung, C. M., Heinze, T. M., Deck, J., Strakosha, R., Sutherland, J. B.
(2008). Transformation of N-Phenylpiperazine by Mixed Cultures from a Municipal Wastewater Treatment Plant. Appl. Environ. Microbiol.
74: 6147-6150
[Abstract]
[Full Text]
-
Szabo, D., Kocsis, B., Rokusz, L., Szentandrassy, J., Katona, K., Kristof, K., Nagy, K.
(2008). First detection of plasmid-mediated, quinolone resistance determinants qnrA, qnrB, qnrS and aac(6')-Ib-cr in extended-spectrum {beta}-lactamase (ESBL)-producing Enterobacteriaceae in Budapest, Hungary. J Antimicrob Chemother
62: 630-632
[Full Text]
-
Rice, L. B., Carias, L. L., Hutton, R. A., Rudin, S. D., Endimiani, A., Bonomo, R. A.
(2008). The KQ Element, a Complex Genetic Region Conferring Transferable Resistance to Carbapenems, Aminoglycosides, and Fluoroquinolones in Klebsiella pneumoniae. Antimicrob. Agents Chemother.
52: 3427-3429
[Abstract]
[Full Text]
-
Hawkey, P. M.
(2008). The growing burden of antimicrobial resistance. J Antimicrob Chemother
62: i1-i9
[Abstract]
[Full Text]
-
Liu, J.-H., Deng, Y.-T., Zeng, Z.-L., Gao, J.-H., Chen, L., Arakawa, Y., Chen, Z.-L.
(2008). Coprevalence of Plasmid-Mediated Quinolone Resistance Determinants QepA, Qnr, and AAC(6')-Ib-cr among 16S rRNA Methylase RmtB-Producing Escherichia coli Isolates from Pigs. Antimicrob. Agents Chemother.
52: 2992-2993
[Full Text]
-
Chmelnitsky, I., Navon-Venezia, S., Strahilevitz, J., Carmeli, Y.
(2008). Plasmid-Mediated qnrB2 and Carbapenemase Gene blaKPC-2 Carried on the Same Plasmid in Carbapenem-Resistant Ciprofloxacin-Susceptible Enterobacter cloacae Isolates. Antimicrob. Agents Chemother.
52: 2962-2965
[Abstract]
[Full Text]
-
Lascols, C., Podglajen, I., Verdet, C., Gautier, V., Gutmann, L., Soussy, C.-J., Collatz, E., Cambau, E.
(2008). A Plasmid-Borne Shewanella algae Gene, qnrA3, and Its Possible Transfer In Vivo between Kluyvera ascorbata and Klebsiella pneumoniae. J. Bacteriol.
190: 5217-5223
[Abstract]
[Full Text]
-
Endimiani, A., Carias, L. L., Hujer, A. M., Bethel, C. R., Hujer, K. M., Perez, F., Hutton, R. A., Fox, W. R., Hall, G. S., Jacobs, M. R., Paterson, D. L., Rice, L. B., Jenkins, S. G., Tenover, F. C., Bonomo, R. A.
(2008). Presence of Plasmid-Mediated Quinolone Resistance in Klebsiella pneumoniae Isolates Possessing blaKPC in the United States. Antimicrob. Agents Chemother.
52: 2680-2682
[Abstract]
[Full Text]
-
Pazhani, G. P., Niyogi, S. K., Singh, A. K., Sen, B., Taneja, N., Kundu, M., Yamasaki, S., Ramamurthy, T.
(2008). Molecular characterization of multidrug-resistant Shigella species isolated from epidemic and endemic cases of shigellosis in India. J Med Microbiol
57: 856-863
[Abstract]
[Full Text]
-
Pitout, J. D. D., Wei, Y., Church, D. L., Gregson, D. B.
(2008). Surveillance for plasmid-mediated quinolone resistance determinants in Enterobacteriaceae within the Calgary Health Region, Canada: the emergence of aac(6')-Ib-cr. J Antimicrob Chemother
61: 999-1002
[Abstract]
[Full Text]
-
Cordeiro, N. F., Robino, L., Medina, J., Seija, V., Bado, I., Garcia, V., Berro, M., Pontet, J., Lopez, L., Bazet, C., Rieppi, G., Gutkind, G., Ayala, J. A., Vignoli, R.
(2008). Ciprofloxacin-Resistant Enterobacteria Harboring the aac(6')-Ib-cr Variant Isolated from Feces of Inpatients in an Intensive Care Unit in Uruguay. Antimicrob. Agents Chemother.
52: 806-807
[Full Text]
-
Xu, X., Wu, S., Ye, X., Liu, Y., Shi, W., Zhang, Y., Wang, M.
(2007). Prevalence and Expression of the Plasmid-Mediated Quinolone Resistance Determinant qnrA1. Antimicrob. Agents Chemother.
51: 4105-4110
[Abstract]
[Full Text]
-
Ambrozic Avgustin, J., Keber, R., Zerjavic, K., Orazem, T., Grabnar, M.
(2007). Emergence of the Quinolone Resistance-Mediating Gene aac(6')-Ib-cr in Extended-Spectrum-{beta}-Lactamase-Producing Klebsiella Isolates Collected in Slovenia between 2000 and 2005. Antimicrob. Agents Chemother.
51: 4171-4173
[Abstract]
[Full Text]
-
Ahmed, A. M., Motoi, Y., Sato, M., Maruyama, A., Watanabe, H., Fukumoto, Y., Shimamoto, T.
(2007). Zoo Animals as Reservoirs of Gram-Negative Bacteria Harboring Integrons and Antimicrobial Resistance Genes. Appl. Environ. Microbiol.
73: 6686-6690
[Abstract]
[Full Text]
-
Cavaco, L. M., Hendriksen, R. S., Aarestrup, F. M.
(2007). Plasmid-mediated quinolone resistance determinant qnrS1 detected in Salmonella enterica serovar Corvallis strains isolated in Denmark and Thailand. J Antimicrob Chemother
60: 704-706
[Full Text]
-
Yamane, K., Wachino, J.-i., Suzuki, S., Kimura, K., Shibata, N., Kato, H., Shibayama, K., Konda, T., Arakawa, Y.
(2007). New Plasmid-Mediated Fluoroquinolone Efflux Pump, QepA, Found in an Escherichia coli Clinical Isolate. Antimicrob. Agents Chemother.
51: 3354-3360
[Abstract]
[Full Text]
-
Pallecchi, L., Bartoloni, A., Fiorelli, C., Mantella, A., Di Maggio, T., Gamboa, H., Gotuzzo, E., Kronvall, G., Paradisi, F., Rossolini, G. M.
(2007). Rapid Dissemination and Diversity of CTX-M Extended-Spectrum {beta}-Lactamase Genes in Commensal Escherichia coli Isolates from Healthy Children from Low-Resource Settings in Latin America. Antimicrob. Agents Chemother.
51: 2720-2725
[Abstract]
[Full Text]
-
Kehrenberg, C., de Jong, A., Friederichs, S., Cloeckaert, A., Schwarz, S.
(2007). Molecular mechanisms of decreased susceptibility to fluoroquinolones in avian Salmonella serovars and their mutants selected during the determination of mutant prevention concentrations. J Antimicrob Chemother
59: 886-892
[Abstract]
[Full Text]