This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Udani, R. A.
Right arrow Articles by Levy, S. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Udani, R. A.
Right arrow Articles by Levy, S. B.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, September 2006, p. 2971-2975, Vol. 50, No. 9
0066-4804/06/$08.00+0     doi:10.1128/AAC.00015-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

MarA-Like Regulator of Multidrug Resistance in Yersinia pestis

Rupa A. Udani1,{dagger} and Stuart B. Levy1,2*

Center of Adaptation Genetics and Drug Resistance and Department of Molecular Biology and Microbiology,1 Department of Medicine, Tufts University School of Medicine, Boston, Massachusetts 021112

Received 5 January 2006/ Returned for modification 2 March 2006/ Accepted 27 June 2006


arrow
ABSTRACT
 
MarA47Yp from Yersinia pestis, showing 47% identity to Escherichia coli MarA in its N terminus, caused resistance to antibiotics and to organic solvents when expressed in both E. coli and Y. pestis. Resistance was linked to increased expression of the AcrAB multidrug efflux pump. In four of five spontaneous multidrug-resistant mutants of Y. pestis independently selected by growth on tetracycline, the marA47Yp gene was overexpressed. The findings suggest that marA47Yp is a marA ortholog in Y. pestis.


arrow
INTRODUCTION
 
Multiple-drug resistance in microorganisms is commonly acquired through plasmids, transposons, or integrons specifying different genes for resistance (12). Alternatively, mutations in chromosomal genes may produce resistance to a wide variety of antibiotics and other toxic substances. One such chromosomal locus, the mar (multiple antibiotic resistance) locus in Escherichia coli and other enteric bacteria, results in resistance to multiple antibiotics, oxidative stress agents, organic solvents, and disinfectant products (1, 2, 6, 7, 10, 27, 29).

In E. coli, the mar locus encodes the marRAB operon (5), specifying MarR, which represses the operon by binding to marO (15), and MarA, which positively regulates the operon and affects expression of the Mar phenotype and many other chromosomal genes through both activation and repression (4, 16, 21, 24-26). marB specifies a small putative protein of unknown function (5). Multidrug resistance is principally caused by MarA-mediated overexpression of the acrAB efflux system (19).

E. coli MarA is a member of the XylS/AraC family of transcriptional activators which contain two helix-turn-helix motifs (9). Most larger members (>250 amino acids [aa]) also possess an effector domain at either the N or C terminus of the protein (9). MarA, a 129-amino-acid protein, lacks the effector domain. MarA control of other chromosomal genes occurs via binding to the "marbox," a 20-bp degenerate MarA binding site (3, 11).

The genus Yersinia contains 11 species, of which 3 are human pathogens: Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica (20). Yersinia pestis is the causative agent of bubonic and pneumonic plague. The majority of Y. pestis strains contain three plasmids involved in virulence, as well as the ~102-kb chromosomal pathogenicity locus pgm, specifying genes for a Yersinia-specific iron siderophore and its receptor and hemin adsorption (20). The report of a multidrug-resistant strain (8) and the possible use of Y. pestis as a vehicle for biological warfare have caused increased public health concern.

We asked whether Y. pestis, like other members of the Enterobacteriaceae, contained chromosomal loci, such as marA, involved in multidrug resistance. We identified a Yersinia ortholog of MarA, gene YPO2243 (designated marA47Yp), which produced multidrug resistance in E. coli and in Y. pestis when overexpressed in each host.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and growth conditions. Table 1 shows the bacterial strains and plasmids used in this study. The Y. pestis strain without the pgm pathogenicity locus was approved by the University Institutional Biosafety Committee for studies at the BL2 level. The E. coli strains were grown at 37°C in Luria-Bertani (LB) broth. The Y. pestis strains were grown in brain heart infusion broth (BHI) (Difco) at 26°C and BHI with 5 mM CaCl2 at 37°C. Ampicillin (100 µg/ml), kanamycin (50 µg/ml), and tetracycline (5 µg/ml) were added when necessary. The plasmid pJP105 (22) was used to clone the gene marA47Yp behind the lac promoter, regulated by the plasmid-borne lac repressor. The plasmid pMB102 (21) bearing E. coli marA was used as a positive control. The lacZ promoter was induced with isopropyl-ß-D-thiogalactopyranoside (IPTG) at a final concentration of 0.2 mM. pJPBH was the vector control (24).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids

Cloning of marA47Yp. The primers A47YPF (CCCAAGCTTGGGAATAAAATGATGAGTGAAGACATATTG) and A447YPR (CGGGATCCCGGCGTTAATTCACTGCCATCA) were used at a 50-pmol final concentration to amplify the marA47Yp coding region beginning with the first putative ATG. The PCR used the Taq polymerase (Invitrogen) and conditions recommended by the manufacturer. marA47Yp was directionally cloned into pJP105 between the BamHI and HindIII sites using a 1:1 vector to insert ratio and T4 DNA ligase (New England Biolabs), creating the plasmid pRU1.

Drug susceptibility testing. Drug susceptibilities of strains were determined using E-tests (gift of AB Biodisk, Solna, Sweden). The E. coli strains were tested by incubation at 37°C overnight on LB agar plates with or without IPTG. Y. pestis was examined after incubation for 2 days on BHI agar plates for growth at 26°C or on BHI agar plates with 5 mM CaCl2 for growth at 37°C with or without IPTG.

Organic solvent tolerance. An overnight culture was diluted 1/100 in respective medium (LB or BHI) containing 10 mM MgSO4 and grown at either 37°C or 26°C to an A530 of 0.2. After 10-fold dilutions with phosphate-buffered saline, 5 µl was spotted onto agar plates containing 10 mM MgSO4 and allowed to dry. The plates were flooded with 6 to 8 ml of organic solvent (hexane, cyclohexane, and pentane) under a fume hood and placed in a sealed container. The E. coli cultures were incubated at 30°C overnight and the Y. pestis at room temperature for 2 days.

Isolation of Y. pestis spontaneous mutants. Approximately 4 x 104 cells of an overnight culture of Y. pestis Ev7651F were inoculated into 15 tubes of fresh BHI broth (2 ml) and incubated at 26°C overnight to an A600 of 0.7 to 0.8. One hundred fifty microliters from each tube was plated on BHI agar plates containing 5 µg/ml tetracycline and incubated at 26°C. Over 4 to 5 days, newly appearing colonies were marked on each day. Approximately 75 mutants growing on tetracycline plates were obtained. Five were selected for further study.

RT-PCR. Early-log-phase cultures of Y. pestis EV7651F/RU1, grown at 26°C and 37°C, were further grown in the presence or absence of 0.2 mM IPTG for ~3 h. RNA from the spontaneous mutants was isolated from cultures grown at both 26°C and 37°C without IPTG. RNA isolated using a QIAGEN RNA isolation kit was DNase treated. Reverse transcription (RT)-PCRs were performed using ~500 ng of total RNA. The RT reaction was performed using the Superscript III first-strand synthesis system (Invitrogen) and following the manufacturer's protocol. A minus RT enzyme reaction of each sample served as a negative control.

Real-time PCR. The real-time PCR assay was carried out using the Quantitect SYBR Green PCR kit (QIAGEN). The reactions followed the kits' protocol. The primers either to acrABYp (SACABF-GCCGGTGATCGCCTGATTA and SACABR-ATGGTCGGATATTGCGCTAC), marA47Yp (SA47F-CTATATCCGTGGGCGAGTGT and SA47R-GCTTGATTTCCGGCGTATAA), or YP16s (S16VF-CAGAAGAAGCACCGGCTAAC and S16VR-CGGGGATTTCACATCTGACT) rRNA were used for the real-time PCR carried out in the MX4000 multiplex quantitative PCR system from Stratagene. The annealing temperature for the reactions was 55°C for 30 s. Three individual readings were taken at annealing temperature during plateau and dissociation analysis. Each reaction was performed at least twice. The amount of 16S rRNA from each strain was used to normalize mRNA levels. The CT (threshold cycle) of each gene from the amplification plot was used to calculate the {Delta}CT ({Delta}CT = CT of gene X of parental EV7651F minus CT of gene X of the mutant). The quantity of gene expression was given by q = 2{Delta}CT. The degree of difference in expression of gene X with respect to 16S rRNA was calculated to determine the relative expression of gene X in the mutant compared to that in the wild type.

Western blot analysis. Protein extracts of E. coli and Y. pestis strains were separated by gel electrophoresis and blotted to membranes for Western analysis using anti-E. coli AcrA antibody (gift of H. Zgurskaya, University of Oklahoma), following published methodology (28).


arrow
RESULTS AND DISCUSSION
 
Search for MarA and AcrAB orthologs in Y. pestis genome. A marRAB locus similar to that in E. coli was not found in the genome sequence of Y. pestis CO92 (www.sanger.ac.uk), but a number of coding sequences showing homology to the individual genes, marR and marA, were detected. Genes for four orthologs of the MarA protein were found on the chromosome and one each on the 70-kb virulence and the 100-kb plasmids of Y. pestis. Orthologs of the E. coli membrane efflux pumps AcrAB, AcrEF, and EmrEF were also identified using the respective proteins as query sequences.

Cloning of the marA ortholog of Y. pestis. The attenuated Y. pestis strain EV7651F was used to clone potential marA orthologs. The coding sequence for YPO1737 (36% identity to E. coli MarA) was first chosen because of its size similarity (128 aa) to the E. coli MarA protein. The gene, cloned into plasmid pJP105 downstream of the IPTG-inducible promoter, did not produce any antibiotic resistance in E. coli AG100 or Y. pestis EV7651F when induced by IPTG (data not shown). This lack of activity of a putative MarA homolog was reported earlier for E. coli ykgA, which did not produce multidrug resistance when overexpressed in E. coli (14).

The product of the YPO2243 coding sequence (which we designated marA47Yp), though double in size (297 aa), was next chosen because of the relatively high identity of its N-terminal half to E. coli MarA (47%) and SoxS (46%) and comparatively lower identity to E. coli Rob (32%) (which is similar in size). The MarA47Yp protein has the two helix-turn-helix motifs at its N terminus rather than the C terminus as found for AraC. Figure 1 shows the alignment of the N-terminal region of the MarA47Yp protein with E. coli MarA and other related proteins using the ClustalW program. The phylogenetic tree analysis of proteins examined in Fig. 1 places MarA47Yp next to E. coli MarA (data not shown).


Figure 1
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 1. Alignment of MarA47Yp with MarA and other members of the AraC family. The ClustalW program was used for the alignment of MarA47Yp with other members of AraC family. The shaded and open horizontal boxes represent the helix-turn-helix (HTH) motifs of MarA. The gray shaded residues are the hydrophobic core of the HTH motif, and the black shaded residues determine the sequence specificity. Asterisks mark the residues that interact with the phosphate backbone group of DNA as determined from the structure of E. coli MarA (23). EMarA, E. coli MarA; YPMarA47, Y. pestis ortholog of MarA; RamA, MarA ortholog from Klebsiella pneumoniae; ESoxS, E. coli SoxS; ERob, E. coli Rob; PqrA, MarA ortholog from Proteus vulgaris; EAraC, E. coli AraC.

marA47Yp expression results in multiple drug resistance and organic solvent tolerance in both E. coli and Y. pestis. Plasmid RU1, bearing the cloned marA47Yp gene, was transformed into E. coli and Y. pestis hosts. When induced by IPTG, marA47Yp produced multiple drug resistance and organic solvent tolerance in AG100 (Table 2) with values similar to those for AG100 bearing E. coli marA on the same plasmid vector (pMB102). The vector pJPBH served as a negative control. In addition, E. coli strain AG112, which constitutively expresses marA because of an inactivating mutation in marR, also expressed multidrug resistance as expected. Neither transformant showed resistance to aminoglycosides.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Drug susceptibilities and organic solvent tolerances of E. coli strains with or without marA or marA47Yp

The induction of marA47Yp was also studied in the marRAB-deleted mutant AG100Kan and in a mar soxS rob triple deletion mutant, E. coli N8453. The expression of marA47Yp in both AG100K and N8453 resulted in resistance to multiple antibiotics and organic solvent tolerance (Table 2) comparable to that observed with cloned E. coli marA in AG100Kan and N8453 (Table 2). Thus, marA47Yp can function independently of the intrinsic mar, soxS, and rob genes of E. coli.

In Y. pestis EV7651 IPTG induction of marA47Yp on RU1 led to multidrug resistance at both 26°C (the temperature at which Yersinia grows in fleas) and also at 37°C (temperature in mammalian hosts) (Table 3). Growth under the organic solvent hexane was also noted only in the presence of 0.2 mM IPTG (data not shown). Transformants of EV7651F bearing the vector alone showed no drug or organic solvent resistance.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Drug susceptibilities of Y. pestis EV7651F with vector or pRU1 at 26°C and 37°C (with 5 mM CaCl2)a

The marA47Yp-associated multidrug resistance functions via the AcrAB efflux pump. Cloned marA47Yp on pRU1 transformed into E. coli AG100A (acrAB deletion mutant) neither conferred multidrug resistance nor exhibited tolerance to organic solvents. Western blot analysis of AG100/RU1, AG100Kan/RU1, and N8453/RU1 cell extracts showed increased expression of AcrA only in the presence of IPTG induction of marA47Yp (data not shown). These results imply that MarA47Yp, like MarA, confers multiple drug resistance through the AcrAB efflux pump in E. coli.

To determine whether the induction of marA47Yp in Ev7651F/RU1 also results in expression of acrABYp, real-time PCR was performed (Materials and Methods). The levels of marA47Yp transcripts were 15-fold higher in the presence of 0.2 mM IPTG at both temperatures, while the acrABYp transcript was increased fourfold by 0.2 mM IPTG at both 26°C and 37°C. No difference was observed in the expression of other potential efflux pump genes, acrEFYp, and emrABYp in Ev7651F/RU1 transformants induced with 0.2 mM IPTG (data not shown). This result suggests that induction of multiple-drug resistance by marA47Yp in Y. pestis also functions via the AcrAB efflux pump.

marA47Yp expression is increased in spontaneous multiple-drug-resistant mutants of Y. pestis. Five mutants chosen from independently selected early-log-phase cultures of EV7561F plated on BHI plates containing 5 µg/ml of tetracycline (see Materials and Methods) showed increased levels of resistance to multiple antibiotics. The mutants displayed differences in organic solvent tolerance (Table 4).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Drug susceptibilities, organic solvent tolerances, and real-time PCR data for Y. pestis EV7651F spontaneous tetracycline-selected mutants at 26°C and 37°C (with 5mM CaCl2)

Real-time PCR demonstrated overexpression of acrABYp transcription in all five mutants. All except mutant 55 showed increased expression of marA47Yp at both 26°C and 37°C (Table 4). There was no direct correlation between the level of marA47Yp and acrABYp expression. No change was detected (by real-time PCR) in the levels of acrEFYp and emrABYp expression for any of the mutants compared to those for parental strain EV7651F (data not shown). The enhanced acrABYp expression was confirmed by an increase in the AcrA protein seen in Y. pestis mutants by Western blot analysis using antibody to E. coli AcrA (Fig. 2). The relatively smaller increase in AcrA in mutant 55 was consistent with its relatively lower level of resistance.


Figure 2
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. AcrA expression in multidrug-resistant mutants of Y. pestis. AcrA expression was determined by Western blot assay using anti-AcrA antibodies (see Materials and Methods). E. coli AG100A deleted of acrAB and E. coli AG100B deleted of acrR (overexpressing AcrAB) served as negative and positive controls, respectively.

The isolation of spontaneous multiple-drug resistance mutants of Y. pestis with associated increased expression of marA47Yp further supports the designation of marA47Yp as a functional ortholog of marA in Yersinia.


arrow
ACKNOWLEDGMENTS
 
This work was supported by NIH grant AI56021. R. Udani was supported in part by a National Institutes of Health training grant (T32 DK07542).

We thank Ida Lister for retesting the MICs for strains in Tables 2 and 4 and L. McMurry for helpful comments on the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Center for Adaptation Genetics and Drug Resistance, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-6764. Fax: (617) 636-0458. E-mail: stuart.levy{at}tufts.edu. Back

{dagger} Present address: Prodesse, Inc., W229 N1870 Westwood Dr., Waukesha, WI 53186. Back


arrow
REFERENCES
 
    1
  1. Alekshun, M. N., and S. B. Levy. 1997. Regulation of chromosomally mediated multiple antibiotic resistance: the mar regulon. Antimicrob. Agents Chemother. 41:2067-2075.[Medline]
  2. 2
  3. Ariza, R. R., S. P. Cohen, N. Bachhawat, S. B. Levy, and B. Demple. 1994. Repressor mutations in the marRAB operon that activate oxidative stress genes and multiple antibiotic resistance in Escherichia coli. J. Bacteriol. 176:143-148.[Abstract/Free Full Text]
  4. 3
  5. Barbosa, T. M., and S. B. Levy. 2002. Activation of the Escherichia coli nfnB gene by MarA through a highly divergent marbox in a class II promoter. Mol. Microbiol. 45:191-202.[CrossRef][Medline]
  6. 4
  7. Barbosa, T. M., and S. B. Levy. 2000. Differential expression of over 60 chromosomal genes in Escherichia coli by constitutive expression of MarA. J. Bacteriol. 182:3467-3474.[Abstract/Free Full Text]
  8. 5
  9. Cohen, S. P., H. Hächler, and S. B. Levy. 1993. Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli. J. Bacteriol. 175:1484-1492.[Abstract/Free Full Text]
  10. 6
  11. Cohen, S. P., L. M. McMurry, D. C. Hooper, J. S. Wolfson, and S. B. Levy. 1989. Cross-resistance to fluoroquinolones in multiple-antibiotic-resistant (Mar) Escherichia coli selected by tetracycline or chloramphenicol: decreased accumulation associated with membrane changes in addition to OmpF reduction. Antimicrob. Agents Chemother. 33:1318-1325.[Abstract/Free Full Text]
  12. 7
  13. Cohen, S. P., W. Yan, and S. B. Levy. 1993. A multidrug resistance regulatory locus is widespread among enteric bacteria. J. Infect. Dis. 168:484-488.[Medline]
  14. 8
  15. Galimand, M., A. Guiyoule, G. Gerbaud, B. Rasoamanana, S. Chanteau, E. Carniel, and P. Courvalin. 1997. Multidrug resistance in Yersinia pestis mediated by a transferable plasmid. N. Engl. J. Med. 337:677-680.[Free Full Text]
  16. 9
  17. Gallegos, M.-T., C. Michan, and J. L. Ramos. 1993. The XylS/AraC family of regulators. Nucleic Acids Res. 21:807-809.[Abstract/Free Full Text]
  18. 10
  19. George, A. M., and S. B. Levy. 1983. Gene in the major cotransduction gap of the Escherichia coli K-12 linkage map required for the expression of chromosomal resistance to tetracycline and other antibiotics. J. Bacteriol. 155:541-548.[Abstract/Free Full Text]
  20. 11
  21. Jair, K.-W., R. G. Martin, J. L. Rosner, N. Fujita, A. Ishihama, and R. E. Wolf, Jr. 1995. Purification and regulatory properties of MarA protein, a transcriptional activator of Escherichia coli multiple antibiotic and superoxide resistance promoters. J. Bacteriol. 177:7100-7104.[Abstract/Free Full Text]
  22. 12
  23. Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S1-S8.
  24. 13
  25. Maneewannakul, K., and S. B. Levy. 1996. Identification of mar mutants among quinolone-resistant clinical isolates of Escherichia coli. Antimicrob. Agents Chemother. 40:1695-1698.[Abstract]
  26. 14
  27. Martin, R. G., W. K. Gillette, and J. L. Rosner. 2000. The ykgA gene of Escherichia coli. Mol. Microbiol. 37:978-979.[CrossRef][Medline]
  28. 15
  29. Martin, R. G., and J. L. Rosner. 1995. Binding of purified multiple antibiotic-resistance repressor protein (MarR) to mar operator sequences. Proc. Natl. Acad. Sci. USA 92:5456-5460.[Abstract/Free Full Text]
  30. 16
  31. Martin, R. G., and J. L. Rosner. 2002. Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data. Mol. Microbiol. 44:1611-1624.[CrossRef][Medline]
  32. 17
  33. Meyer, K. F. 1970. Effectiveness of live or killed plague vaccines in man. Bull. W. H. O. 42:653-666.[Medline]
  34. 18
  35. Oethinger, M., W. V. Kern, A. S. Jellen-Ritter, L. M. McMurry, and S. B. Levy. 2000. Ineffectiveness of topoisomerase mutations in mediating clinically significant fluoroquinolone resistance in Escherichia coli in the absence of the AcrAB efflux pump. Antimicrob. Agents Chemother. 44:10-13.[Abstract/Free Full Text]
  36. 19
  37. Okusu, H., D. Ma, and H. Nikaido. 1996. AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. J. Bacteriol. 178:306-308.[Abstract/Free Full Text]
  38. 20
  39. Perry, R. D., and J. D. Fetherston. 1997. Yersinia pestis--Etiologic agent of plague. Clin. Microbiol. Rev. 10:35-66.[Abstract]
  40. 21
  41. Pomposiello, P. J., M. H. Bennik, and B. Demple. 2001. Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate. J. Bacteriol. 183:3890-3902.[Abstract/Free Full Text]
  42. 22
  43. Pomposiello, P. J., and B. Demple. 2000. Identification of SoxS-regulated genes in Salmonella enterica serovar Typhimurium. J. Bacteriol. 182:23-29.[Abstract/Free Full Text]
  44. 23
  45. Rhee, S., R. G. Martin, J. L. Rosner, and D. R. Davies. 1998. A novel DNA-binding motif in MarA: the first structure for an AraC family transcriptional activator. Proc. Natl. Acad. Sci. USA 95:10413-10418.[Abstract/Free Full Text]
  46. 24
  47. Schneiders, T., T. M. Barbosa, L. M. McMurry, and S. B. Levy. 2004. The Escherichia coli transcriptional regulator MarA directly represses transcription of purA and hdeA. J. Biol. Chem. 279:9037-9042.[Abstract/Free Full Text]
  48. 25
  49. Schneiders, T., H. Haechler, and W. Yan. 2005. The mar locus, p. 198-208. In D. G. White, M. N. Alekshun, and P. F. McDermott (ed.), Frontiers in antimicrobial resistance: a tribute to Stuart B. Levy. ASM Press, Washington, D.C.
  50. 26
  51. Seoane, A. S., and S. B. Levy. 1995. Identification of new genes regulated by the marRAB operon in Escherichia coli. J. Bacteriol. 177:530-535.[Abstract/Free Full Text]
  52. 27
  53. Sulavik, M. C., M. Dazer, and P. F. Miller. 1997. The Salmonella typhimurium mar locus: molecular and genetic analysis and assessment of its requirement for virulence. J. Bacteriol. 179:1857-1866.[Abstract/Free Full Text]
  54. 28
  55. Wang, H., J. L. Dzink-Fox, M. Chen, and S. B. Levy. 2001. Genetic characterization of highly fluoroquinolone-resistant clinical Escherichia coli strains from China: role of acrR mutations. Antimicrob. Agents Chemother. 45:1515-1521.[Abstract/Free Full Text]
  56. 29
  57. White, D. G., J. D. Goldman, B. Demple, and S. B. Levy. 1997. Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli. J. Bacteriol. 179:6122-6126.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, September 2006, p. 2971-2975, Vol. 50, No. 9
0066-4804/06/$08.00+0     doi:10.1128/AAC.00015-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Udani, R. A.
Right arrow Articles by Levy, S. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Udani, R. A.
Right arrow Articles by Levy, S. B.