Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2007, p. 3830-3835, Vol. 51, No. 11
0066-4804/07/$08.00+0 doi:10.1128/AAC.00360-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Dietary Inclusion of Colicin E1 Is Effective in Preventing Postweaning Diarrhea Caused by F18-Positive Escherichia coli in Pigs
S. A. Cutler,1
S. M. Lonergan,1
N. Cornick,2
A. K. Johnson,1 and
C. H. Stahl3*
Department of Animal Science, Iowa State University, Ames, Iowa,1
Veterinary Microbiology and Preventive Medicine, Iowa State University, Ames, Iowa,2
Department of Animal Science, North Carolina State University, Raleigh, North Carolina3
Received 17 March 2007/
Returned for modification 7 May 2007/
Accepted 19 August 2007

ABSTRACT
With worldwide concern over the use of antibiotics in animal
agriculture and their contribution to the spread of antibiotic
resistance, alternatives to conventional antibiotics are needed.
Previous research in our laboratories has shown that colicin
E1 is effective against some
Escherichia coli strains responsible
for postweaning diarrhea (PWD) in vitro. In this study we examined
the efficacy of the dietary inclusion of colicin E1 in preventing
experimentally induced PWD caused by F18-positive enterotoxigenic
E. coli in young pigs. Twenty-four weaned pigs (23 days of age),
identified by genotyping to be susceptible to F18-positive
E. coli infections, were individually housed and fed diets containing
0, 11, or 16.5 mg colicin E1/kg diet. Two days after the start
of the trial, all animals were orally inoculated with 1
x 10
9 CFU of each of two F18-positive
E. coli strains isolated from
pigs with PWD. The dietary inclusion of colicin E1 decreased
the incidence and severity of PWD caused by F18-positive enterotoxigenic
E. coli and improved the growth performance of the piglets.
Additionally, the reduced incidence of PWD due to dietary colicin
E1, lowered the levels of expression of the genes for interleukin
1ß and tumor necrosis factor beta in ileal tissues
from these animals. The dietary inclusion of colicin E1 may
be an effective alternative to conventional antibiotics in the
diets of weaning pigs for the prevention of PWD caused by F18-positive
enterotoxigenic
E. coli.

INTRODUCTION
Postweaning diarrhea (PWD) is a serious threat to the economic
success of the swine industry both due to losses as a result
of mortalities and due to the reduced growth performance of
surviving pigs. It is estimated that 50% of piglet mortality
due to diarrhea is attributable to the causative agent of PWD,
enterotoxigenic
Escherichia coli (ETEC) (
18). The ETEC strains
most commonly associated with PWD possess either the F4 or the
F18 fimibrial type (
11,
39). As a result of the significant
impact that F18-positive ETEC and other bacterial infections
can have on pig production, prophylactic antibiotics are frequently
included in the diets of young pigs in an attempt to prevent
ETEC colonization and the resulting PWD. An estimated 78% of
large swine farms in the United States include subtherapeutic
concentrations of antibiotics in the diets for young pigs (
36).
Despite the use of antibiotic prophylaxis, 40.7% of these farms
reported the occurrence of diarrhea caused by
E. coli infections
(
36). The lack of the effective prevention of PWD with the use
of prophylactic antibiotics is not surprising because of the
frequency and spectrum of antibiotic resistance seen among ETEC
strains (
7,
23,
25). It is expected that antibiotic resistance
will further increase among these strains, based on the overall
increase in resistance to antibiotics by ETEC strains over the
last 20 years (
25).
With worldwide concern over the use of prophylactic antibiotics in animal agriculture and its contribution to the spread of antibiotic resistance (12, 34, 38), the development of alternatives to conventional antibiotics is urgently needed to protect swine from these E. coli infections. Public concerns surrounding the antibiotic resistance issue led to the elimination of prophylactic antibiotic use in animal agriculture in Denmark (20, 34). This cessation of the use of prophylactic antibiotics in pig production caused increases in the rate of PWD and a 30% increase in piglet mortality (34). These infections led to a large increase in veterinarian-prescribed antibiotic use in Denmark's swine industry (35). The switch from growth-promoting or prophylactic antibiotic usage to veterinarian-prescribed therapeutic usage resulted in only a very modest reduction, if any, in total antibiotic usage in Denmark's swine industry (35). In order to realize a true reduction in antibiotic use in animal agriculture, effective alternative therapies must be developed.
A potential alternative to conventional antibiotics that holds a great deal of promise are colicins. Colicins are a class of bacteriocins produced by and effective against E. coli and closely related bacteria (14). Pore-forming colicins, such as colicin E1, bind to their target bacteria and kill them by disrupting the ionic gradient of the cell (14). These proteins are particularly attractive for use as an alternative to conventional antibiotics for the control of E. coli-caused PWD for several reasons. We have previously shown them to be effective against ETEC strains isolated from pigs with PWD in vitro (33), and other work has demonstrated that colicin E1 is effective against a wide range of E. coli strains (22, 27, 30). They are also not related to any antibiotics that are currently being used in human medicine. Additionally, colicins would not be absorbed intact by the animals, thereby eliminating concerns over the presence of antibiotic residues in meat, and colicins could be effective at concentrations low enough to not significantly alter the nutrient density of the diet. The objective of this study was to determine the efficacy of the dietary inclusion of colicin E1 in preventing PWD due to F18-positive ETEC.

MATERIALS AND METHODS
Colicin production.
Colicin E1 was produced and purified to homogeneity by the method
of Stahl et al. (
33). Briefly, a colicin E1-producing strain
of
E. coli was grown in LB medium, and colicin production was
induced by the addition of mitomycin C (EMD Biosciences, San
Diego, CA) to the medium. The colicin E1 was purified from the
cell-free supernatant by ion-exchange chromatography, first
by using DEAE cellulose (Sigma-Aldrich, St. Louis, MO) and then
by further purifying the protein with Q Sepharose (GE Healthcare,
Piscataway, NJ). The purity of the colicin E1 used in this study
has been visualized by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis and is estimated to be over 95% pure (
30).
ETEC challenge strains.
Escherichia coli F18-producing strains 2144 (O147:NM, where NM indicates nonmotile) and S1191 (O139) were used as challenge strains. Strain S1191 was isolated from a pig with edema disease, produces heat-stable toxins (ST) STa and STb and Shiga toxin 2e, and is chloramphenicol resistant. Strain 2144 was a field isolate that was made nalidixic acid resistant and produces the toxins STa and STb. Both strains were grown overnight as pure cultures in LB medium at 37°C with shaking. They were then individually diluted to an optical density at 600 nm (OD600) of 0.1 in fresh LB medium and allowed to grow to an OD600 of
1. The cultures were then centrifuged at 4,000 x g for 10 min at 4°C. The bacterial pellets were resuspended in 20% dextrose and 5% nonfat dry milk. The challenge dose consisted of an equal amount of each strain and was determined by serial dilution and plating to provide a total 2 x 109 CFU/0.5 ml oral dose.
Animals.
All of our protocols involving animals were approved by the Institutional Animal Care and Use Committee of Iowa State University. The 24 barrows (castrated pigs) used were obtained from the Iowa State University Swine Nutrition Farm and were determined to be susceptible to F18-positive E. coli infections based on the restriction fragment length polymorphism test described by Frydendahl et al. (15). Briefly, genomic DNA was purified (DNeasy kit; QIAGEN, Valencia, CA) from pig tail clippings, and primers (forward primer, TTGGGAACCAGATGGGACAGTATG; reverse primer, CCCGCCAAGGAGCGTGCCTGTCTA) were used to amplify a 162-bp section of the 1,2
-fucosyltransferase enzyme gene (ECF18R) by PCR (26). The 162-bp PCR product was then digested with HhaI (New England Biolabs, Ipswich, MD), and the polymorphism was determined by size comparison on a 3% agarose gel.
Pigs were weaned at 17 days of age and allowed to adjust to solid food (TechStart 17-25; Kent Feeds, Muscatine, IA). At 21 days of age, the pigs (n = 8) were allotted into treatment groups on the basis of their body weights and were transferred to individual pens. The pigs were given 2 days to adjust to individual housing before the experimental diets were fed. The basal diet for all of the experimental diets was corn and soy based and contained no animal products (26% crude protein, 3.51 kcal/kg of diet). This diet met or exceeded the nutrient requirements of these pigs, based on the 1998 recommendations of the National Research Council (29). Either 0 (control), 11, or 16.5 mg of purified colicin E1 (supplied at 10 mg/ml in 10 mM Tris, pH 7.6) was added per kg to the basal diet (TestDiet; Purina, Richmond, IN), and the diets were then pelleted at low temperature. The pelleted rations were provided to the pigs twice daily at a rate which exceeded the consumption for each animal (approximately 500 g/day). The unconsumed feed was weighed daily and feed intake was determined.
After the animals received the experimental diets for 2 days, all animals were orally inoculated with the two F18-positive ETEC strains and their fecal scores were recorded. Fecal scores (0, dry, hard, and well-formed feces; 1, soft but formed feces; 2, pasty feces green or brown in color; 3, viscous feces light in color, episodic; 4, fluid feces light in color, episodic; 5, watery feces, continuous) were determined twice daily after the bacterial challenge. Fecal samples were obtained 2 days prior to the ETEC challenge and daily after the challenge by inserting a 10-µl fecal loop (Fisher Scientific, Pittsburgh, PA) into the rectum. These samples were immediately diluted in 5 ml of sterile phosphate-buffered saline. Serial 10-fold dilutions (up to 1:100,000) were plated onto MacConkey (MAC; Difco, Franklin Lakes, NJ), MAC-chloramphenicol, and MAC-nalidixic acid agar plates for CFU determination. Our limit of detection for the fecal samples was 10,000 CFU/g. Four days postchallenge, all pigs were euthanized by captive bolt, and tissue samples were collected. Ileal sections (approximately 10 cm each) were collected from each pig for RNA extraction and E. coli enumeration. Additionally, rectal and cecal contents were collected for E. coli enumeration.
Gene expression.
Isolation of RNA from the ileum was performed by using a whole ileal homogenate and an RNeasy kit (QIAGEN). Genomic DNA was eliminated from the extracted total RNA by using the DNA-free kit from Ambion (Austin, TX), according to the manufacturer's instructions. The RNA was reverse transcribed with Superscript III reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA), and the RNA was removed from the resulting cDNA by incubation with E. coli RNase H (Invitrogen), according to the manufacturer's instructions. The cDNA concentrations were determined by using a Quant-it kit (Invitrogen), and the cDNA samples were then stored at –80°C until analysis by real-time PCR. The levels of interferon (IFN), interleukin 10 (IL-10), IL-8, tumor necrosis factor alpha (TNF-
), tumor necrosis factor beta (TNF-ß), IL-1ß, and inducible nitric oxide synthase (iNOS) mRNA were determined semiquantitatively by real-time PCR with a the MyiQ single-color real-time PCR detection system and SYBR green (Bio-Rad Laboratories; Hercules, CA). The thermal cycling conditions included 45 cycles of 30 s of melting at 95°C, followed by 30 s of annealing and extension at 65°C. Following amplification, all samples were subjected to a melting curve analysis to ensure that only a single product was formed. Primer oligonucleotides (Table 1) were designed by using PrimerQuest software, available from Integrated DNA Technologies (Coralville, IA). All primer sets were validated to amplify only the sequence of interest and to do so in a linear fashion over a 2-log range of cDNA concentrations. The data for all samples were normalized to the cDNA concentration prior to statistical analysis.
Bacterial enumeration.
The enumeration of
E. coli from the ileal mucosa, cecal content,
and rectal content samples was performed as follows. The samples
were weighed, diluted 1:2 with buffered peptone water, and placed
in a stomacher blender (Stomacher 80; Seward, Worthing, United
Kingdom) for 30 s. The samples were then serially diluted over
a 4-log range at a 1:200 starting dilution. Ten microliters
of each dilution was plated in duplicate on MAC, MAC-chloramphenicol
(30 µg/ml), and MAC-nalidixic acid (50 µg/ml) agar
plates. The plates were incubated for 16 h at 37°C, and
the countable dilution was then recorded. Our limit of detection
for these samples was 1,000 CFU/g.
Statistical analysis.
Statistical analysis of the data was performed with Statistical Analysis Software, version 9.1 (SAS, Cary, NC), by the general linear models procedure for comparison of least-squares means. Treatment was considered a fixed effect, and for growth parameters, initial body weight was used as a covariate in the analysis. For bacterial enumeration data, when the counts were below our limit of detection, a value of 1 CFU/g less than our limit of detection was ascribed prior to analysis. Statistical significance was set at
equal to 0.05, and trends are discussed at an
value of 0.1.

RESULTS
Fecal scores.
Prior to bacterial challenge, there was no indication of diarrhea
or loose stools among any of the pigs. There were no differences
in fecal scores between the treatment groups until 48 h postchallenge.
At this point the group fed the control diet had a mean fecal
score of 2.38, which tended to be higher (
P < 0.06) than
that for the group fed the 16.5-mg colicin E1/kg diet (mean
score, 0.5) (Fig.
1). Over the entire study, the control group
had a significantly higher (
P < 0.05) average fecal score
than the high-dose (16.5-mg/kg) colicin E1 group (2.1 and 0.59,
respectively). The low-dose (11-mg/kg) colicin E1 group also
had higher (
P < 0.05) average fecal scores than the high-dose
group, and these were not significantly different from those
for the control pigs. These differences in group fecal scores
were caused by the incidence of diarrhea (fecal scores,

4) in
one, four, and five of the eight control group pigs 24, 48,
and 72 h after ETEC inoculation, respectively. Among the pigs
fed the low dose of colicin E1, no animals had diarrhea at 24
h postinoculation; however, three and four pigs had diarrhea
at 48 and 72 h postchallenge, respectively. None of the pigs
fed the high dose of colicin E1 had any incidence of diarrhea
at any time during the experiment.
Growth performance.
The dietary inclusion of colicin E1 had a significant effect
(
P < 0.05) on the growth performance of the pigs in this
study (Table
2). From the time of
E. coli challenge until the
completion of the study, the pigs fed the control diet gained
an average of 380 g, while the pigs receiving the low and high
doses of colicin E1 in their diets gained 540 and 940 g, respectively
(Table
2). Although the animals fed the control diet gained
the least body weight over the course of the study, they consumed
significantly (
P < 0.05) more feed than either of the groups
fed diets containing colicin E1. The control group of animals
averaged a total consumption of 1.54 kg of diet, while the pigs
treated with the low and high doses of colicin E1 ate 1.22 kg
and 1.44 kg, respectively. Although there were significant differences
in both body weight gain and feed consumption, there was not
a significant difference in feed conversion efficiency (body
weight gain/feed intake) (
P < 0.19) among any of the treatment
groups. This was because over the length of the study two of
the pigs in the control group lost weight (approximately 400
g each) and one pig gained virtually no weight (less than 10
g) while still consuming feed. This negative body weight gain
resulted in a negative feed conversion efficiency, which resulted
in tremendous variation in the feed conversion efficiency values
for this group.
Bacterial enumeration. (i) Fecal cultures.
No colonies were isolated on the agar plates containing either
chloramphenicol or nalidixic acid from any samples prior to
the ETEC challenge. At 24 h postinoculation, the levels of both
total coliforms and ETEC challenge strain 2144 recovered in
the feces were significantly higher (
P < 0.05) for the control
animals than for both groups of colicin E1-fed pigs (Table
3).
There were no significant differences between the groups in
the recovery of ETEC strain S1191 at the first day postchallenge,
but on the following day there was a reduction in the high-dose
colicin E1 group compared to that in the controls (
P < 0.05).
By the last day of fecal sampling, the levels of strain S1191
had dropped below our detection limit for most of the animals,
regardless of the dietary treatment (16/24 pigs), and there
were no significant differences in the amount of strain 2144
recovered.
(ii) Tissues.
In the ileum, both colicin E1-fed groups averaged lower levels
(
P < 0.05) of the S1191 challenge strain and coliforms compared
to those in the controls (Table
4). There were no significant
differences in the recovery of bacteria from the cecal samples
among the groups. Strain S1191 was recovered from samples from
only three of the eight animals in the high-dose colicin E1
group and was recovered from six and four of the eight animals
in the control and the low-dose colicin E1 treatment groups,
respectively. In the rectum, similar levels of total coliforms
and strains 2144 and S1191 were recovered from the animals in
all groups.
Gene expression.
The concentration of TNF-ß mRNA in ileal tissue was
higher (
P < 0.06) in the control animals than in either of
the colicin E1-treated groups (Fig.
2). The amount of IL-1ß
mRNA was the highest in the group supplemented with the low
dose of colicin E1 (sixfold higher [
P < 0.01] than the amount
in the controls), whereas the group supplemented with the high
dose of colicin E1 had nearly undetectable levels of IL-1ß
mRNA (Fig.
2). The levels of expression of both TNF-

and iNOS
tended (
P < 0.1) to be greater in the control animals than
in the animals receiving the diets with colicin E1 supplementation.
There were no significant differences in the concentrations
of gamma IFN (IFN-

), IL-8, or IL-10 mRNA in the ileum among
any of the groups.

DISCUSSION
We examined the efficacy of colicin E1 in preventing PWD caused
by F18-producing
E. coli because this disease has been estimated
to be responsible for as much as 50% of the economic losses
seen in the production of weaned pigs (
19,
36). In herds with
PWD, mortality of up to 2% (
21,
37) can be seen among weaning
pigs, but of greater economic significance is the morbidity
and reduction in growth performance of the pigs that survive
these infections. Although there is a need for alternatives
to conventional antibiotics, the development of compounds that
can be used to combat ETEC-associated PWD is beset with difficulties,
including the availability of an adequate experimental model
of ETEC infection. Establishing a good challenge model for this
disease has proven to be difficult. Madec et al. (
24) used four
strains of ETEC and several different dosing methods in six
trials with a total of 168 specific-pathogen-free piglets and
was able to generate clinically significant, although transient,
diarrhea in only 50% of the animals (
24). The use of a viral
coinfectious agent, such as transmissible gastroenteritis or
rotavirus, that leads to immunosuppression and intestinal membrane
disruption can also increase experimental ETEC infection rates
(
1,
9,
16,
28). While a cochallenge model can increase the rate
of success of experimentally reproducing PWD, it also adds a
potential confounding effect, particularly if the viral infection
alone causes reduced growth performance. An alternative to the
viral coinfection model that has also been shown to increase
the success of an ETEC bacterial challenge is modification of
the postweaning diet. The removal of all animal-based protein
sources from the postweaning diet can increase the susceptibility
of the pigs to ETEC infection due to a transient intestinal
inflammatory response (
2,
10). Diets designed to be fed to pigs
immediately postweaning typically provide over 40% of the total
protein in the diet as protein from animal sources, in part
to help prevent this temporary inflammatory response. However,
due to the higher cost of animal-based protein sources, there
is a constant push to minimize the amount of animal protein
included in pig diets. While both viral cochallenges and dietary
alterations can increase infection rates in experimentally induced
PWD models, identifying the genetic susceptibility of the animals
may offer the most efficient way to increase infection rates
in a challenge model. With the use of prescreening for an F18
receptor polymorphism, the rate of infection can be increased
from 5.9% in pigs with the F18-resistant genotype to 87% in
those that are genetically susceptible (
15). In our study, we
used only genetically susceptible animals, as well as a weaning
diet that contained no animal protein. With this model we achieved
a 75% infection rate in control animals, with no mortality after
4 days, with no use of viral coinfection, and with the use of
an easily performed one-time oral challenge.
Although our high dose of colicin E1 (16.5 mg/kg of diet) was able to eliminate all clinical signs of PWD, our low dose of colicin E1 appeared to be able to slightly delay only the onset of PWD. The level of reduction of the challenge strains of E. coli that reached the ileum as a result of dietary colicin E1 inclusion may have been the determining factor in the development of clinical disease. Colicin-fed animals had significantly lower levels (P < 0.04) of fecal shedding of the strain 2144 challenge bacteria at 1 day postchallenge. While this suggests that the addition of colicin to the feed significantly reduced the amount of viable bacteria that reached the distal end of the small intestine, it also demonstrates that our colicin dose was not sufficient to completely eliminate the challenge strains. By the end of the study there were no significant differences in the fecal shedding of either challenge strain on the basis of colicin treatment. We would not anticipate that the feeding of colicin E1 would have an effect on reducing the colonization of the ETEC strains if they reached the ileum in a viable state, since colicin E1 is highly sensitive to proteolysis (3, 4, 6). It is likely that not all of the E. coli bacteria in our large challenge dose would be killed by the colicin E1 present in the digesta prior to the inactivation of the colicin E1 by proteolysis, but it appears that enough were eliminated as a result of high-dose colicin E1 supplementation to prevent disease. The gene expression data also suggest that fewer of the challenge bacteria were able to cause the inflammatory response leading to diarrhea in the pigs. This is supported by the lower levels of expression (P < 0.05) of IL-1ß and TNF-ß mRNA in the ileal tissues of pigs fed the high-dose colicin E1 diet compared with those in the control group. IL-1ß is primarily secreted by macrophages and activates lymphocytes during an inflammatory response, and increases have been associated with E. coli toxin production (11, 17). While the concentration of IL-1ß mRNA was significantly lower in the ileal tissue of the pigs fed the high dose of colicin E1 than in the ileal tissue of the control pigs, pigs in the low-colicin E1-dose group had mRNA levels that were over sixfold higher than those in the control group. At the time of tissue collection there was no longer any significant difference in fecal scores between the low-dose and the control groups, and this elevated expression may indicate a delay in the inflammatory response as a result of the challenge bacteria. This would be reasonable, since there appeared to be a delay in the onset of PWD in the pigs fed the low dose of colicin E1 compared with the time of onset in the control animals. An increase in IL-1ß gene expression in the intestinal mucosa has been correlated with enteropathogenic E. coli challenge (16), although the associated increases in the expression of IL-6, IL-8, and IL-10 seen by Girard et al. (16) were not noted in our study. Regardless of the dose, colicin E1 in the diet caused reduced levels (P < 0.06) of expression of TNF-ß. TNF-ß, also known as lymphotoxin, is a primary effector of NO production and is associated with inflammatory responses related to T-cell recruitment (13). The lower levels of TNF-ß and IL-1ß in the ileal tissues of pigs fed the high dose of colicin E1 compared with those in the control animals suggest that colicin E1 was able to significantly reduce the bacterial load that initially reached the ileum in these animals, thereby reducing the inflammatory response to the ETEC challenge.
While other researchers have examined the efficacy of using colicin-producing bacterial cultures as probiotics for cattle in order to reduce E. coli O157 contamination (32), we are the first, to our knowledge, to examine a purified colicin as a feed component for the prevention of an ETEC infection. We have demonstrated with growth performance data, clinical indicators of PWD, and intestinal gene expression that the inclusion of colicin E1 can prevent experimentally induced PWD. The efficacy in preventing PWD at a level of dietary inclusion of 16.5 mg/kg of diet suggests that colicin E1 warrants further evaluation as a potential alternative to conventional antibiotics for use in weaning pig diets. This protein may also have significant implications for human food safety as well, since the efficacy of colicin E1 against many ETEC strains of concern for human food safety has been well documented (5, 8, 31).

ACKNOWLEDGMENTS
This work was supported in part by the Biotechnology Research
and Development Corporation (Peoria, IL).

FOOTNOTES
* Corresponding author. Mailing address: Department of Animal Science, North Carolina State University, Campus Box 7621, 226A Polk Hall, Raleigh, NC 27695. Phone: (919) 513-1512. Fax: (919) 515-6884. E-mail:
chad_stahl{at}ncsu.edu 
Published ahead of print on 27 August 2007. 

REFERENCES
1 - Benfield, D. A., D. H. Francis, J. P. McAdaragh, D. D. Johnson, M. E. Bergeland, K. Rossow, and R. Moore. 1988. Combined rotavirus and K99 Escherichia coli infection in gnotobiotic pigs. Am. J. Vet. Res. 49:330-337.[Medline]
2 - Bosi, P., L. Casini, A. Finamore, C. Cremokolini, G. Merialdi, P. Trevisi, F. Nobili, and E. Mengheri. 2004. Spray-dried plasma improves growth performance and reduces inflammatory status of weaned pigs challenged with enterotoxigenic Escherichia coli K88. J. Anim. Sci. 82:1764-1772.[Abstract/Free Full Text]
3 - Bowles, L. K., and J. Konisky. 1981. Cleavage of colicin Ia by the Escherichia coli K-12 outer membrane is not mediated by the colicin Ia receptor. J. Bacteriol. 145:668-671.[Abstract/Free Full Text]
4 - Brey, R. N. 1982. Fragmentation of colicins A and E1 by cell surface proteases. J. Bacteriol. 149:306-315.[Abstract/Free Full Text]
5 - Callaway, T. R., C. H. Stahl, T. S. Edrington, K. J. Genovese, L. M. Lincoln, R. C. Anderson, S. M. Lonergan, T. L. Poole, R. B. Harvey, and D. J. Nisbet. 2004. Colicin concentrations inhibit growth of Escherichia coli O157:H7 in vitro. J. Food Prot. 67:2603-2607.[Medline]
6 - Cavard, D. 1990. Colicin cleavage by OmpT protease during both entry into and release from Eshcherichia coli cells. J. Bacteriol. 172:648-652.[Abstract/Free Full Text]
7 - Choi, C., H. J. Ham, D. Kwon, J. Kim, D. S. Cheon, K. Min, W. S. Cho, H. K. Chung, T. Jung, K. Jung, and C. Chae. 2002. Antimicrobial susceptibility of pathogenic Escherichia coli isolated from pigs in Korea. J. Vet. Med. Sci. 64:71-73.[CrossRef][Medline]
8 - Cole, K., M. B. Farnell, A. M. Donoghue, N. J. Stern, E. A. Svetoch, B. N. Eruslanov, L. I. Volodina, Y. N. Kovalev, V. V. Perelygin, E. V. Mitsevich, I. P. Mitsevich, V. P. Levchuk, V. D. Pokhilenko, V. N. Borzenkov, O. E. Svetoch, T. Y. Kudryavtseva, I. Reyes-Herrera, P. J. Blore, F. Solis de los Santos, and D. J. Donoghue. 2006. Bacteriocins reduce Campylobacter colonization and alter gut morphology in turkey poults. Poult. Sci. 85:1570-1575.[Abstract/Free Full Text]
9 - Cox, E., E. Schrauwen, V. Cools, and A. Houvenaghel. 1991. Experimental induction of diarrhoea in newly-weaned piglets. Zentbl. Veterinarmed. A 38:418-426.
10 - Dreau, D., J. P. Lalles, V. Philouze-Rome, R. Toullec, and H. Salmon. 1994. Local and systemic immune responses to soybean protein ingestion in early-weaned pigs. J. Anim. Sci. 72:2090-2098.[Abstract]
11 - Fairbrother, J. M., E. Nadeau, and C. L. Gyles. 2005. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim. Health Res. Rev. 6:17-39.[CrossRef][Medline]
12 - FDA 2003. Guidance for industry no. 152: evaluating the safety of antimicrobial new animal drugs with regard to their microbiological effects on bacteria of human health concern. CVM, FDA, DHHS, Washington, DC.
13 - Ferrante, A., R. E. Staugas, B. Rowan-Kelly, S. Bresatz, L. M. Kumaratilake, C. M. Rzepczyk, and G. R. Adolf. 1990. Production of tumor necrosis factors alpha and beta by human mononuclear leukocytes stimulated with mitogens, bacteria, and malarial parasites. Infect. Immun. 58:3996-4003.[Abstract/Free Full Text]
14 - Fredericq, P. 1957. Colicins. Annu. Rev. Microbiol. 11:7-22.[Medline]
15 - Frydendahl, K., T. Kare Jensen, J. Strodl Andersen, M. Fredholm, and G. Evans. 2003. Association between the porcine Escherichia coli F18 receptor genotype and phenotype and susceptibility to colonisation and postweaning diarrhoea caused by E. coli O138:F18. Vet. Microbiol. 93:39-51.[CrossRef][Medline]
16 - Girard, F., I. Batisson, G. M. Frankel, J. Harel, and J. M. Fairbrother. 2005. Interaction of enteropathogenic and Shiga toxin-producing Escherichia coli and porcine intestinal mucosa: role of intimin and Tir in adherence. Infect. Immun. 73:6005-6016.[Abstract/Free Full Text]
17 - Gyles, C. L. 2006 Shiga toxin-producing Escherichia coli: an overview. J. Anim. Sci. 85:E45-E62.[Medline]
18 - Gyles, C. L. 1994. Escherichia coli verotoxin and other cytotoxins, p. 151-170. In C. L. Gyles (ed.), Escherichia coli in domestic animals and humans. CAB International, Wallingford, United Kingdom.
19 - Hani, H., A. Brandli, J. Nicolet, P. von Roll, H. Luginbuhl, and B. Horning. 1976. Occurrence and significance of swine diseases: analysis of dissected material (1971-1973). III. Pathology of the digestive tract. Schweiz. Arch. Tierheilkd. 118:13-30. (In German.)[Medline]
20 - Hayes, D. J., H. H. Jensen, L. Backstrom, and J. Fabiosa. 1999. Economic impact of a ban on the use of over-the-counter antibiotics in U.S. swine rations, p. 25-27. Iowa State University, Ames.
21 - Jahn, S., and E. Uecker. 1997. Research on the economics of enterotoxaemia due to coliforms in pigs. Monatahefte. Veterinar. Medizin. 42:769-771.
22 - Jordi, B. J., K. Boutaga, C. M. van Heeswijk, F. van Knapen, and L. J. Lipman. 2001. Sensitivity of Shiga toxin-producing Escherichia coli (STEC) strains for colicins under different experimental conditions. FEMS Microbiol. Lett. 204:329-334.[CrossRef][Medline]
23 - Lanz, R., P. Kuhnert, and P. Boerlin. 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91:73-84.[CrossRef][Medline]
24 - Madec, F., N. Bridoux, S. Bounaix, R. Cariolet, Y. Duval-Iflah, D. J. Hampson, and A. Jestin. 2000. Experimental models of porcine post-weaning colibacillosis and their relationship to post-weaning diarrhoea and digestive disorders as encountered in the field. Vet. Microbiol. 72:295-310.[CrossRef][Medline]
25 - Maynard, C., S. Bekal, F. Sanschagrin, R. C. Levesque, R. Brousseau, L. Masson, S. Lariviere, and J. Harel. 2004. Heterogeneity among virulence and antimicrobial resistance gene profiles of extraintestinal Escherichia coli isolates of animal and human origin. J. Clin. Microbiol. 42:5444-5452.[Abstract/Free Full Text]
26 - Meijerink, E., S. Neuenschwander, R. Fries, A. Dinter, H. U. Bertschinger, G. Stranzinger, and P. Vogeli. 2000. A DNA polymorphism influencing alpha(1,2)fucosyltransferase activity of the pig FUT1 enzyme determines susceptibility of small intestinal epithelium to Escherichia coli F18 adhesion. Immunogenetics 52:129-136.[CrossRef][Medline]
27 - Murinda, S. E., R. F. Roberts, and R. A. Wilson. 1996. Evaluation of colicins for inhibitory activity against diarrheagenic Escherichia coli strains, including serotype O157:H7. Appl. Environ. Microbiol. 62:3196-3202.[Abstract]
28 - Nagy, B., L. H. Arp, H. W. Moon, and T. A. Casey. 1992. Colonization of the small intestine of weaned pigs by enterotoxigenic Escherichia coli that lack known colonization factors. Vet. Pathol. 29:239-246.[Abstract]
29 - National Research Council. 1998. Nutrient requirements of swine, 10th ed. National Academy Press, Washington, DC.
30 - Patton, B. S., J. S. Dixon, S. M. Lonergan, S. A. Cutler, and C. H. Stahl. 2007. Inhibitory activity of Colicin E1 against Listeria monocytogenes. J. Food Prot. 70:1256-1262.[Medline]
31 - Schamberger, G. P., and F. Diez-Gonzalez. 2002. Selection of recently isolated colicinogenic Escherichia coli strains inhibitory to Escherichia coli O157:H7. J. Food Prot. 65:1381-1387.[Medline]
32 - Schamberger, G. P., R. L. Philips, J. L. Jacobs, and F. Diez-Gonzalez. 2004. Reduction of Escherichia coli O157:H7 populations in cattle by addition of colicin E7-producing E. coli to feed. Appl. Environ. Microbiol. 70:6053-6060.[Abstract/Free Full Text]
33 - Stahl, C. H., T. R. Callaway, L. M. Lincoln, S. M. Lonergan, and K. J. Genovese. 2004. Inhibitory activities of colicins against Escherichia coli strains responsible for postweaning diarrhea and edema disease in swine. Antimicrob. Agents Chemother. 48:3119-3121.[Abstract/Free Full Text]
34 - Stein, H. H. 2002. Experience of feeding pigs without antibiotics: a European perspective. Anim. Biotechnol. 13:85-95.[CrossRef][Medline]
35 - Svensmark, B., K. Nielsen, K. Dalsgaard, and P. Willeberg. 1989. Epidemiological studies of piglet diarrhoea in intensively managed Danish sow herds. III. Rotavirus infection. Acta Vet. Scand. 30:63-70.[Medline]
36 - USDA. 2001. Part I: reference of swine health and management in the United States, 2000. Publication N338.0801. National Animal Health Monitoring System, Fort Collins, CO.
37 - Wegmann, P. 1990. Pathology of swine—a portrait of economic loss in pig production in Switzerland. Proc. Int. Congr. Pig Vet. Soc. 11:295.
38 - WHO. 2000. WHO global principles for the containment of antimicrobial resistance in animals intended for food: report of a WHO consultation. WHO/CDS/CSR/APH, Geneva, Switzerland.
39 - Zhang, W., M. Zhao, L. Ruesch, A. Omot, and D. Francis. 2007. Prevalence of virulence genes in Escherichia coli strains recently isolated from young pigs with diarrhea in the US. Vet. Microbiol. 123:145-152.[CrossRef][Medline]
Antimicrobial Agents and Chemotherapy, November 2007, p. 3830-3835, Vol. 51, No. 11
0066-4804/07/$08.00+0 doi:10.1128/AAC.00360-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.