Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, August 2006, p. 2866-2868, Vol. 50, No. 8
0066-4804/06/$08.00+0 doi:10.1128/AAC.00217-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Potential Role of Veillonella spp. as a Reservoir of Transferable Tetracycline Resistance in the Oral Cavity
D. Ready,1*
J. Pratten,2
A. P. Roberts,2
R. Bedi,3
P. Mullany,2 and
M. Wilson2
Eastman Dental Hospital, UCLH NHS Foundation Trust, 256 Gray's Inn Road, London WC1X 8LD,1
Division of Microbial Diseases, UCL Eastman Dental Institute, 256 Gray's Inn Road, London WC1X 8LD,2
King's College London, Strand, London WC2R 2LS, United Kingdom3
Received 20 February 2006/
Returned for modification 16 April 2006/
Accepted 17 May 2006

ABSTRACT
Twelve out of 96
Veillonella spp. isolated from oral samples
harbored tetracycline resistance genes. The most common resistance
gene was
tet(M). A
tet(M)-positive
Veillonella dispar strain
was shown to transfer a Tn
916-like element to four
Streptococcus spp. by conjugation at a frequency of 5.2
x 10
6 to 4.5
x 10
5 per recipient.

TEXT
The tetracyclines are broad-spectrum, bacteriostatic antibiotics
used for the treatment of skin, respiratory, and oral infections
(
18); however, bacterial resistance is limiting their usefulness.
The oral cavity harbors a diverse community of microorganisms
and has been shown to be a reservoir for antibiotic-resistant
bacteria (
5,
9,
14). The most widespread tetracycline resistance
(Tc
r) gene identified from oral bacteria is
tet(M) (
9,
17,
19).
It has been identified in 42 genera (
16) and is usually found
on conjugative transposons of the Tn
916/Tn
1545 family (
4). Transfer
of Tn
916-like elements between oral streptococci has been observed
(
7,
8,
15). However, the role of oral bacteria other than streptococci
in the transfer of Tc
r genes has not been thoroughly investigated.
Previous work has shown that the most prevalent group of tetracycline-resistant
oral bacteria, other than the oral streptococci, are
Veillonella spp. (
9).
Veillonella spp. are anaerobic, gram-negative cocci
and are residents of the oral cavity, gastrointestinal tract,
and vagina (
2). The aim of this study was to determine if oral
Veillonella spp. harbored transferable Tc
r.
Ninety-six Veillonella isolates were tested for Tcr. The isolates were recovered from the dental plaque of 52 healthy subjects who had not received antibiotics in the previous three months (ethical approval 98/56 [Local Health Authority Research and Ethics Committee]). Of these isolates, 12.5% were shown to be tetracycline resistant by agar dilution (12) (MIC
16 µg/ml), and five different Tcr genes were detected (Table 1) by PCR and sequencing using previously published primers (13, 19). The most common Tcr gene was tet(M), followed by tet(S) (Table 1). Veillonella dispar (34.2A) containing tet(M) was used as a donor of Tcr. The genetic support for tet(M) was demonstrated by PCR. Reactions were carried out to amplify the region from the start of tet(M) to the int gene using previously published primer pairs RT1 and RT2, RT3 and RT4 (15), orf6 (5' TGGATATTTGTGTCCTGTATGTG) and xis (5' CGTAGCTTGTTTTCGCCAAT), and intxis1 and intxis2 (15). The results of the PCR and sequencing demonstrated that the tet(M) gene was likely to be contained within a Tn916-like conjugative transposon.
Determination of conjugative transfer of the Tn
916-like element
from
V. dispar to four oral streptococci (Table
2) was achieved
by filter-mating and transformation experiments in the presence
and absence of DNase I. The donor
V. dispar 34.2A (MIC, 32 µg/ml)
was grown anaerobically overnight on tetracycline containing
anaerobic agar (8 µg/ml; Oxoid Ltd., Basingstoke, United
Kingdom) supplemented with 5% defibrinated horse blood (E&O
Laboratories, Bonnybridge, United Kingdom). The four tetracycline-susceptible
recipients (MIC

0.25 µg/ml; Table
2) were grown overnight
in air with 5% CO
2 on antibiotic-free Columbia blood agar (Oxoid)
supplemented with 5% defibrinated horse blood. The cells from
these plates were suspended in 20 ml of antibiotic-free brain
heart infusion (BHI) broth (Oxoid) and grown overnight at 37°C
anaerobically. Ten milliliters of antibiotic-free BHI broth
was inoculated with 100 µl of overnight culture and incubated
at 37°C until mid-exponential phase (optical density at
600 nm, 0.4 to 0.6). The cultures were centrifuged (1,910
x g) for 10 min, and the supernatant was discarded. The cells
were resuspended in 1 ml of BHI broth with or without 50 mg/liter
DNase I (
3), and 100 µl aliquots from the donor and one
of the recipients were spread onto 0.45 µm nitrocellulose
filters (Fisher Scientific, London, United Kingdom) on antibiotic-free
anaerobic agar and incubated anaerobically overnight at 37°C.
To control for transformation (as all the recipients are naturally
competent), the pelleted recipient cells were mixed with 371
ng of pAM120 DNA and spread onto filters as described above.
The plasmid pAM120 is pGL101 containing Tn
916 and flanking DNA
on an EcoRI fragment. This plasmid has previously been shown
to transform gram-positive cells to have Tc
r (
6). As with the
filter-mating experiments, these transformation experiments
were carried out both in the presence and in the absence of
DNase I. The filters were removed from the agar plates and placed
in sterile universals with 1 ml of prewarmed BHI broth and vortexed
(20 s). Aliquots of 100 µl were then spread onto Columbia
blood agar plates containing tetracycline (8 µg/ml). These
plates were incubated at 37°C for 48 h in air supplemented
with 5% CO
2, providing selection against the obligate anaerobic
donor. Colonies were counted and subcultured onto tetracycline-containing
agar to ensure resistance and purity. Putative transconjugants
were identified by partial 16S rRNA gene sequencing (
10,
20).
Sequences were analyzed using relevant databases (
1,
11). The
presence of the Tn
916-like element within the streptococcal
transconjugants was confirmed by PCR amplification and sequencing
of the
tet(M) gene and
int and
xis (
15).
Results of the filter-mating experiments are shown in Table
2. None of the recipients became spontaneously resistant to
tetracycline, and tetracycline-resistant transconjugants (MIC,
32 µg/ml) arose from each of the mating experiments. PCR
and sequencing demonstrated that the donor and transconjugants
contained identical
tet(M),
int, and
xis genes. DNase I was
added to the matings to ensure that transfer occurred by conjugation.
Mating experiments in which DNase I was not added were also
carried out. The transformation experiments with pAM120 in the
absence of DNase I showed that the four recipients were all
naturally transformable while incubating on the filters. The
same experiment in the presence of DNase I showed a dramatic
reduction in the number of transformants (Table
2), confirming
the observation that most of the extracellular DNA present during
these experiments was being degraded. Therefore, the majority
of the transfer observed during these filter-mating experiments
was likely to be due to conjugation.
Other studies have shown transfer of Tcr between oral streptococci (7, 8, 15). However, the potential of Veillonella spp. to harbor and transfer Tcr has not previously been investigated. In this study, 12.5% of Veillonella spp. were shown to be tetracycline resistant, and tet(M) was found to be the most common resistance gene. Furthermore, the transfer of tet(M) from V. dispar to four streptococcal species was demonstrated.
Tetracycline-resistant Veillonella spp. have the opportunity to come into close contact with, and consequently transfer resistance elements to, other oral bacteria and bacteria which pass through the oral cavity. Additionally, oral bacteria have the opportunity to transfer from person to person, and this transfer could further allow the spread of a resistant bacterium to a new host and subsequent dissemination of the mobile Tcr genes to susceptible bacteria.

ACKNOWLEDGMENTS
We thank Julia Roche for collecting the plaque samples and Lindsay
Sharp for help with 16S rRNA gene sequencing.
This work was supported by funding from the Charles Wolfson Trust.

FOOTNOTES
* Corresponding author. Mailing address: Microbiology, Eastman Dental Hospital, UCLH NHS Foundation Trust, 256 Gray's Inn Road, London WC1X 8LD, United Kingdom. Phone: 44 20 7915 1050. Fax: 44 20 7915 1127. E-mail:
d.ready{at}eastman.ucl.ac.uk.


REFERENCES
1 - Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
2 - Bhatti, M. A., and M. O. Frank. 2000. Veillonella parvula meningitis: case report and review of Veillonella infections. Clin. Infect. Dis. 31:839-840.[CrossRef][Medline]
3 - Christie, P. J., R. Z. Korman, S. A. Zahler, J. C. Adsit, and G. M. Dunny. 1987. Two conjugation systems associated with Streptococcus faecalis plasmid pCF10: identification of a conjugative transposon that transfers between S. faecalis and Bacillus subtilis. J. Bacteriol. 169:2529-2536.[Abstract/Free Full Text]
4 - Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 3:229-236.[CrossRef][Medline]
5 - Edlund, C., L. Björkman, J. Ekstrand, G. Sandborgh-Englund, and C. E. Nord. 1996. Resistance of the normal human microflora to mercury and antimicrobials after exposure to mercury from dental amalgam fillings. Clin. Infect. Dis. 22:944-950.[Medline]
6 - Gawron-Burke, C., and D. B. Clewell. 1984. Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria. J. Bacteriol. 159:214-221.[Abstract/Free Full Text]
7 - Hartley, D. L., K. R. Jones, J. A. Tobian, D. J. LeBlanc, and F. L. Macrina. 1984. Disseminated tetracycline resistance in oral streptococci: implication of a conjugative transposon. Infect. Immun. 45:13-17.[Abstract/Free Full Text]
8 - Kuramitsu, H. K., and V. Trapa. 1984. Genetic exchange between oral streptococci during mixed growth. J. Gen. Microbiol. 130:2497-2500.[Abstract/Free Full Text]
9 - Lancaster, H., D. Ready, P. Mullany, D. Spratt, R. Bedi, and M. Wilson. 2003. Prevalence and identification of tetracycline-resistant oral bacteria in children not receiving antibiotic therapy. FEMS Microbiol. Lett. 228:99-104.[CrossRef][Medline]
10 - Lane, D. J. 1996. 16S/23S rRNA sequencing, p. 115-175. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley and Sons, Ltd., Chichester, United Kingdom.
11 - Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, Jr., P. R. Saxman, J. M. Stredwick, G. M. Garrity, B. Li, G. J. Olsen, S. Pramanik, T. M. Schmidt, and J. M. Tiedje. 2000. The RDP (Ribosomal Database Project) continues. Nucleic Acids Res. 28:173-174.[Abstract/Free Full Text]
12 - National Committee for Clinical Laboratory Standards. 2003. Methods for antimicrobial susceptibility testing of anaerobic bacteria, 5th ed. Approved standard M11-A5. National Committee for Clinical Laboratory Standards, Villanova, Pa.
13 - Ng, L. K., I. Martin, M. Alfa, and M. Mulvey. 2001. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 15:209-215.[CrossRef][Medline]
14 - Ready, D., R. Bedi, D. A. Spratt, P. Mullany, and M. Wilson. 2003. Prevalence, proportions, and identities of antibiotic-resistant bacteria in the oral microflora of healthy children. Microb. Drug Resist. 9:367-372.[CrossRef][Medline]
15 - Roberts, A. P., G. Cheah, D. Ready, J. Pratten, M. Wilson, and P. Mullany. 2001. Transfer of Tn916-like elements in microcosm dental plaques. Antimicrob. Agents Chemother. 45:2943-2946.[Abstract/Free Full Text]
16 - Roberts, M. C. 2005. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 245:195-203.[CrossRef][Medline]
17 - Roberts, M. C. 2002. Antibiotic toxicity, interactions and resistance development. Periodontol. 2000. 28:280-297.[CrossRef]
18 - Smilack, J. D. 1999. The tetracyclines. Mayo Clin. Proc. 74:727-729.[Abstract]
19 - Villedieu, A., M. L. Diaz-Torres, M. L. Hunt, R. McNab, D. A. Spratt, M. Wilson, and P. Mullany. 2003. Prevalence of tetracycline resistance genes in oral bacteria. Antimicrob. Agents Chemother. 47:878-882.[Abstract/Free Full Text]
20 - Wilson, M. J., A. J. Weightman, and W. G. Wade. 1997. Applications of molecular ecology in the characterisation of uncultured microorganisms associated with human disease. Rev. Med. Microbiol. 8:91-101.
Antimicrobial Agents and Chemotherapy, August 2006, p. 2866-2868, Vol. 50, No. 8
0066-4804/06/$08.00+0 doi:10.1128/AAC.00217-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Sun, J., Song, X., Kristiansen, B. E., Kjaereng, A., Willems, R. J. L., Eriksen, H. M., Sundsfjord, A., Sollid, J. E.
(2009). Occurrence, Population Structure, and Antimicrobial Resistance of Enterococci in Marginal and Apical Periodontitis. J. Clin. Microbiol.
47: 2218-2225
[Abstract]
[Full Text]