AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ready, D.
Right arrow Articles by Wilson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ready, D.
Right arrow Articles by Wilson, M.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, August 2006, p. 2866-2868, Vol. 50, No. 8
0066-4804/06/$08.00+0     doi:10.1128/AAC.00217-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Potential Role of Veillonella spp. as a Reservoir of Transferable Tetracycline Resistance in the Oral Cavity

D. Ready,1* J. Pratten,2 A. P. Roberts,2 R. Bedi,3 P. Mullany,2 and M. Wilson2

Eastman Dental Hospital, UCLH NHS Foundation Trust, 256 Gray's Inn Road, London WC1X 8LD,1 Division of Microbial Diseases, UCL Eastman Dental Institute, 256 Gray's Inn Road, London WC1X 8LD,2 King's College London, Strand, London WC2R 2LS, United Kingdom3

Received 20 February 2006/ Returned for modification 16 April 2006/ Accepted 17 May 2006


   ABSTRACT
Top
 Abstract
Text
 References
 
Twelve out of 96 Veillonella spp. isolated from oral samples harbored tetracycline resistance genes. The most common resistance gene was tet(M). A tet(M)-positive Veillonella dispar strain was shown to transfer a Tn916-like element to four Streptococcus spp. by conjugation at a frequency of 5.2 x 10–6 to 4.5 x 10–5 per recipient.


   TEXT
Top
 Abstract
 Text
References
 
The tetracyclines are broad-spectrum, bacteriostatic antibiotics used for the treatment of skin, respiratory, and oral infections (18); however, bacterial resistance is limiting their usefulness. The oral cavity harbors a diverse community of microorganisms and has been shown to be a reservoir for antibiotic-resistant bacteria (5, 9, 14). The most widespread tetracycline resistance (Tcr) gene identified from oral bacteria is tet(M) (9, 17, 19). It has been identified in 42 genera (16) and is usually found on conjugative transposons of the Tn916/Tn1545 family (4). Transfer of Tn916-like elements between oral streptococci has been observed (7, 8, 15). However, the role of oral bacteria other than streptococci in the transfer of Tcr genes has not been thoroughly investigated. Previous work has shown that the most prevalent group of tetracycline-resistant oral bacteria, other than the oral streptococci, are Veillonella spp. (9). Veillonella spp. are anaerobic, gram-negative cocci and are residents of the oral cavity, gastrointestinal tract, and vagina (2). The aim of this study was to determine if oral Veillonella spp. harbored transferable Tcr.

Ninety-six Veillonella isolates were tested for Tcr. The isolates were recovered from the dental plaque of 52 healthy subjects who had not received antibiotics in the previous three months (ethical approval 98/56 [Local Health Authority Research and Ethics Committee]). Of these isolates, 12.5% were shown to be tetracycline resistant by agar dilution (12) (MIC ≥ 16 µg/ml), and five different Tcr genes were detected (Table 1) by PCR and sequencing using previously published primers (13, 19). The most common Tcr gene was tet(M), followed by tet(S) (Table 1). Veillonella dispar (34.2A) containing tet(M) was used as a donor of Tcr. The genetic support for tet(M) was demonstrated by PCR. Reactions were carried out to amplify the region from the start of tet(M) to the int gene using previously published primer pairs RT1 and RT2, RT3 and RT4 (15), orf6 (5' TGGATATTTGTGTCCTGTATGTG) and xis (5' CGTAGCTTGTTTTCGCCAAT), and intxis1 and intxis2 (15). The results of the PCR and sequencing demonstrated that the tet(M) gene was likely to be contained within a Tn916-like conjugative transposon.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Distribution of tetracycline resistance genes among Veillonella spp.

 
Determination of conjugative transfer of the Tn916-like element from V. dispar to four oral streptococci (Table 2) was achieved by filter-mating and transformation experiments in the presence and absence of DNase I. The donor V. dispar 34.2A (MIC, 32 µg/ml) was grown anaerobically overnight on tetracycline containing anaerobic agar (8 µg/ml; Oxoid Ltd., Basingstoke, United Kingdom) supplemented with 5% defibrinated horse blood (E&O Laboratories, Bonnybridge, United Kingdom). The four tetracycline-susceptible recipients (MIC ≤ 0.25 µg/ml; Table 2) were grown overnight in air with 5% CO2 on antibiotic-free Columbia blood agar (Oxoid) supplemented with 5% defibrinated horse blood. The cells from these plates were suspended in 20 ml of antibiotic-free brain heart infusion (BHI) broth (Oxoid) and grown overnight at 37°C anaerobically. Ten milliliters of antibiotic-free BHI broth was inoculated with 100 µl of overnight culture and incubated at 37°C until mid-exponential phase (optical density at 600 nm, 0.4 to 0.6). The cultures were centrifuged (1,910 x g) for 10 min, and the supernatant was discarded. The cells were resuspended in 1 ml of BHI broth with or without 50 mg/liter DNase I (3), and 100 µl aliquots from the donor and one of the recipients were spread onto 0.45 µm nitrocellulose filters (Fisher Scientific, London, United Kingdom) on antibiotic-free anaerobic agar and incubated anaerobically overnight at 37°C. To control for transformation (as all the recipients are naturally competent), the pelleted recipient cells were mixed with 371 ng of pAM120 DNA and spread onto filters as described above. The plasmid pAM120 is pGL101 containing Tn916 and flanking DNA on an EcoRI fragment. This plasmid has previously been shown to transform gram-positive cells to have Tcr (6). As with the filter-mating experiments, these transformation experiments were carried out both in the presence and in the absence of DNase I. The filters were removed from the agar plates and placed in sterile universals with 1 ml of prewarmed BHI broth and vortexed (20 s). Aliquots of 100 µl were then spread onto Columbia blood agar plates containing tetracycline (8 µg/ml). These plates were incubated at 37°C for 48 h in air supplemented with 5% CO2, providing selection against the obligate anaerobic donor. Colonies were counted and subcultured onto tetracycline-containing agar to ensure resistance and purity. Putative transconjugants were identified by partial 16S rRNA gene sequencing (10, 20). Sequences were analyzed using relevant databases (1, 11). The presence of the Tn916-like element within the streptococcal transconjugants was confirmed by PCR amplification and sequencing of the tet(M) gene and int and xis (15).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Frequency of transfer detected in filter-mating experiments

 
Results of the filter-mating experiments are shown in Table 2. None of the recipients became spontaneously resistant to tetracycline, and tetracycline-resistant transconjugants (MIC, 32 µg/ml) arose from each of the mating experiments. PCR and sequencing demonstrated that the donor and transconjugants contained identical tet(M), int, and xis genes. DNase I was added to the matings to ensure that transfer occurred by conjugation. Mating experiments in which DNase I was not added were also carried out. The transformation experiments with pAM120 in the absence of DNase I showed that the four recipients were all naturally transformable while incubating on the filters. The same experiment in the presence of DNase I showed a dramatic reduction in the number of transformants (Table 2), confirming the observation that most of the extracellular DNA present during these experiments was being degraded. Therefore, the majority of the transfer observed during these filter-mating experiments was likely to be due to conjugation.

Other studies have shown transfer of Tcr between oral streptococci (7, 8, 15). However, the potential of Veillonella spp. to harbor and transfer Tcr has not previously been investigated. In this study, 12.5% of Veillonella spp. were shown to be tetracycline resistant, and tet(M) was found to be the most common resistance gene. Furthermore, the transfer of tet(M) from V. dispar to four streptococcal species was demonstrated.

Tetracycline-resistant Veillonella spp. have the opportunity to come into close contact with, and consequently transfer resistance elements to, other oral bacteria and bacteria which pass through the oral cavity. Additionally, oral bacteria have the opportunity to transfer from person to person, and this transfer could further allow the spread of a resistant bacterium to a new host and subsequent dissemination of the mobile Tcr genes to susceptible bacteria.


   ACKNOWLEDGMENTS
 
We thank Julia Roche for collecting the plaque samples and Lindsay Sharp for help with 16S rRNA gene sequencing.

This work was supported by funding from the Charles Wolfson Trust.


   FOOTNOTES
 
* Corresponding author. Mailing address: Microbiology, Eastman Dental Hospital, UCLH NHS Foundation Trust, 256 Gray's Inn Road, London WC1X 8LD, United Kingdom. Phone: 44 20 7915 1050. Fax: 44 20 7915 1127. E-mail: d.ready{at}eastman.ucl.ac.uk. Back


   REFERENCES
Top
 Abstract
 Text
 References
 

  1. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. Bhatti, M. A., and M. O. Frank. 2000. Veillonella parvula meningitis: case report and review of Veillonella infections. Clin. Infect. Dis. 31:839-840.[CrossRef][Medline]
  3. Christie, P. J., R. Z. Korman, S. A. Zahler, J. C. Adsit, and G. M. Dunny. 1987. Two conjugation systems associated with Streptococcus faecalis plasmid pCF10: identification of a conjugative transposon that transfers between S. faecalis and Bacillus subtilis. J. Bacteriol. 169:2529-2536.[Abstract/Free Full Text]
  4. Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 3:229-236.[CrossRef][Medline]
  5. Edlund, C., L. Björkman, J. Ekstrand, G. Sandborgh-Englund, and C. E. Nord. 1996. Resistance of the normal human microflora to mercury and antimicrobials after exposure to mercury from dental amalgam fillings. Clin. Infect. Dis. 22:944-950.[Medline]
  6. Gawron-Burke, C., and D. B. Clewell. 1984. Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria. J. Bacteriol. 159:214-221.[Abstract/Free Full Text]
  7. Hartley, D. L., K. R. Jones, J. A. Tobian, D. J. LeBlanc, and F. L. Macrina. 1984. Disseminated tetracycline resistance in oral streptococci: implication of a conjugative transposon. Infect. Immun. 45:13-17.[Abstract/Free Full Text]
  8. Kuramitsu, H. K., and V. Trapa. 1984. Genetic exchange between oral streptococci during mixed growth. J. Gen. Microbiol. 130:2497-2500.[Medline]
  9. Lancaster, H., D. Ready, P. Mullany, D. Spratt, R. Bedi, and M. Wilson. 2003. Prevalence and identification of tetracycline-resistant oral bacteria in children not receiving antibiotic therapy. FEMS Microbiol. Lett. 228:99-104.[CrossRef][Medline]
  10. Lane, D. J. 1996. 16S/23S rRNA sequencing, p. 115-175. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley and Sons, Ltd., Chichester, United Kingdom.
  11. Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, Jr., P. R. Saxman, J. M. Stredwick, G. M. Garrity, B. Li, G. J. Olsen, S. Pramanik, T. M. Schmidt, and J. M. Tiedje. 2000. The RDP (Ribosomal Database Project) continues. Nucleic Acids Res. 28:173-174.[Abstract/Free Full Text]
  12. National Committee for Clinical Laboratory Standards. 2003. Methods for antimicrobial susceptibility testing of anaerobic bacteria, 5th ed. Approved standard M11-A5. National Committee for Clinical Laboratory Standards, Villanova, Pa.
  13. Ng, L. K., I. Martin, M. Alfa, and M. Mulvey. 2001. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 15:209-215.[CrossRef][Medline]
  14. Ready, D., R. Bedi, D. A. Spratt, P. Mullany, and M. Wilson. 2003. Prevalence, proportions, and identities of antibiotic-resistant bacteria in the oral microflora of healthy children. Microb. Drug Resist. 9:367-372.[CrossRef][Medline]
  15. Roberts, A. P., G. Cheah, D. Ready, J. Pratten, M. Wilson, and P. Mullany. 2001. Transfer of Tn916-like elements in microcosm dental plaques. Antimicrob. Agents Chemother. 45:2943-2946.[Abstract/Free Full Text]
  16. Roberts, M. C. 2005. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 245:195-203.[CrossRef][Medline]
  17. Roberts, M. C. 2002. Antibiotic toxicity, interactions and resistance development. Periodontol. 2000. 28:280-297.[CrossRef]
  18. Smilack, J. D. 1999. The tetracyclines. Mayo Clin. Proc. 74:727-729.[Medline]
  19. Villedieu, A., M. L. Diaz-Torres, M. L. Hunt, R. McNab, D. A. Spratt, M. Wilson, and P. Mullany. 2003. Prevalence of tetracycline resistance genes in oral bacteria. Antimicrob. Agents Chemother. 47:878-882.[Abstract/Free Full Text]
  20. Wilson, M. J., A. J. Weightman, and W. G. Wade. 1997. Applications of molecular ecology in the characterisation of uncultured microorganisms associated with human disease. Rev. Med. Microbiol. 8:91-101.

Antimicrobial Agents and Chemotherapy, August 2006, p. 2866-2868, Vol. 50, No. 8
0066-4804/06/$08.00+0     doi:10.1128/AAC.00217-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ready, D.
Right arrow Articles by Wilson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ready, D.
Right arrow Articles by Wilson, M.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS