Plasmid-Mediated Imipenem-Hydrolyzing Enzyme KPC-2 among Multiple Carbapenem-Resistant Escherichia coli Clones in Israel

Carbapenem resistance in Escherichia coli is rare. We reportfour genetically unrelated carbapenem-resistant E. coli isolatescultured from four patients hospitalized in Tel Aviv MedicalCenter. PCR, sequencing, and Southern blot analysis identifiedKPC-2 as the imipenem-hydrolyzing enzyme in all four strains,carried on different plasmids with a possible common origin.This is the first discovery of KPC-2 in E. coli and the firstreport of this enzyme originating outside the United States.

INTRODUCTION

Top

Introduction

Carbapenem resistance in Escherichia coli does not occur naturally,and acquired resistance is rare in this species (15). Few casesof carbapenem-resistant E. coli strains have been reported.The first reported case in 1999 described the occurrence ofouter-membrane protein deficiency coupled with the plasmid-mediatedclass C ß-lactamase CMY (17). Carbapenem-hydrolyzing,plasmid-mediated metallo-ß-lactamases in clinicalE. coli strains from various parts of the world have been reported(6, 11, 16, 19), but class A carbapenemases in E. coli havebeen described in only one case, involving KPC-3 acquisitionin a patient in the United States during imipenem therapy (7).

A high prevalence of extended-spectrum-ß-lactamase-producingE. coli clinical isolates has been observed and studied in ourinstitution (5), but carbapenem resistance in this species hasnever been observed. In February 2005, an imipenem-resistantE. coli strain (MIC, 32 µg/ml) was isolated from a urineculture from a 75-year-old woman with multiple chronic illnesseshospitalized at Tel Aviv Medical Center due to syncope. DuringSeptember and October 2005, three additional carbapenem-resistantE. coli isolates were isolated at our hospital. We examinedthe epidemiological and genetic relatedness and the clinicalscenario as well as the enzymatic mechanism leading to thisresistance.

MATERIALS AND METHODS

Top

Materials and Methods

Setting, bacterial strains, and antibiotic susceptibility testing. Tel Aviv Medical Center is a 1,200-bed tertiary care teachinghospital, with 70,000 admissions annually. Four clinical isolatesof Escherichia coli were isolated from four patients hospitalizedduring 2005 in our institution. The patients' relevant clinicaldata were collected from their medical records. Antibiotic susceptibilitieswere determined by Vitek-2 (BioMerieux Inc., Marcy, France).MICs of all carbapenems (imipenem, meropenem, and ertapenem)were determined by Etest (AB Biodisk, Solna, Sweden).

PFGE. The genetic relatedness of the four E. coli isolates was analyzedby pulsed-field gel electrophoresis (PFGE). Bacterial DNA wasprepared and cleaved with 20U SpeI endonuclease (New EnglandBiolabs, Boston, MA) as previously described (5), and DNA macrorestrictionpatterns were visually compared and interpreted according tothe criteria established by Tenover et al. (18).

Carbapenemase analysis and IEF of ß-lactamases. Visualization of imipenem-hydrolyzing ß-lactamaseactivity by the E. coli clinical isolates was performed by animipenem inactivation bioassay (21) performed on Mueller-Hintonagar plates (Hy-Labs, Rehovot, Israel), with E. coli ATCC 25922as the test strain and an imipenem-susceptible E. coli strainas a negative control for carbapenemase production. Screeningfor production of metallo-ß-lactamase was done bydisk approximation tests with EDTA and 2-mercaptopropionic acid(1). Analytical isoelectric focusing (IEF) of ß-lactamaseswas performed with crude enzyme preparations from sonicatedcell cultures of E. coli isolates and transformants, grown ontryptic soy broth (Biolife Italiana, Milano, Italy). IEF wasperformed according to the method of Matthew et al. (10), byuse of an LKB Multiphor II electrophoresis system apparatuson prepared PAGplates (pH 3.5 to 9.5; Amersham Biosciences,Buckinghamshire, United Kingdom). Beta-lactamase activity wasrevealed with nitrocefin (0.5 mg/ml; Calbiochem-NovabiochemCorp., San Diego, CA), and pIs were determined by running ß-lactamaseswith known pIs in parallel as controls.

Screening of carbapenemase genes and cloning and sequencing of bla_KPC. Identification of the carbapenemase genes was determined byPCR, with specific primers designed for identification of knownclass A ß-lactamase genes, including bla_KPC (4), bla_SME(forward, ACTTTGATGGGAGGATTGGCGTCT; reverse, ACCCAATCAGCAGGAACACTAGCA),bla_IMI (forward, TCTCACAGGCCAATACAAAGGGCA; reverse, CCGCATAATCATTTGCCGTACCGT),and bla_NMC (forward, TAGGTGATATGGCTGCTGCTGCTT; reverse, ACTGCTGCAGGTGTAGATGTGTCA).

The PCR conditions were as follows: 15 min at 95°C and 35cycles of 1 min at 94°C, 2 min at 68°C, and 3 min at72°C, followed by an extension step of 10 min at 72°C.PCRs were performed with Hot-StarTaq DNA polymerase (QIAGEN,Hilden, Germany), and the resulting PCR products were analyzedin a 1% agarose gel. Full-length bla_KPC PCR products were ligatedinto pGEM-T easy PCR cloning vector and transformed into competentcells of E. coli JM109 according to the manufacturer's instructions(Promega, WI). Sequencing of cloned genes was performed withSP6 and T7 promoter primers. Sequences were analyzed with anABI PRISM 3100 genetic analyzer (PE Biosystems), using DNA sequencinganalysis software and 3100 data collection software version1.1. The nucleotide acid and deduced protein sequences wereanalyzed and compared by use of software available via the Internetat the NCBI website (http://www.ncbi.nlm.nih.gov/).

Transformation experiments, plasmid purification, and Southern analysis. Plasmid DNA from E. coli strains was isolated by use of a QIAGENplasmid DNA midi kit (QIAGEN, Hilden, Germany) according tothe manufacturer's instructions, and plasmid DNA samples wereelectrophoresed on 0.8% agarose gels in the presence of 1.0TAE (Tris-acetate-EDTA) buffer. Transformation experiments withE. coli strain DH5 ${alpha}$ were carried out by electroporation of plasmidDNA with an Electroporator 2510 (Eppendorf, Hamburg, Germany),and transformants were selected on LB agar plates containing100 µg/ml AMP. For Southern blot analysis, plasmid DNAfrom donor E. coli strains and their transformants was digestedwith BglII, EcoRV, and SmaI endonucleases (New England Biolabs),electrophoresed, transferred to a Hybond N⁺ membrane (AmershamBiosciences, Buckinghamshire, United Kingdom), and cross-linkedwith UV light. bla_KPC-2 radioactively labeled with random-primer-DNA-labelingmixture (Biological Industries, Beit Haemek, Israel) was usedas a probe.

RESULTS

Top

Results

Patients' background, antibiotic susceptibilities, and genetic relatedness. Carbapenem-resistant E. coli was initially identified at TelAviv Medical Center in February 2005 and was subsequently isolatedfrom three additional patients during September and October2005. This represents an incidence rate of 5.7 cases/100,000admissions and a proportion of resistance to carbapenem amongE. coli isolates of 0.15%. While these isolates were culturedfrom patients with different clinical backgrounds (Table 1),they were all chronically ill, with extensive exposure to themedical system. Nevertheless, they were hospitalized in differentwards and cared for by different staff members, and no commonepidemiological link between them was identified. No apparentcontact between the patients or travel to the east coast ofthe United States was documented.

View this table:
[in this window]
[in a new window]
TABLE 1. Details of patient from whom imipenem-resistant E. coli was isolated^a

PFGE revealed four different SpeI endonuclease-restricted DNAprofiles, with band difference greater than seven, indicatingthat all four strains were genetically unrelated (18). Threeof the patients had recent antibiotic exposure, but only onewas treated with carbapenems before E. coli was isolated.

All isolates were multidrug resistant, with different antibioticsusceptibilities (Table 2). All strains were resistant to ertapenem,three were imipenem resistant and one imipenem intermediate,and three were meropenem resistant and one meropenem susceptible.

View this table:
[in this window]
[in a new window]
TABLE 2. Antibiotic susceptibilities of E. coli clinical strains and their transformants

Detection of a carbapenem-hydrolyzing ß-lactamase. Crude enzyme preparations of all four E. coli strains showedalterations in the shapes of the zones of inhibition arounda susceptible E. coli test organism, indicating the productionof a ß-lactamase with imipenem hydrolysis activity.Phenotypic screening for metallo-ß-lactamase was negativein all four strains. IEF showed production of various ß-lactamases(Fig. 1A, lanes D), with two distinct bands observed in allfour strains migrating as bla_TEM (pI 5.4) and a ß-lactamasemigrating with a pI of 6.7. Isolates 157 and 360 expressed twoadditional ß-lactamases with pIs of 7.4 and above9.0, and isolate 329 showed a ß-lactamase with a pIof 7.9.

View larger version (35K):
[in this window]
[in a new window]
FIG. 1. IEF, plasmid DNA, and Southern blot analysis of the four KPC-2-producing, carbapenem-resistant E. coli strains (lanes D) and their respective transformants (lanes T). (A) M, pI marker. (B) Lane 9, plasmid AFF2 (85 kb) as a molecular-size marker. (C) Restriction pattern of plasmid DNA from E. coli transformants of strains 157, 329, 339, and 360. Lane 13, lambda DNA digested with HindIII; lane 14, 1-kb DNA ladder (Fermentas). (D) Southern blot analysis of plasmid DNA of strain 360 digested with BglII, EcoRV, or SmaI endonucleases (recognizes position 790 of the OPR of bla_KPC-2), respectively, and hybridized with a KPC-2 probe.

Analysis and transfer of KPC-2-encoding plasmid DNA. Plasmid DNA analysis of the E. coli strains revealed a differentband pattern, with a plasmid of >85 kb in three of four strains(Fig. 1B). Transformation of plasmid extracts into E. coli DH5 ${alpha}$ succeeded, and PCR on plasmid DNA isolated from transformedcolonies followed by cloning and sequencing confirmed the presenceof bla_KPC-2. ß-lactamase extracts from all four transformantssubjected to IEF showed one distinct band focusing at pI 6.7,corresponding to the pI of KPC-2 (2) (Fig. 1A, lanes T). Transferof the KPC-2-encoding plasmids raised the MICs of extended-spectrumcephalosporins, aztreonam, and carbapenems compared to whatwas found for the susceptible E. coli DH5 ${alpha}$ , but none of the transformantsbecame resistant to imipenem or meropenem (Table 1). Other PCR-screeningreactions using specific primers for known class A carbapenemaseswere all negative.

Plasmid analysis of all four transformants indicated that eachhad acquired a single plasmid (Fig. 1B, lanes T), with the largestplasmid transferred from parent strain 157 (Fig. 1B, lane 2).Plasmids from strains 329 and 339 appeared similar in size (Fig.1B, lanes 4 and 6, respectively). Restriction analysis usingvarious endonucleases (Fig. 1C) showed different restrictionprofiles, but clear similarities (BglII and EcoRV) and evenidentity (Sma) in the band patterns were noticeable, suggestingthe possibility of a common origin. Strain 157 exhibited a uniquerestriction pattern (Fig. 1C). Southern blot analysis usinga bla_KPC-2 probe following restriction with BglII, EcoRV, orSmaI, which digests bla_KPC-2 at nucleotide 790, proved the presenceof bla_KPC-2 in the transferred plasmids (Fig. 1D). AlthoughKPC-2-encoding plasmids in the parent strains differed, hybridizationwas positive at the same position on the blot for each strain(hybridization results are presented only for strain 360 asa representative), supporting the possibility that the plasmidsshared a large fragment that contained the gene.

DISCUSSION

Top

Discussion

Our study is the first to report on KPC-2 in E. coli clinicalstrains and the first to report KPC-2 outside the United Stateswithout an apparent U.S. origin. The enzyme was found in fourgenetically unrelated carbapenem-resistant isolates of E. colifrom four epidemiologically unrelated patients. Three of thepatients had been treated recently with antibiotics but onlyone with a carbapenem. The KPC-2 gene was carried on four differentplasmids that contained a common encoding element and probablyhad a common origin.

Transfer of these plasmids to a susceptible E. coli strain increasedthe imipenem MIC significantly but did not confer complete resistance,suggesting that an additional mechanism is involved in carbapenemresistance in these strains. Among the possibilities for sucha mechanism are porin alterations, which reduce the entry ofcarbapenems into the cell, as has been shown mainly for imipenem-resistantKlebsiella pneumoniae strains (9, 20) or efflux pumps, a mechanismmore common in nonfermenters, such as Pseudomonas aeruginosaand Acinetobacter.

KPC-2 was originally identified in K. pneumoniae strains fromMaryland in 2003 (13), and since then, it has been identifiedin a Salmonella strain from the same area (12), in an Enterobacterstrain from Boston (8), and in K. pneumoniae strains from NewYork (3). KPC class A ß-lactamases have been reportedto date only in the United States or as originating in the UnitedStates, as in the case of the Klebsiella pneumoniae strain inFrance that was likely acquired by a patient during hospitalizationin New York (14). Our study is the first to report KPC-2 outsidethe United States without an apparent U.S. origin.

PFGE indicated that these E. coli strains were genetically unrelated.Epidemiological investigation revealed that two of the fourclinical strains were not acquired in the hospital and werelikely imported from two different chronic-health-care facilities,posing the worrying problem of fluctuation of carbapenem resistancein and out of the hospital setting.

Carbapenem resistance in E. coli remains rare, and therefore,at present, there are no clinical outcome data on infectionscaused by these strains. In our cases, carbapenem treatmentdid not seem to be a prerequisite for the isolation of carbapenem-resistantE. coli. Nevertheless, the existence of the KPC-2 gene on plasmidsthat may carry additional antibiotic resistance determinantsposes the possibility of dissemination of this carbapenem-encodinggene between and among species.

ACKNOWLEDGMENTS

This work was supported in part by a grant from the Israel-UnitedStates Binational Science Foundation.

FOOTNOTES

* Corresponding author. Mailing address: Division of Epidemiology, Tel Aviv Sourasky Medical Center, 6 Weizmann St., Tel Aviv 64239, Israel. Phone: 972 3 692 5644. Fax: 972 3 697 4966. E-mail: shiri_nv{at}tasmc.health.gov.il.

REFERENCES

Top