This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andini, N.
Right arrow Articles by Nash, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andini, N.
Right arrow Articles by Nash, K. A.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, July 2006, p. 2560-2562, Vol. 50, No. 7
0066-4804/06/$08.00+0     doi:10.1128/AAC.00264-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Intrinsic Macrolide Resistance of the Mycobacterium tuberculosis Complex Is Inducible

Nadya Andini1 and Kevin A. Nash1,2*

Department of Pathology and Laboratory Medicine, Saban Research Institute of Childrens Hospital Los Angeles,1 Department of Pathology, University of Southern California, Los Angeles, California2

Received 2 March 2006/ Returned for modification 1 April 2006/ Accepted 27 April 2006


arrow
ABSTRACT
 
Mycobacterium tuberculosis is intrinsically resistant to macrolides, a characteristic associated with expression of the erm(37) gene. This intrinsic resistance was found to be inducible with clarithromycin and the ketolide HMR3004. Furthermore, underlying the phenotypic induction was an increase in erm(37) mRNA levels.


arrow
TEXT
 
The Mycobacterium tuberculosis complex (MTC) is intrinsically resistant to macrolides, such as clarithromycin (4, 5, 12, 14), and studies from this laboratory (8) demonstrated the inducibility of this phenotype in Mycobacterium microti (a member of the MTC). Subsequent reports associated the macrolide resistance of the MTC with the erm(37) gene (1, 6) and suggested that expression of this gene was inducible (6, 7) and may be regulated by the whiB7 gene (7). However, it was unclear whether regulation of erm(37) expression in M. tuberculosis conferred an inducible phenotype. Thus, the primary objectives of this study were to determine if the macrolide resistance of M. tuberculosis was induced by macrolides and ketolides and to analyze the underlying kinetics of erm(37) expression.

(This study was presented in part at the 104th General Meeting of the American Society for Microbiology, New Orleans, La., 23 to 27 May 2004 [abstr. U-019].)

For this study, the experimental organisms were M. tuberculosis strain H37Ra (ATCC 25177) and M. microti strain ATCC 19422; the macrolide susceptibilities of these organisms were considered equivalent to those of virulent M. tuberculosis and Mycobacterium bovis, respectively (1, 2). To assess phenotypic induction, M. tuberculosis and M. microti were cultured to mid-exponential growth phase in Middlebrook 7H9 broth (supplemented with 0.05% Tween 80, 1 g/liter digested casein, and 10% oleic acid-albumin-dextrose-catalase), and then the cultures were split and incubated in a range of clarithromycin concentrations (up to 32 µg/ml). The clarithromycin MIC was determined for each suspension by a broth microdilution assay based on CLSI (formerly NCCLS) guidelines (11).

In a preliminary experiment, preincubation of M. tuberculosis with clarithromycin at 2 and 8 µg/ml for 4, 8, 18, and 48 h indicated that ≤8 h of preincubation did not change the clarithromycin MIC (16 µg/ml), whereas the clarithromycin MIC was 128 µg/ml for organisms preincubated for 18 and 48 h. Thus, a preincubation of 18 to 24 h was used in subsequent experiments.

Table 1 shows the effect on the clarithromycin MIC of using an extended range of preincubation clarithromycin concentrations for M. tuberculosis and M. microti. Consistent with previous reports (1), the noninduced clarithromycin MIC for M. tuberculosis (16 µg/ml) was higher than the noninduced MIC for M. microti (2 µg/ml). However, preincubation of M. tuberculosis in ≤8 µg clarithromycin per ml increased the clarithromycin MIC to 64 to 128 µg/ml. For M. microti, preincubation in ≤0.5 µg clarithromycin per ml increased the MIC to 16 µg/ml. Thus, exposure to subinhibitory clarithromycin concentrations (i.e., below the noninduced MIC) caused four- to eightfold increases in clarithromycin MICs for both M. tuberculosis and M. microti.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Effect of preincubation with clarithromycin or the ketolide HMR3004 on susceptibilities of M. tuberculosis H37Ra and M. microti ATCC 19422

Further studies demonstrated that preincubation with either clarithromycin or the ketolide HMR3004 increased resistance to azithromycin and HMR3004, as well as to clarithromycin (Table 1); HMR3004 was used because it was considered one of the more active ketolides against mycobacteria (3, 12) and also only a weak inducer of erm genes in other bacteria (13). In contrast, preincubation of M. bovis BCG-Pasteur [erm(37) negative] with subinhibitory concentrations of clarithromycin or HMR3004 did not significantly change the clarithromycin MIC of 0.05 to 0.1 µg/ml. These findings indicated that the erm(37)-positive members of the MTC expressed inducible macrolide resistance, although the phenotype shift (four- to eightfold) was smaller than that observed for the rapidly growing mycobacteria (RGM) (8-10).

Ketolides were developed to overcome resistance conferred by erm genes, partly by not inducing these genes; therefore, it is interesting that the ketolide HMR3004 is able to induce resistance in the MTC and in the RGM (K. A. Nash, unpublished data). The inducing activity of ketolides for mycobacteria may reflect a novel regulatory mechanism, such as the involvement of the whiB7 gene as proposed by Morris et al. (7).

To investigate how clarithromycin affects erm(37) mRNA levels, real-time reverse transcription (RT)-PCR analysis was applied using methods described elsewhere (10), with the erm(37)-specific primers ERMMT-1 (TGTCCTCCGCGAGCGATTCC) and ERMMT-2 (AGGCCGACGGTCAGGGTGAA). Each sample was normalized to the level of 23S rRNA assessed by real-time RT-PCR (primers MS23-1 and MS23-3, detailed elsewhere [10]), using algorithms outlined by Vandesompele et al. (15). Initially, erm(37) RNA levels were analyzed in M. tuberculosis H37Ra organisms that had been incubated for 24 h in clarithromycin concentrations ranging from 1 to 32 µg/ml. This experiment demonstrated that erm(37) RNA levels were dependent on the drug concentration with a peak expression at 2 µg clarithromycin per ml (Fig. 1A). Furthermore, these results suggested that erm(37) induction occurred at clarithromycin concentrations at and above the noninduced MIC of 16 µg/ml.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
  		FIG. 1. A. The level of erm(37) mRNA in M. tuberculosis 24 h after the addition of clarithromycin (CLR) (1, 2, 4, 8, 16, and 32 µg/ml). Relative expression represents mRNA levels from each experimental condition compared to those of organisms incubated in medium alone (0 µg/ml). B. The change in erm(37) mRNA levels in M. tuberculosis following addition of clarithromycin (2 µg/ml) relative to the mRNA levels at time zero. Inset—change in erm(37) mRNA levels (relative to time zero) of M. microti (micr) and M. tuberculosis (tb) incubated for 18 h with clarithromycin at 0.1 and 2 µg/ml, respectively. Each experimental condition was tested in triplicate.

To analyze the kinetics of erm(37) induction, mRNA levels were assessed up to 30 h after the addition of 2 µg clarithromycin per ml (Fig. 1B). The initial increase in mRNA levels was linear; the correlation coefficient was 0.998 for time points between 1 and 9 h. After 9 h, the level of mRNA remained relatively constant at approximately 40-fold above that at time zero. Thus, phenotype induction (>8 h of preincubation) appeared to correlate with the plateau phase of erm(37) expression. A similar pattern was observed with the erm genes of the RGM, although the time course was faster, reaching the plateau phase within 1.5 to 2 h (10).

Like M. tuberculosis, erm(37) mRNA levels increased in M. microti following incubation in subinhibitory concentrations of clarithromycin (Fig. 1B). Interestingly, the erm(37) mRNA levels in noninduced M. microti were 80% of that for noninduced M. tuberculosis. Furthermore, the sequences of the erm(37) gene and surrounding DNA of the MTC (including M. microti) were found to be ≥99% identical (using the NCBI website http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi). These results suggested that, in addition to erm(37), other factors must be involved in the macrolide resistance of the MTC in order to explain the distinct phenotypes of M. tuberculosis and M. microti.

Although the induced M. tuberculosis phenotype probably represents clinically significant resistance, the M. microti phenotype may be in the therapeutic range for clarithromycin. Thus, if M. microti is representative of M. bovis, then clarithromycin may have utility against tuberculosis caused by the latter. Furthermore, a study by Falzari et al. (3) indicated that several new macrolide derivatives have low MICs for M. tuberculosis, although the erm(37)-inducing ability of these agents is unknown. Thus, we believe that further study of macrolides and ketolides as potential agents for treatment of tuberculosis is warranted.


arrow
ACKNOWLEDGMENTS
 
Funding for this study was provided by National Institutes of Health (NIH)/National Institute of Allergy and Infectious Diseases (NIAID) grant RO1-AI052291 and the Department of Pathology and Laboratory Medicine, Children’s Hospital Los Angeles.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Pathology and Laboratory Medicine, Saban Research Institute of Children’s Hospital Los Angeles, 4650 Sunset Blvd., Mailstop 103, Los Angeles, CA 90027. Phone: (323) 669-5670. Fax: (323) 668-7989. E-mail: kanash{at}usc.edu. Back


arrow
REFERENCES
 
    1
  1. Buriankova, K., F. Doucet-Populaire, O. Dorson, A. Gondran, J. C. Ghnassia, J. Weiser, and J. L. Pernodet. 2004. Molecular basis of intrinsic macrolide resistance in the Mycobacterium tuberculosis complex. Antimicrob. Agents Chemother. 48:143-150.[Abstract/Free Full Text]
    2. 2
  2. Collins, L., and S. G. Franzblau. 1997. Microplate Alamar blue assay versus BACTEC 460 system for high-throughput screening of compounds against Mycobacterium tuberculosis and Mycobacterium avium. Antimicrob. Agents Chemother. 41:1004-1009.[Abstract]
    3. 3
  3. Falzari, K., Z. Zhu, D. Pan, H. Liu, P. Hongmanee, and S. G. Franzblau. 2005. In vitro and in vivo activities of macrolide derivatives against Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 49:1447-1454.[Abstract/Free Full Text]
    4. 4
  4. Hoffner, S. E., L. Gezelius, and B. Olsson-Liljequist. 1997. In-vitro activity of fluorinated quinolones and macrolides against drug-resistant Mycobacterium tuberculosis. J. Antimicrob. Chemother. 40:885-888.[Abstract/Free Full Text]
    5. 5
  5. Luna-Herrera, J., V. Reddy, D. Daneluzzi, and P. Gangadharam. 1995. Antituberculosis activity of clarithromycin. Antimicrob. Agents Chemother. 39:2692-2695.[Abstract]
    6. 6
  6. Madsen, C. T., L. Jakobsen, K. Buriankova, F. Doucet-Populaire, J. L. Pernodet, and S. Douthwaite. 2005. Methyltransferase Erm(37) slips on rRNA to confer atypical resistance in Mycobacterium tuberculosis. J. Biol. Chem. 280:38942-38947.[Abstract/Free Full Text]
    7. 7
  7. Morris, R. P., L. Nguyen, J. Gatfield, K. Visconti, K. Nguyen, D. Schnappinger, S. Ehrt, Y. Liu, L. Heifets, J. Pieters, G. Schoolnik, and C. J. Thompson. 2005. Ancestral antibiotic resistance in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 102:12200-12205.[Abstract/Free Full Text]
    8. 8
  8. Nash, K. A. 2003. Intrinsic macrolide resistance in Mycobacterium smegmatis is conferred by a novel erm gene, erm(38). Antimicrob. Agents Chemother. 47:3053-3060.[Abstract/Free Full Text]
    9. 9
  9. Nash, K. A., N. Andini, Y. Zhang, B. A. Brown-Elliott, and R. J. Wallace, Jr. 2004. Adenine rRNA methylase or erm genes and macrolide resistance in rapidly growing mycobacteria, abstr. C1-407, p. 67. Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother. American Society for Microbiology, Washington, D.C.
    10. 10
  10. Nash, K. A., Y. Zhang, B. A. Brown-Elliott, and R. J. Wallace, Jr. 2005. Molecular basis of intrinsic macrolide resistance in clinical isolates of Mycobacterium fortuitum. J. Antimicrob. Chemother. 55:170-177.[Abstract/Free Full Text]
    11. 11
  11. NCCLS. 2003. Susceptibility testing of mycobacteria, nocardia, and other aerobic actinomycetes, 1st ed. Approved standard M24-A, vol. 23. NCCLS, Wayne, Pa.
    12. 12
  12. Rastogi, N., K. S. Goh, M. Berchel, and A. Bryskier. 2000. In vitro activities of the ketolides telithromycin (HMR 3647) and HMR 3004 compared to those of clarithromycin against slowly growing mycobacteria at pHs 6.8 and 7.4. Antimicrob. Agents Chemother. 44:2848-2852.[Abstract/Free Full Text]
    13. 13
  13. Rosato, A., H. Vicarini, A. Bonnefoy, J. F. Chantot, and R. Leclercq. 1998. A new ketolide, HMR 3004, active against streptococci inducibly resistant to erythromycin. Antimicrob. Agents Chemother. 42:1392-1396.[Abstract/Free Full Text]
    14. 14
  14. Truffot-Pernot, C., N. Lounis, J. H. Grosset, and B. Ji. 1995. Clarithromycin is inactive against Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 39:2827-2828.[Abstract]
    15. 15
  15. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:1-34.[Medline]

Antimicrobial Agents and Chemotherapy, July 2006, p. 2560-2562, Vol. 50, No. 7
0066-4804/06/$08.00+0     doi:10.1128/AAC.00264-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Nash, K. A., Brown-Elliott, B. A., Wallace, R. J. Jr. (2009). A Novel Gene, erm(41), Confers Inducible Macrolide Resistance to Clinical Isolates of Mycobacterium abscessus but Is Absent from Mycobacterium chelonae. Antimicrob. Agents Chemother. 53: 1367-1376 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andini, N.
Right arrow Articles by Nash, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andini, N.
Right arrow Articles by Nash, K. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»