Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services E-mail this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Martinez, L. R. Articles by Nosanchuk, J. D. Search for Related Content PubMed PubMed Citation Articles by Martinez, L. R. Articles by Nosanchuk, J. D.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, December 2007, p. 4396-4400, Vol. 51, No. 12
0066-4804/07/$08.00+0     doi:10.1128/AAC.00376-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Voriconazole Inhibits Melanization in Cryptococcus neoformans

Luis R. Martinez, Patricia Ntiamoah, Attila Gácser, Arturo Casadevall, and Joshua D. Nosanchuk^*

Departments of Medicine (Division of Infectious Diseases) and Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York

Received 20 March 2007/ Returned for modification 25 April 2007/ Accepted 29 September 2007

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Voriconazole is a triazole antifungal drug that inhibits ergosterol synthesis and has broad activity against yeast and molds. While studying the interaction of voriconazole and Cryptococcus neoformans, we noted that cells grown in the presence of subinhibitory concentrations of voriconazole reduced melanin pigmentation. We investigated this effect systematically by assessing melanin production in the presence of voriconazole, amphotericin B, caspofungin, itraconazole, and fluconazole. Only voriconazole impeded the formation of melanin at subinhibitory concentrations. Voriconazole did not affect the autopolymerization of L-dopa, and 0.5 MIC of voriconazole did affect the gene expression of C. neoformans. However, voriconazole inhibited the capacity of laccase to catalyze the formation of melanin. Hence, voriconazole affects melanization in C. neoformans by interacting directly with laccase, which may increase the efficacy of this potent antifungal against certain pigmented fungi.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Voriconazole, a synthetic derivative of fluconazole, is a broad-spectrum triazole antifungal that inhibits cytochrome P450-dependent 14-lanosterol demethylation, which is a critical step in fungal cell membrane ergosterol synthesis. We have previously shown that voriconazole is highly active against melanized and nonmelanized Cryptococcus neoformans, an important human pathogenic fungus, in vitro (12) and during experimental infection (4).

Melanins are negatively charged, hydrophobic pigments of high molecular weight that are formed by the oxidative polymerization of phenolic and/or indolic compounds (15), and the pigments are found in all biological kingdoms (2). Melanin synthesis occurs in C. neoformans, dimorphic fungi, and diverse molds and has been associated with virulence for the human pathogenic fungi Cryptococcus neoformans, Aspergillus species, Exophiala (Wangiella) dermatitidis, and Sporothrix schenckii (reviewed in reference 7). In C. neoformans, pigment production protects the fungus against diverse insults, including oxidants, elevated temperature, amphotericin B, caspofungin, microbicidal peptides, enzymatic degradation, and macrophages in vitro (reviewed in reference 7). In our studies with voriconazole on C. neoformans, we noted that the drug appeared to affect C. neoformans melanization, and we therefore investigated this phenomenon by assessing the impacts of voriconazole, fluconazole, itraconazole, caspofungin, and amphotericin B on melanin production. Additionally, we analyzed the effect of subinhibitory voriconazole on gene expression.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Antifungal drugs, C. neoformans, and melanization. Voriconazole and fluconazole were provided by Pfizer (Sandwich, England). We purchased amphotericin B from Gibco (Invitrogen Corp., Carlsbad, CA), itraconazole from Janssen (Spring House, PA), and caspofungin from Merck (Whitehouse Station, NJ). Although caspofungin has limited clinical efficacy in cryptococcosis, it has activity against C. neoformans in vitro (1) and was used in these experiments to establish proof of principle for the effect of this drug class on melanin production. C. neoformans serotype D strain 24067 from the American Type Culture Collection (Rockville, MD) was selected for these studies since it was used in our prior melanin and cellular morphology studies (8, 10, 12). Cultures inoculated with 5 x 10⁴ C. neoformans yeast cells were grown either in 50 ml of a chemically defined minimal medium (15 mM glucose, 10 mM MgSO₄, 29.4 mM KH₂PO₄, 13 mM glycine, and 3.0 µM vitamin B₁) or on minimal medium agar (minimal medium plus 2% agar) with 1 mM L-dopa (Sigma, St. Louis, MO) as a substrate for melanization at 30°C. Liquid cultures were shaken at 150 rpm. The MICs for C. neoformans were determined by us previously (11, 12): 0.015 µg/ml for voriconazole, 0.125 µg/ml for amphotericin B, 1 µg/ml for fluconazole, <0.625 µg/ml for itraconazole, and 8 µg/ml for caspofungin. To determine whether these antifungal drugs could impact the melanization of C. neoformans at subinhibitory concentrations, these compounds were added at various concentrations to a maximum concentration of 0.5 MIC to the minimal medium with L-dopa. The cultures were wrapped in foil to avert autopolymerization of the L-dopa and examined daily for growth and melanin production.

Growth studies. C. neoformans strain 24067 was grown in L-dopa minimal medium in the absence and presence of voriconazole or fluconazole at 30°C. Both antifungal drugs were added at various concentrations to a maximum concentration of 0.5 MIC. The initial inoculum was 5 x 10⁴ cells in 50 ml medium for each concentration.

Isolation of melanin from C. neoformans after incubation with antifungal drugs. A density of 5 x 10⁴ C. neoformans 24067 yeast cells were grown in 50 ml of minimal medium supplemented with 1 mM L-dopa without or with voriconazole (0.25 or 0.5 MIC) or fluconazole (0.25 or 0.5 MIC) at 30°C for 7 days. Liquid cultures were shaken at 150 rpm. On day 7, melanized C. neoformans cells were treated with enzymes, denaturant, and hot acid, resulting in the isolation of purified melanin in the shape and size of the parental melanized cryptococcal cell, and these particles are referred to as melanin "ghosts" (15). Briefly, C. neoformans from the subcultures of cells grown for 10 days and transferred to fresh medium with or without L-dopa for 36 h were collected by centrifugation at 2,010 x g for 30 min, washed with phosphate-buffered saline (PBS), and suspended in 1.0 M sorbitol-0.1 M sodium citrate (pH 5.5). Cell wall-lysing enzymes (from Trichoderma harzianum; Sigma) were added at 10 mg ml^–1, and the suspensions were incubated at 30°C overnight. The resulting protoplasts were collected by centrifugation, washed with PBS, and treated with 1 mg proteinase K ml^–1 (Roche Laboratories) made up in a reaction buffer (10 mM Tris, 1 mM CaCl₂, and 0.5% sodium dodecyl sulfate, pH 7.8) at 37°C overnight. The debris was collected, washed with PBS, and then boiled in 6 M HCl for 1 h. If particles remained, they were collected, washed in PBS, and lyophilized. Finally, the amount of melanin produced by yeast cells after incubation with drugs was quantitated by dry weight measurement.

Autopolymerization. To determine whether voriconazole directly interacted with L-dopa to impede melanization, this drug was incubated with L-dopa in minimal medium and exposed to ambient light to catalyze the autopolymerization of the phenolic compound to melanin. Voriconazole at a concentration of 0.0075, 0.015, or 0.03 µg/ml was incubated in Erlenmeyer flasks with 25 ml of minimal medium supplemented with 1 mM L-dopa at 30°C with shaking at 150 rpm. A flask without drug was utilized as a control.

Gene expression. Cryptococcus neoformans yeasts were grown in minimal medium with L-dopa in triplicates alone or with 0.0625 µg/ml of voriconazole for 3 days. Approximately 2 x 10⁹ to 6 x10⁹ cells were suspended in 5 ml of PBS and then homogenized with 0.5-mm-diameter zirconium-silica glass beads (Biospec, Bartlesville, OK) by using a glass bead beater (Biospec) for 4 min to ensure complete lysis. Cell debris was removed by centrifugation at 3,900 x g for 10 min at room temperature. Isolation of high quality Cryptococcus neoformans RNA was performed using an Ambion kit (Ambion, Austin, TX) according to the manufacturer's instructions. At the microarray facility at the Genome Sequencing Center of Washington University in St. Louis, the RNA was hybridized to a microarray containing all the currently predicted genes in serotype D C. neoformans (http://genome.wustl.edu/activity/ma/cneoformans/). The slides were scanned immediately after hybridization on a ScanArray express HT scanner (Perkin Elmer, Wellesley, MA) to detect Cy3 and Cy5 fluorescence. The laser power was kept constant, and photomultiplier tube values were set for optimal intensity with minimal background. Gridding and analysis of images were performed with ScanArray software Express V2.0 (Perkin Elmer), and the intensity values were imported into GeneSpring 7.3 software (Agilent, Redwood City, CA). A Lowess curve was fitted to the log intensity versus log ratio plot, and 20.0% of the data was used to calculate the Lowess fit at each point. This curve was used to adjust the control value for each measurement, and mean-to-Lowess-adjusted-signal controlled ratios were calculated. Cross-chip averages were derived from the antilog of the mean of the natural log ratios across the two microarrays.

Real-time RT-PCR for LAC1 gene expression. C. neoformans 24067 yeast cells were grown in minimal medium agar plates supplemented with 1 mM L-dopa without or with voriconazole (0.25 or 0.5 MIC) or fluconazole (0.25 or 0.5 MIC) at 30°C for 7 days. The plates were covered with aluminum foil to prevent autopolymerization. After incubation, LAC1 gene expression was analyzed by quantitative reverse transcription-PCR (qRT-PCR). Briefly, cells were collected and washed, and then RNA was isolated according to the RNeasy kit protocol (QIAGEN). For real-time RT-PCR detection of LAC1 transcripts, 10 µg of total RNA was treated with DNase at 37°C for 1 h, precipitated with ethanol, and suspended in 100 µl of nuclease-free water. cDNA synthesis was carried out from equal amounts of RNA in a cyclic Bio-Rad MyCycler (Bio-Rad) using reagents from Invitrogen according to the manufacturer's instructions. The expression of the LAC1 gene was examined via RT-PCR with the primers LAC1a (CCAGCGAGGAGCCTTTGTGAATGT) and LAC1b (GCCGTGCAGGTGGTAAGGATGG). For an internal mRNA control, we used primers specific for the ACT1 gene of C. neoformans: ACT1a (GCCCTTGCTCCTTCTTCTAT) and ACT1b (GACGATTGAGGGACCAGACT). To confirm that similar concentrations of cDNA were achieved, the signals from ACT1 PCR were compared. The LAC1 transcript levels were determined and quantitatively assessed using a Bio-Rad iQ iCycler and Cycler iQ software, respectively. The cycling conditions used were 95°C for 5 min and 40 cycles of 95°C for 15 s, 55°C for 30 s, and 72°C for 30 s. Next, the samples were cooled to 55°C, and a melting curve for temperatures between 55°C and 95°C with 0.5°C increments was recorded. Real-time expression measurements were normalized against the expression of the reference gene, ACT1. The relative RNA levels were calculated by using the threshold cycle (C_T) method; all primers resulted in amplification efficiencies of at least 95%.

Laccase assays. A quantitative laccase assay using the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS; Sigma) as the substrate was performed with C. neoformans yeast cells, C. neoformans cytoplasmic extractions, and a commercially available recombinant laccase from Rhus vernificera (Sigma). For intact cells, yeasts were grown in asparagine medium (1 g/liter asparagine, 10 mM sodium phosphate [pH 6.5], 0.25 g/liter MgSO₄, 10 µM CuSO₄) with glucose (1.5 g/liter) for 72 h at 30°C. The cells were collected by centrifugation, washed with PBS, and transferred into asparagine medium without glucose for 36 h at 30°C. The strains were collected by centrifugation, washed, and diluted to 1 x 10⁸ cells/ml in PBS with or without voriconazole. A final concentration of 1 mM ABTS was achieved by adding 100 µl of 10 mM ABTS to 900 µl of a yeast cell suspension. After incubation at 30°C for 2 h, the cells were removed with centrifugation and the absorbance readings of the solutions were measured at 420 nm. A yeast cell suspension without ABTS was used as a baseline. Commercially produced laccase from Rhus vernificera (activity, 50 U per mg of solid) was used as a positive control at 1 U in 1 ml of PBS. For cytoplasmic extracts, yeast cells were collected, suspended in 0.1 M Na₂HPO₄ with protease inhibitor, and treated once for 6 min in a bead beater at 2-min intervals alternating with 5 min on ice. Supernatants were separated from cellular debris by centrifugation and used in place of the yeast cell suspensions in the ABTS assay. This assay was also used with commercial laccase incubated with voriconazole using various concentrations of either compound.

Phagocytosis assays. J774.16 is a well-characterized murine macrophagelike cell line that has been extensively used to study C. neoformans-macrophage interactions. The J774.16 cells was maintained at –80°C prior to use and were prepared for the phagocytosis assays as described previously (12). A density of 5 x 10⁴ C. neoformans 24067 yeast cells was grown in 25 ml of minimal medium supplemented with 1 mM L-dopa without or with voriconazole (0.25 or 0.5 MIC) or fluconazole (0.25 or 0.5 MIC) at 30°C for 7 days. Liquid cultures were shaken at 150 rpm. On days 3, 5, and 7, an aliquot was collected and washed three times in PBS. Cells were added to the J774.16 monolayer in a macrophage/yeast ratio of 1:1. The plates were incubated for 2 h at 37°C with 10 µg of monoclonal antibody 18B7/ml. Monoclonal antibody 18B7 binds to cryptococcal glucuronoxylomannan, the major component of the fungal capsule. The monolayer was washed three times with PBS to remove nonadherent cells, fixed with cold methanol, and stained with Giemsa (Sigma). The phagocytic index is the number of internalized yeast cells per number of macrophages per field. Internalized cells were differentiated from attached cells by their presence in a well-defined phagocytic vacuole. These measurements were determined by light microscopy using an Axiovert 200 M inverted microscope (Carl Zeiss MicroImaging, NY) at a magnification of x400. For each experiment, three wells were examined, and the ingested cryptococcal cells and macrophages in three fields were counted, with approximately 100 macrophages per field.

Statistical analysis. All data were subjected to statistical analysis using Origin 7.0 (Origin Lab Corp., Northampton, MA). P values were calculated by Student's t test or analysis of variance, depending on the data. P values of <0.05 were considered significant.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Voriconazole inhibits melanization at subinhibitory concentrations. C. neoformans melanization was significantly reduced and visibly delayed at 0.125 MIC of voriconazole (Fig. 1). In contrast, the addition of 0.5 MIC of amphotericin B, caspofungin, fluconazole, or itraconazole to C. neoformans cultures did not visibly affect melanization. Inhibition of melanization occurred in a similar manner in both liquid and solid media. The growth rate of C. neoformans was not affected by incubation in subinhibitory concentrations of voriconazole or fluconazole (Fig. 2). L-Dopa polymerization was not impeded by the presence of voriconazole at drug concentrations of up to 2x MIC for C. neoformans. By the third day of incubation, small black particles were visible in the flasks with and without antifungal drug, and the particle density increased similarly in all the flasks over a 2-week period.

View larger version (35K): [in this window] [in a new window]

FIG. 1. C. neoformans yeast cells were grown on minimal medium-1 mM L-dopa agar plates for 10 days at 30°C with or without the addition of antifungal drugs. (A) Growth of C. neoformans in the absence of antifungal drugs demonstrating dark pigmentation of the colonies and polymerization of the L-dopa in the agar surrounding the colonies due to the secretion of laccase into the medium. (B to D) C. neoformans grown with voriconazole at 0.125 (B), 0.25 (C), and 0.5 (D) MIC showing increasingly lower amounts of melanin formation in the colonies or within the agar. (E to H) There was no significant reduction of melanin production with 0.5 MIC of amphotericin B (E), caspofungin (F), fluconazole (G), or itraconazole (H). Plates were done in triplicate. This experiment was done twice, with similar results each time.

View larger version (24K): [in this window] [in a new window]

FIG. 2. Growth curve of C. neoformans with subinhibitory concentrations of voriconazole or fluconazole used in this study.

To confirm the results obtained by the plating assay, the percent inhibition in melanization of cryptococcal cells was determined by dry weight measurement (Table 1). The amount of melanin produced by fungal cells coincubated with L-dopa and voriconazole or fluconazole in minimal medium was isolated, quantified, and compared to the amount produced by yeast cells grown in minimal medium with L-dopa. C. neoformans melanization was significantly inhibited by voriconazole. Melanin production was reduced 82.1 and 94.5% after coincubation with 0.25 and 0.5 MIC of voriconazole, respectively. However, fluconazole did not prevent melanization at subinhibitory concentrations.

View this table: [in this window] [in a new window]

TABLE 1. Inhibition of C. neoformans 24067 melanin production by voriconazole

Voriconazole does not affect global gene regulation at subinhibitory concentrations. Three independent replicate experiments were carried out to generate the global gene regulation data set. After normalization of the data using Lowess smoothing, there were no genes identified with at least a twofold upward or downward change, which is considered to be the cutoff for significance with the microarray system used. Hence, although the concentration of voriconazole was sufficient to inhibit melanization, there was no evidence that the phenotype was transcriptionally based.

Voriconazole affects the expression of the melanin regulator gene LAC1 at subinhibitory concentrations. To explore changes in the expression of the LAC1 gene of C. neoformans that is required for melanin production and full virulence, qRT-PCR was performed on RNA extracted from cryptococcal cells grown in the absence or in the presence of sub-MICs of voriconazole and fluconazole (Fig. 3). Our results showed that coincubation with voriconazole significantly reduced LAC1 gene expression. Voriconazole decreased LAC1 gene expression by approximately 40% compared with its level of expression in control cells. However, LAC1 was not affected by a similar sub-MIC of fluconazole.

View larger version (19K): [in this window] [in a new window]

FIG. 3. Voriconazole affects C. neoformans LAC1 gene expression at subinhibitory concentrations. *, P < 0.05 in comparison with results for control or fluconazole groups. Error bars show standard deviations. This experiment was done twice, with similar results.

Voriconazole directly inhibits laccase activity. Voriconazole reduces the capacity of laccase to oxidize ABTS (Fig. 4). When 0.5 MIC of voriconazole was added to suspensions of cryptococci or to cytoplasmic extracts of the fungus, voriconazole dramatically inhibited the activity of the fungal laccase. In order to reproducibly examine these interactions, a commercial standardized recombinant laccase from Rhus vernificera was used to demonstrate that voriconazole inhibited the activity in a dose-dependent fashion (Fig. 5A). Similarly, reducing laccase in the presence of a constant concentration of voriconazole resulted in a dose-dependent reduction in activity (Fig. 5B).

View larger version (14K): [in this window] [in a new window]

FIG. 4. Oxidation of ABTS by C. neoformans laccase from intact cells or from supernatants of yeast cell extracts is suppressed by voriconazole. Recombinant laccase from Rhus vernificera incubated with ABTS represents the positive control, and the negative control is ABTS alone. Error bars show standard deviations. The experiment was done twice, and similar results were obtained.

View larger version (11K): [in this window] [in a new window]

FIG. 5. The oxidation of ABTS by laccase is reduced by the presence of voriconazole. (A) Increasing concentrations of voriconazole in the presence of a constant amount of laccase. #, P < 0.05; *, P < 0.001. The P values are in comparison to the activity of laccase in the absence of voriconazole. (B) Decreasing concentrations of laccase occur in the presence of a constant amount of voriconazole. **, P < 0.001 in comparison to the activity of the highest concentration of laccase in the absence of voriconazole. Error bars show standard deviations. The experiments were done twice, with similar results.

Reduction in C. neoformans cells’ melanization by voriconazole alters phagocytosis by J774.16 cells. We investigated whether coincubation of voriconazole with cryptococci in minimal medium supplemented with L-dopa altered the phagocytic activity of macrophagelike cells. Significantly more cryptococcal cells grown in the presence of the sub-MIC of voriconazole than cells grown in the absence of antifungal drug or in the presence of subinhibitory concentrations of fluconazole were phagocytosed by J774.16 cells (Fig. 6). Voriconazole reduced melanization by fungal cells in culture and increased the phagocytosis of yeast cells by J774.16 cells. As found in previous studies in our laboratory, the exposure of C. neoformans to subinhibitory concentrations of fluconazole also enhanced phagocytosis by macrophages.

View larger version (49K): [in this window] [in a new window]

FIG. 6. Voriconazole reduces C. neoformans 24067 melanization and alters yeasts phagocytosis by J774.16 cells. Bars are the averages of the results for three wells, and error bars denote standard deviations. *, P < 0.001 in comparison with the results for the control group; #, P < 0.05 in comparing the voriconazole group with the fluconazole group. This experiment was done twice, with similar results.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Voriconazole significantly impacts the ability of C. neoformans to produce melanin, which makes the yeast cells more susceptible to host effector cells. There are various mechanisms by which voriconazole could interfere with melanization. First, voriconazole could interfere with protein trafficking as a side effect of its action on fungal sterols, with consequent disruption of secretion pathways. In this regard, melanin-synthesizing enzymes are often located in the cell wall (5, 17) and the proper expression involves transport to the outside of the cell, possibly in secretory vesicles. Voriconazole may function in a manner analogous to glyphosate, which has been shown to inhibit melanin formation, probably through interference with the polymerization of laccase-oxidized precursors (9). The structure of voriconazole differs from that of fluconazole, its parent structure, by the addition of a methyl group and fluorine, which appears to be sufficient to alter the compound's ability to engage laccase. Interestingly, miconazole, a related imidazole, has been reported to interfere with the production of melanin in melanoma cells by inhibiting tyrosinase in a dose-dependent fashion, beginning at a concentration of 30 µM (6). Although the cryptococcal microarray failed to show any global differences upon challenge with subinhibitory amounts of voriconazole, the more-sensitive qRT-PCR revealed that voriconazole reduced the expression of the LAC1 gene. In addition to its role in C. neoformans melanization, laccase protects the fungus from toxic metabolites produced by macrophages via its iron oxidase activity (3). Hence, if voriconazole binds laccase, then the capacity of the enzyme to regulate iron oxidation could be impacted as well. Previous to this study, there was no evidence of any antifungal drug directly inhibiting fungal melanin-synthesizing enzymes. However, voriconazole has been shown to be effective against fungi at subtherapeutic concentrations by inhibiting conidiation in Aspergillus species (14).

The demonstration that voriconazole interferes with melanization suggests the exciting possibility that this drug may retain antimicrobial activity even if the targeted microbe develops resistance by mutations of the sterol-synthetic pathway and/or by selection of enhanced efflux mechanisms. This attribute would not be detected by in vitro susceptibility tests since these are standardized in conditions where fungi are not ordinarily melanized. Hence, it is conceivable that voriconazole would be active in vivo against fungi for which it has minimal or no in vitro activity, since a reduction in melanin production would translate into reduced virulence that in turn would allow increased clearance by host immune mechanisms. In this regard, Serena et al. recently demonstrated that voriconazole reduces fungal burden and enhances survival in a murine model of cryptococcal central nervous system infection (10). The human brain contains various phenolic compounds, such as norepinephrine, 3,4-dihydroxyphenylacetic acid, homovanillic acid, 5-hydroxyindoleacetic acid, serotonin, and dopamine, all of which can serve as substrates for the C. neoformans laccase. Our study shows that voriconazole, in addition to interfering with the production of ergosterol, can suppress laccase production, which could reduce the ability of C. neoformans yeast cells to utilize phenolic compounds as substrates for melanin production in the brain and other tissues, further crippling the organism's capacity to cause disease.

 
This study was supported by an unrestricted grant from Pfizer Pharmaceuticals Group, New York, NY. L.R.M. is supported by a molecular pathogenesis training grant. A.C. is supported in part by NIH grants GM-071421, AI033142, AI033774, AI052733, and HL059842. J.D.N. is supported in part by NIH grants AI52733 and AI056070-01A2, by a Wyeth Vaccine young investigator research award from the Infectious Disease Society of America, by the Center for AIDS Research at the Albert Einstein College of Medicine, and by Montefiore Medical Center (NIH AI-51519).

 
* Corresponding author. Mailing address: Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461. Phone: (718) 430-3766. Fax: (718) 430-8968. E-mail: nosanchu{at}aecom.yu.edu

Published ahead of print on 8 October 2007.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Franzot, S. P., and A. Casadevall. 1997. Pneumocandin L-743,872 enhances the activities of amphotericin B and fluconazole against Cryptococcus neoformans in vitro. Antimicrob. Agents Chemother. 41:331-336.[Abstract/Free Full Text]
2
2. Hill, Z. H. 1992. The function of melanin or six blind people examine an elephant. BioEssays 14:49-56.[CrossRef][Medline]
3
3. Liu, L., R. P. Tewari, and P. R. Williamson. 1999. Laccase protects Cryptococcus neoformans from antifungal activity of alveolar macrophages. Infect. Immun. 67:6034-6039.[Abstract/Free Full Text]
4
4. Mavrogiorgos, N., O. Zaragoza, A. Casadevall, and J. D. Nosanchuk. 2006. Efficacy of voriconazole in experimental Cryptococcus neoformans infection. Mycopathologia 162:111-114.[CrossRef][Medline]
5
5. Missall, T. A., J. M. Moran, J. A. Corbett, and J. K. Lodge. 2005. Distinct stress responses of two functional laccases in Cryptococcus neoformans are revealed in the absence of the thiol-specific antioxidant Tsa1. Eukaryot. Cell 4:202-208.[Abstract/Free Full Text]
6
6. Mun, Y. J., S. W. Lee, H. W. Jeong, K. G. Lee, J. H. Kim, and W. H. Woo. 2004. Inhibitory effect of miconazole on melanogenesis. Biol. Pharm. Bull. 27:806-809.[CrossRef][Medline]
7
7. Nosanchuk, J. D., and A. Casadevall. 2003. The contribution of melanin to microbial pathogenesis. Cell. Microbiol. 5:203-223.[CrossRef][Medline]
8
8. Nosanchuk, J. D., W. Cleare, S. P. Franzot, and A. Casadevall. 1999. Amphotericin B and fluconazole affect cellular charge, macrophage phagocytosis, and cellular morphology of Cryptococcus neoformans at subinhibitory concentrations. Antimicrob. Agents Chemother. 43:233-239.[Abstract/Free Full Text]
9
9. Nosanchuk, J. D., R. Ovalle, and A. Casadevall. 2001. Glyphosate inhibits melanization of Cryptococcus neoformans and prolongs survival of mice after systemic infection. J. Infect. Dis. 183:1093-1099.[CrossRef][Medline]
10
10. Serena, C., F. J. Pastor, M. Marine, M. M. Rodriguez, and J. Guarro. 2007. Efficacy of voriconazole in a murine model of cryptococcal central nervous system infection. J. Antimicrob. Chemother. 60:162-165.[Abstract/Free Full Text]
11
11. Van Duin, D., A. Casadevall, and J. D. Nosanchuk. 2002. Melanization of Cryptococcus neoformans and Histoplasma capsulatum reduces their susceptibility to amphotericin B and caspofungin. Antimicrob. Agents Chemother. 46:3394-3400.[Abstract/Free Full Text]
12
12. Van Duin, D., W. Cleare, O. Zaragoza, A. Casadevall, and J. D. Nosanchuk. 2004. Effects of voriconazole on Cryptococcus neoformans. Antimicrob. Agents Chemother. 48:2014-2020.[Abstract/Free Full Text]
13
13. Reference deleted.
14
14. Varanasi, N. L., I. Baskaran, G. J. Alangaden, P. H. Chandrasekar, and E. K. Manavathu. 2004. Novel effect of voriconazole on conidiation of Aspergillus species. Int. J. Antimicrob. Agents 23:72-79.[CrossRef][Medline]
15
15. Wang, Y., P. Aisen, and A. Casadevall. 1996. Melanin, melanin "ghosts," and melanin composition in Cryptococcus neoformans. Infect. Immun. 64:2420-2424.[Abstract/Free Full Text]
16
16. Reference deleted.
17
17. Zhu, X., J. Gibbons, J. Garcia-Rivera, A. Casadevall, and P. R. Williamson. 2001. Laccase of Cryptococcus neoformans is a cell wall-associated virulence factor. Infect. Immun. 69:5589-5596.[Abstract/Free Full Text]

---

Antimicrobial Agents and Chemotherapy, December 2007, p. 4396-4400, Vol. 51, No. 12
0066-4804/07/$08.00+0     doi:10.1128/AAC.00376-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services E-mail this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Martinez, L. R. Articles by Nosanchuk, J. D. Search for Related Content PubMed PubMed Citation Articles by Martinez, L. R. Articles by Nosanchuk, J. D.