MarA-Like Regulator of Multidrug Resistance in Yersinia pestis

MarA47_Yp from Yersinia pestis, showing 47% identity to Escherichiacoli MarA in its N terminus, caused resistance to antibioticsand to organic solvents when expressed in both E. coli and Y.pestis. Resistance was linked to increased expression of theAcrAB multidrug efflux pump. In four of five spontaneous multidrug-resistantmutants of Y. pestis independently selected by growth on tetracycline,the marA47_Yp gene was overexpressed. The findings suggest thatmarA47_Yp is a marA ortholog in Y. pestis.

INTRODUCTION

Top

Introduction

Multiple-drug resistance in microorganisms is commonly acquiredthrough plasmids, transposons, or integrons specifying differentgenes for resistance (12). Alternatively, mutations in chromosomalgenes may produce resistance to a wide variety of antibioticsand other toxic substances. One such chromosomal locus, themar (multiple antibiotic resistance) locus in Escherichia coliand other enteric bacteria, results in resistance to multipleantibiotics, oxidative stress agents, organic solvents, anddisinfectant products (1, 2, 6, 7, 10, 27, 29).

In E. coli, the mar locus encodes the marRAB operon (5), specifyingMarR, which represses the operon by binding to marO (15), andMarA, which positively regulates the operon and affects expressionof the Mar phenotype and many other chromosomal genes throughboth activation and repression (4, 16, 21, 24-26). marB specifiesa small putative protein of unknown function (5). Multidrugresistance is principally caused by MarA-mediated overexpressionof the acrAB efflux system (19).

E. coli MarA is a member of the XylS/AraC family of transcriptionalactivators which contain two helix-turn-helix motifs (9). Mostlarger members (>250 amino acids [aa]) also possess an effectordomain at either the N or C terminus of the protein (9). MarA,a 129-amino-acid protein, lacks the effector domain. MarA controlof other chromosomal genes occurs via binding to the "marbox,"a 20-bp degenerate MarA binding site (3, 11).

The genus Yersinia contains 11 species, of which 3 are humanpathogens: Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica(20). Yersinia pestis is the causative agent of bubonic andpneumonic plague. The majority of Y. pestis strains containthree plasmids involved in virulence, as well as the $~$ 102-kbchromosomal pathogenicity locus pgm, specifying genes for aYersinia-specific iron siderophore and its receptor and heminadsorption (20). The report of a multidrug-resistant strain(8) and the possible use of Y. pestis as a vehicle for biologicalwarfare have caused increased public health concern.

We asked whether Y. pestis, like other members of the Enterobacteriaceae,contained chromosomal loci, such as marA, involved in multidrugresistance. We identified a Yersinia ortholog of MarA, geneYPO2243 (designated marA47_Yp), which produced multidrug resistancein E. coli and in Y. pestis when overexpressed in each host.

MATERIALS AND METHODS

Top

Materials and Methods

Bacterial strains, plasmids, and growth conditions. Table 1 shows the bacterial strains and plasmids used in thisstudy. The Y. pestis strain without the pgm pathogenicity locuswas approved by the University Institutional Biosafety Committeefor studies at the BL2 level. The E. coli strains were grownat 37°C in Luria-Bertani (LB) broth. The Y. pestis strainswere grown in brain heart infusion broth (BHI) (Difco) at 26°Cand BHI with 5 mM CaCl₂ at 37°C. Ampicillin (100 µg/ml),kanamycin (50 µg/ml), and tetracycline (5 µg/ml)were added when necessary. The plasmid pJP105 (22) was usedto clone the gene marA47_Yp behind the lac promoter, regulatedby the plasmid-borne lac repressor. The plasmid pMB102 (21)bearing E. coli marA was used as a positive control. The lacZpromoter was induced with isopropyl-ß-D-thiogalactopyranoside(IPTG) at a final concentration of 0.2 mM. pJPBH was the vectorcontrol (24).

View this table:
[in this window]
[in a new window]
TABLE 1. Bacterial strains and plasmids

Cloning of marA47_Yp. The primers A47YPF (CCCAAGCTTGGGAATAAAATGATGAGTGAAGACATATTG)and A447YPR (CGGGATCCCGGCGTTAATTCACTGCCATCA) were used at a50-pmol final concentration to amplify the marA47_Yp coding regionbeginning with the first putative ATG. The PCR used the Taqpolymerase (Invitrogen) and conditions recommended by the manufacturer.marA47_Yp was directionally cloned into pJP105 between the BamHIand HindIII sites using a 1:1 vector to insert ratio and T4DNA ligase (New England Biolabs), creating the plasmid pRU1.

Drug susceptibility testing. Drug susceptibilities of strains were determined using E-tests(gift of AB Biodisk, Solna, Sweden). The E. coli strains weretested by incubation at 37°C overnight on LB agar plateswith or without IPTG. Y. pestis was examined after incubationfor 2 days on BHI agar plates for growth at 26°C or on BHIagar plates with 5 mM CaCl₂ for growth at 37°C with or withoutIPTG.

Organic solvent tolerance. An overnight culture was diluted 1/100 in respective medium(LB or BHI) containing 10 mM MgSO₄ and grown at either 37°Cor 26°C to an A₅₃₀ of 0.2. After 10-fold dilutions withphosphate-buffered saline, 5 µl was spotted onto agarplates containing 10 mM MgSO₄ and allowed to dry. The plateswere flooded with 6 to 8 ml of organic solvent (hexane, cyclohexane,and pentane) under a fume hood and placed in a sealed container.The E. coli cultures were incubated at 30°C overnight andthe Y. pestis at room temperature for 2 days.

Isolation of Y. pestis spontaneous mutants. Approximately 4 x 10⁴ cells of an overnight culture of Y. pestisEv7651F were inoculated into 15 tubes of fresh BHI broth (2ml) and incubated at 26°C overnight to an A₆₀₀ of 0.7 to0.8. One hundred fifty microliters from each tube was platedon BHI agar plates containing 5 µg/ml tetracycline andincubated at 26°C. Over 4 to 5 days, newly appearing colonieswere marked on each day. Approximately 75 mutants growing ontetracycline plates were obtained. Five were selected for furtherstudy.

RT-PCR. Early-log-phase cultures of Y. pestis EV7651F/RU1, grown at26°C and 37°C, were further grown in the presence orabsence of 0.2 mM IPTG for $~$ 3 h. RNA from the spontaneous mutantswas isolated from cultures grown at both 26°C and 37°Cwithout IPTG. RNA isolated using a QIAGEN RNA isolation kitwas DNase treated. Reverse transcription (RT)-PCRs were performedusing $~$ 500 ng of total RNA. The RT reaction was performed usingthe Superscript III first-strand synthesis system (Invitrogen)and following the manufacturer's protocol. A minus RT enzymereaction of each sample served as a negative control.

Real-time PCR. The real-time PCR assay was carried out using the QuantitectSYBR Green PCR kit (QIAGEN). The reactions followed the kits'protocol. The primers either to acrAB_Yp (SACABF-GCCGGTGATCGCCTGATTAand SACABR-ATGGTCGGATATTGCGCTAC), marA47_Yp (SA47F-CTATATCCGTGGGCGAGTGTand SA47R-GCTTGATTTCCGGCGTATAA), or YP16s (S16VF-CAGAAGAAGCACCGGCTAACand S16VR-CGGGGATTTCACATCTGACT) rRNA were used for the real-timePCR carried out in the MX4000 multiplex quantitative PCR systemfrom Stratagene. The annealing temperature for the reactionswas 55°C for 30 s. Three individual readings were takenat annealing temperature during plateau and dissociation analysis.Each reaction was performed at least twice. The amount of 16SrRNA from each strain was used to normalize mRNA levels. TheC_T (threshold cycle) of each gene from the amplification plotwas used to calculate the ${Delta}$ C_T ( ${Delta}$ C_T = C_T of gene X of parentalEV7651F minus C_T of gene X of the mutant). The quantity of geneexpression was given by q = 2 ${Delta}$ ^C_T. The degree of difference inexpression of gene X with respect to 16S rRNA was calculatedto determine the relative expression of gene X in the mutantcompared to that in the wild type.

Western blot analysis. Protein extracts of E. coli and Y. pestis strains were separatedby gel electrophoresis and blotted to membranes for Westernanalysis using anti-E. coli AcrA antibody (gift of H. Zgurskaya,University of Oklahoma), following published methodology (28).

RESULTS AND DISCUSSION

Top

Results and Discussion

Search for MarA and AcrAB orthologs in Y. pestis genome. A marRAB locus similar to that in E. coli was not found in thegenome sequence of Y. pestis CO92 (www.sanger.ac.uk), but anumber of coding sequences showing homology to the individualgenes, marR and marA, were detected. Genes for four orthologsof the MarA protein were found on the chromosome and one eachon the 70-kb virulence and the 100-kb plasmids of Y. pestis.Orthologs of the E. coli membrane efflux pumps AcrAB, AcrEF,and EmrEF were also identified using the respective proteinsas query sequences.

Cloning of the marA ortholog of Y. pestis. The attenuated Y. pestis strain EV7651F was used to clone potentialmarA orthologs. The coding sequence for YPO1737 (36% identityto E. coli MarA) was first chosen because of its size similarity(128 aa) to the E. coli MarA protein. The gene, cloned intoplasmid pJP105 downstream of the IPTG-inducible promoter, didnot produce any antibiotic resistance in E. coli AG100 or Y.pestis EV7651F when induced by IPTG (data not shown). This lackof activity of a putative MarA homolog was reported earlierfor E. coli ykgA, which did not produce multidrug resistancewhen overexpressed in E. coli (14).

The product of the YPO2243 coding sequence (which we designatedmarA47_Yp), though double in size (297 aa), was next chosen becauseof the relatively high identity of its N-terminal half to E.coli MarA (47%) and SoxS (46%) and comparatively lower identityto E. coli Rob (32%) (which is similar in size). The MarA47_Ypprotein has the two helix-turn-helix motifs at its N terminusrather than the C terminus as found for AraC. Figure 1 showsthe alignment of the N-terminal region of the MarA47_Yp proteinwith E. coli MarA and other related proteins using the ClustalWprogram. The phylogenetic tree analysis of proteins examinedin Fig. 1 places MarA47_Yp next to E. coli MarA (data not shown).

View larger version (48K):
[in this window]
[in a new window]
FIG. 1. Alignment of MarA47_Yp with MarA and other members of the AraC family. The ClustalW program was used for the alignment of MarA47_Yp with other members of AraC family. The shaded and open horizontal boxes represent the helix-turn-helix (HTH) motifs of MarA. The gray shaded residues are the hydrophobic core of the HTH motif, and the black shaded residues determine the sequence specificity. Asterisks mark the residues that interact with the phosphate backbone group of DNA as determined from the structure of E. coli MarA (23). EMarA, E. coli MarA; YPMarA47, Y. pestis ortholog of MarA; RamA, MarA ortholog from Klebsiella pneumoniae; ESoxS, E. coli SoxS; ERob, E. coli Rob; PqrA, MarA ortholog from Proteus vulgaris; EAraC, E. coli AraC.

marA47_Yp expression results in multiple drug resistance and organic solvent tolerance in both E. coli and Y. pestis. Plasmid RU1, bearing the cloned marA47_Yp gene, was transformedinto E. coli and Y. pestis hosts. When induced by IPTG, marA47_Ypproduced multiple drug resistance and organic solvent tolerancein AG100 (Table 2) with values similar to those for AG100 bearingE. coli marA on the same plasmid vector (pMB102). The vectorpJPBH served as a negative control. In addition, E. coli strainAG112, which constitutively expresses marA because of an inactivatingmutation in marR, also expressed multidrug resistance as expected.Neither transformant showed resistance to aminoglycosides.

View this table:
[in this window]
[in a new window]
TABLE 2. Drug susceptibilities and organic solvent tolerances of E. coli strains with or without marA or marA47_Yp

The induction of marA47_Yp was also studied in the marRAB-deletedmutant AG100Kan and in a mar soxS rob triple deletion mutant,E. coli N8453. The expression of marA47_Yp in both AG100K andN8453 resulted in resistance to multiple antibiotics and organicsolvent tolerance (Table 2) comparable to that observed withcloned E. coli marA in AG100Kan and N8453 (Table 2). Thus, marA47_Ypcan function independently of the intrinsic mar, soxS, and robgenes of E. coli.

In Y. pestis EV7651 IPTG induction of marA47_Yp on RU1 led tomultidrug resistance at both 26°C (the temperature at whichYersinia grows in fleas) and also at 37°C (temperature inmammalian hosts) (Table 3). Growth under the organic solventhexane was also noted only in the presence of 0.2 mM IPTG (datanot shown). Transformants of EV7651F bearing the vector aloneshowed no drug or organic solvent resistance.

View this table:
[in this window]
[in a new window]
TABLE 3. Drug susceptibilities of Y. pestis EV7651F with vector or pRU1 at 26°C and 37°C (with 5 mM CaCl₂)^a

The marA47_Yp-associated multidrug resistance functions via the AcrAB efflux pump. Cloned marA47_Yp on pRU1 transformed into E. coli AG100A (acrABdeletion mutant) neither conferred multidrug resistance norexhibited tolerance to organic solvents. Western blot analysisof AG100/RU1, AG100Kan/RU1, and N8453/RU1 cell extracts showedincreased expression of AcrA only in the presence of IPTG inductionof marA47_Yp (data not shown). These results imply that MarA47_Yp,like MarA, confers multiple drug resistance through the AcrABefflux pump in E. coli.

To determine whether the induction of marA47_Yp in Ev7651F/RU1also results in expression of acrAB_Yp, real-time PCR was performed(Materials and Methods). The levels of marA47_Yp transcriptswere 15-fold higher in the presence of 0.2 mM IPTG at both temperatures,while the acrAB_Yp transcript was increased fourfold by 0.2 mMIPTG at both 26°C and 37°C. No difference was observedin the expression of other potential efflux pump genes, acrEF_Yp,and emrAB_Yp in Ev7651F/RU1 transformants induced with 0.2 mMIPTG (data not shown). This result suggests that induction ofmultiple-drug resistance by marA47_Yp in Y. pestis also functionsvia the AcrAB efflux pump.

marA47_Yp expression is increased in spontaneous multiple-drug-resistant mutants of Y. pestis. Five mutants chosen from independently selected early-log-phasecultures of EV7561F plated on BHI plates containing 5 µg/mlof tetracycline (see Materials and Methods) showed increasedlevels of resistance to multiple antibiotics. The mutants displayeddifferences in organic solvent tolerance (Table 4).

View this table:
[in this window]
[in a new window]
TABLE 4. Drug susceptibilities, organic solvent tolerances, and real-time PCR data for Y. pestis EV7651F spontaneous tetracycline-selected mutants at 26°C and 37°C (with 5mM CaCl₂)

Real-time PCR demonstrated overexpression of acrAB_Yp transcriptionin all five mutants. All except mutant 55 showed increased expressionof marA47_Yp at both 26°C and 37°C (Table 4). There wasno direct correlation between the level of marA47_Yp and acrAB_Ypexpression. No change was detected (by real-time PCR) in thelevels of acrEF_Yp and emrAB_Yp expression for any of the mutantscompared to those for parental strain EV7651F (data not shown).The enhanced acrAB_Yp expression was confirmed by an increasein the AcrA protein seen in Y. pestis mutants by Western blotanalysis using antibody to E. coli AcrA (Fig. 2). The relativelysmaller increase in AcrA in mutant 55 was consistent with itsrelatively lower level of resistance.

View larger version (31K):
[in this window]
[in a new window]
FIG. 2. AcrA expression in multidrug-resistant mutants of Y. pestis. AcrA expression was determined by Western blot assay using anti-AcrA antibodies (see Materials and Methods). E. coli AG100A deleted of acrAB and E. coli AG100B deleted of acrR (overexpressing AcrAB) served as negative and positive controls, respectively.

The isolation of spontaneous multiple-drug resistance mutantsof Y. pestis with associated increased expression of marA47_Ypfurther supports the designation of marA47_Yp as a functionalortholog of marA in Yersinia.

ACKNOWLEDGMENTS

This work was supported by NIH grant AI56021. R. Udani was supportedin part by a National Institutes of Health training grant (T32DK07542).

We thank Ida Lister for retesting the MICs for strains in Tables2 and 4 and L. McMurry for helpful comments on the manuscript.

FOOTNOTES

* Corresponding author. Mailing address: Center for Adaptation Genetics and Drug Resistance, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-6764. Fax: (617) 636-0458. E-mail: stuart.levy{at}tufts.edu.

Present address: Prodesse, Inc., W229 N1870 Westwood Dr., Waukesha,WI 53186.

REFERENCES

Top