Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Vickers, A. A. Articles by O'Neill, A. J. Search for Related Content PubMed PubMed Citation Articles by Vickers, A. A. Articles by O'Neill, A. J.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, December 2007, p. 4484-4485, Vol. 51, No. 12
0066-4804/07/$08.00+0     doi:10.1128/AAC.00708-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Intrinsic Novobiocin Resistance in Staphylococcus saprophyticus

Anna A. Vickers, Ian Chopra, and Alex J. O'Neill^*

Antimicrobial Research Centre and Research Institute of Molecular and Cellular Biology, University of Leeds, Leeds LS2 9JT, United Kingdom

Received 31 May 2007/ Returned for modification 24 July 2007/ Accepted 5 September 2007

Top ABSTRACT TEXT REFERENCES

 
Intrinsic novobiocin resistance in Staphylococcus saprophyticus was associated with expression of a novobiocin-resistant form of the drug target protein (GyrB). Site-directed mutagenesis established that resistance depends upon the presence of two specific amino acid residues in GyrB: a glycine at position 85 and a lysine at position 140.

Top ABSTRACT TEXT REFERENCES

 
Coagulase-negative staphylococci are commensals of the human skin flora (6) However, many are also significant disease-causing organisms, responsible for infections in both hospital and community environments (4, 6). For instance, Staphylococcus saprophyticus is the second most common pathogen identified in acute uncomplicated urinary tract infections (6). The success of this organism as a urinary tract pathogen is attributed to the possession of a specific cell wall-anchored adhesin, the production of urease, and a proliferation of transport systems which facilitate adaptation to the human urogenital environment (5). S. saprophyticus is innately resistant to the coumarin antibiotic novobiocin (4). Indeed, uniform resistance to novobiocin is a property central to the identification of S. saprophyticus isolates in the diagnostic laboratory and is particularly valuable for distinguishing S. saprophyticus from other coagulase-negative species of staphylococci (4, 6, 8). However, the basis of inherent resistance to novobiocin in S. saprophyticus is unknown.

Acquired resistance to novobiocin in staphylococci and bacteria of other genera is predominantly due to the accumulation of point mutations in the gene gyrB, encoding the DNA gyrase B subunit (GyrB), the target of novobiocin (2). To examine the importance of gyrB in the resistance of S. saprophyticus to novobiocin, we sought to introduce gyrB from S. saprophyticus into Staphylococcus aureus (which is naturally susceptible to novobiocin) and assess the novobiocin susceptibility of the resulting recombinant strain. The gyrB gene and ribosome-binding site were amplified by PCR from S. saprophyticus ATCC 15305 (5) and from a negative control strain, S. aureus SH1000 (3), using the following oligonucleotide primers (engineered restriction sites shown underlined): S. saprophyticus gyrB forward, 5'-TAGACGGTACCGAACATGAAATTATGAAAAACG; S. saprophyticus gyrB reverse, 5'-GATTGAGCTCATTCAGCCATCAAGATATCCTCC; S. aureus gyrB forward, 5'-TCATTGGTACCTGAATAACGCTAAATTGTATCG; S. aureus gyrB reverse, 5'-CTTGAGAGCTCTAATTCAGCCATCAAGAGTTCC. PCR amplicons were digested with KpnI/SacI and ligated into the tetracycline-regulable expression vector pAJ96 (7) to generate constructs pAJ96-SAP (gyrB from S. saprophyticus) and pAJ96-SA (gyrB from S. aureus). Both constructs were subjected to DNA sequencing to confirm that mutations had not been introduced during PCR amplification. The recombinant plasmids were propagated in Escherichia coli prior to recovery and electroporation (9) into S. aureus RN4220 (1). Transformants were grown overnight at 37°C with aeration in Iso-Sensitest broth, diluted 1:50 in fresh medium, and allowed to grow for 60 min. Anhydrotetracycline (250 ng/ml) was added to cultures to induce expression from the xyl/tetO promoter on pAJ96, and incubation was continued for 3 h. The cultures were then subjected to novobiocin susceptibility testing by agar dilution in Iso-Sensitest agar. After 24 h of incubation at 37°C, MICs were determined as the lowest concentration of novobiocin that prevented visible colony growth (11).

Expression of gyrB from S. saprophyticus in S. aureus RN4220 conferred a ca. 64-fold increase in resistance to novobiocin, relative to wild-type RN4220/SH1000 and RN4220 carrying unmodified pAJ96 (Table 1). This increase in resistance was not the result of elevated gene dosage of the drug target, since expression of gyrB from S. aureus SH1000 in RN4220 did not affect novobiocin susceptibility (Table 1). Since the level of novobiocin resistance achieved following expression of S. saprophyticus gyrB in S. aureus in trans was essentially the same as observed for wild-type S. saprophyticus (Table 1), it appears that the intrinsic novobiocin resistance of this organism results predominantly from expression of a novobiocin-resistant GyrB protein.

View this table: [in this window] [in a new window]

TABLE 1. Novobiocin susceptibilities of staphylococcal strains used in this study

To identify amino acid residues in S. saprophyticus GyrB with a role in novobiocin resistance, we aligned the amino acid sequences of GyrB from S. aureus and S. saprophyticus and compared these with previously published data on novobiocin resistance polymorphisms selected in S. aureus (2) (Fig. 1). Residues G₈₅ and K₁₄₀ of S. saprophyticus GyrB were predicted to contribute to novobiocin resistance, since mutations at corresponding sites in S. aureus GyrB (D₈₉G, R₁₄₄G, R₁₄₄I, or R₁₄₄S) are associated with acquired resistance to novobiocin (2), and the amino acids differ at these positions in the two species (Fig. 1). To examine the role of these residues in novobiocin resistance, site-directed mutagenesis was used to replace these amino acids with those found at the corresponding locations in S. aureus GyrB. The QuikChange kit (Stratagene, Amsterdam, The Netherlands) was used in conjunction with gel-purified oligonucleotide primers (G₈₅D forward, 5'-GATAATGGCCGTGGTATACCTGTTGATATTCAAGAAAAAATGGGACGTCC; G₈₅D reverse, 5'-GGACGTCCCATTTTTTCTTGAATATCAACAGGTATACCAC GGCCATTATC; K₁₄₀R forward, 5'-GAAGATCTTGAAGTATACGTGTATAGAGACCGCAAAGTTTATCATCAAGG; K₁₄₀R reverse, 5'-CCTTGATGATAAACTTTGCGGTCTCTATACACGTATACTTCAAGATCTTC [site-directed mutations are underlined]) using pAJ96-SAP as a PCR template to generate constructs pAJ96-SAP85, pAJ96-SAP140, and pAJ96-SAP85/140, encoding the substitutions G₈₅D, K₁₄₀R, and both G₈₅D and K₁₄₀R, respectively.

View larger version (14K): [in this window] [in a new window]

FIG. 1. Amino acid sequence alignment of the N-terminal region of GyrB (where novobiocin resistance mutations occur) from S. aureus with that from S. saprophyticus. The G85D and K140R substitutions introduced by site-directed mutagenesis are shown above the S. saprophyticus (S.sap) sequence (1, pAJ96-SAP85; 2, pAJ96-SAP140; 3, pAJ96-SAP85,140). Amino acid residues of S. aureus GyrB commonly involved in coumarin resistance are highlighted, and the substitutions are shown below the S. aureus (S.aur) wild-type sequence (2, 10).

Introduction of the G₈₅D mutation into S. saprophyticus GyrB reduced the novobiocin MIC against RN4220 carrying the corresponding gene from 8 µg/ml to 1 µg/ml (Table 1). Mutation of the S. saprophyticus gyrB gene to encode R₁₄₀ conferred a fourfold decrease in novobiocin resistance (Table 1). When both G₈₅D and K₁₄₀R mutations were introduced into S. saprophyticus GyrB, novobiocin resistance in RN4220 fell to a level equivalent to that encoded by the novobiocin-sensitive S. aureus enzyme.

In conclusion, our results show that the GyrB subunit of DNA gyrase is important in the innate resistance of S. saprophyticus to novobiocin and that G₈₅ and K₁₄₀ of GyrB are critical for the expression of resistance.

 
This work was supported by project grant GA483 awarded to I. Chopra by the British Society for Antimicrobial Chemotherapy.

 
* Corresponding author. Mailing address: Antimicrobial Research Centre and Research Institute of Molecular and Cellular Biology, University of Leeds, Leeds LS2 9JT, United Kingdom. Phone: 44-113-343-5600. Fax: 44-113-343-5638. E-mail: A.J.O'Neill{at}leeds.ac.uk

Published ahead of print on 17 September 2007.

Top ABSTRACT TEXT REFERENCES

 

1
1. Fairweather, N., S. Kennedy, T. J. Foster, M. Kehoe, and G. Dougan. 1983. Expression of a cloned Staphylococcus aureus alpha-hemolysin determinant in Bacillus subtilis and Staphylococcus aureus. Infect. Immun. 41:1112-1117.[Abstract/Free Full Text]
2
2. Fujimoto-Nakamura, M., H. Ito, Y. Oyamada, T. Nishino, and J. Yamagishi. 2005. Accumulation of mutations in both gyrB and parE genes is associated with high-level resistance to novobiocin in Staphylococcus aureus. Antimicrob. Agents Chemother. 49:3810-3815.[Abstract/Free Full Text]
3
3. Horsburgh, M. J., J. L. Aish, I. J. White, L. Shaw, J. K. Lithgow, and S. J. Foster. 2002. Sigma B modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J. Bacteriol. 184:5457-5467.[Abstract/Free Full Text]
4
4. Kloos, W. E., and T. L. Bannerman. 1994. Update on clinical significance of coagulase-negative staphylococci. Clin. Microbiol. Rev. 7:117-140.[Abstract/Free Full Text]
5
5. Kuroda, M., A. Yamashita, H. Hirakawa, M. Kumano, K. Morikawa, M. Higashide, A. Maruyama, Y. Inose, K. Matoba, H. Toh, S. Kuhara, M. Hattori, and T. Ohta. 2005. Whole genome sequence of Staphylococcus saprophyticus reveals the pathogenesis of uncomplicated urinary tract infection. Proc. Natl. Acad. Sci. USA 102:13272-13277.[Abstract/Free Full Text]
6
6. Martineau, F., F. J. Picard, C. Menard, P. H. Roy, M. Ouellette, and M. G. Bergeron. 2000. Development of a rapid PCR assay specific for Staphylococcus saprophyticus and application to direct detection from urine samples. J. Clin. Microbiol. 38:3280-3284.[Abstract/Free Full Text]
7
7. O'Neill, A. J., F. McLaws, G. Kahlmeter, A. S. Henriksen, and I. Chopra. 2007. Genetic basis of resistance to fusidic acid in staphylococci. Antimicrob. Agents Chemother. 51:1737-1740.[Abstract/Free Full Text]
8
8. Raz, R., R. Colodner, and C. M. Kunin. 2005. Who are you—Staphylococcus saprophyticus? Clin. Infect. Dis. 40:896-898.[CrossRef][Medline]
9
9. Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 73:133-138.[Medline]
10
10. Vickers, A. A., A. J. O'Neill, and I. Chopra. 2007. Emergence and maintenance of resistance to fluoroquinolones and coumarins in Staphylococcus aureus: predictions from in vitro studies. J. Antimicrob. Chemother. 60:269-273.[Abstract/Free Full Text]
11
11. Working Party on Antibiotic Sensitivity Testing of the British Society for Antimicrobial Chemotherapy. 1991. A guide to sensitivity testing. J. Antimicrob. Chemother. 27(Suppl. D):1-50.[Free Full Text]

---

Antimicrobial Agents and Chemotherapy, December 2007, p. 4484-4485, Vol. 51, No. 12
0066-4804/07/$08.00+0     doi:10.1128/AAC.00708-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Vickers, A. A. Articles by O'Neill, A. J. Search for Related Content PubMed PubMed Citation Articles by Vickers, A. A. Articles by O'Neill, A. J.