Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, April 2007, p. 1407-1413, Vol. 51, No. 4
0066-4804/07/$08.00+0 doi:10.1128/AAC.01251-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Rega Institute for Medical Research, Katholieke Universiteit Leuven, B-3000 Leuven, Belgium,1 Division of Histopathology, University Hospitals, Katholieke Universiteit Leuven, B-3000 Leuven, Belgium,2 Department of Chemistry and Technology of Drug, University of Perugia, Via del Liceo, 06123 Perugia, Italy,3 Department of Pharmaco-Biology, University of Calabria, 87030 Rende (CS), Italy,4 Department of Experimental Medicine and Biochemical Sciences, University of Rome Tor Vergata, Via Montpellier 1, 00133 Rome, Italy5
Received 5 October 2006/ Returned for modification 17 November 2006/ Accepted 8 January 2007
|
|
|---|
). Treating these SCID mice with HM-12 or HM-13 prior to hTNF-
stimulation resulted in a pronounced suppressive effect on viral reactivation. Since both quinolone derivatives were able to inhibit the reactivation of HIV-1 from this artificial viral reservoir in vivo, we provide encouraging evidence for the use of quinolones in the control of HIV-1 infections. |
|
|---|
A unique class of drugs that may contribute to the control of the latent HIV-1 reservoir includes the quinolone derivatives. Quinolones were first reported as an important class of broad-spectrum antibacterials based on the inhibition of prokaryotic type II topoisomerases, namely, DNA gyrase and, in a few cases, topoisomerase IV (39). In addition to their antibacterial properties, the quinolones have been shown to inhibit HIV-1 replication in vitro in both acutely and chronically HIV-infected cell lines by interfering with Tat-mediated transcription (4, 5, 11, 34, 38, 40, 41, 44). Richter and coworkers found that the mechanism of anti-HIV action could be ascribed to the interaction of the quinolone with the bulge of the HIV-1 TAR RNA element, resulting in the inhibition of Tat-TAR complex formation (38). This antiviral approach has also been described for many other classes of anti-HIV compounds, including peptoids (such as CGP64222 or TR87) (19, 21), Tat peptide mimetics (13), polyamide oligomers (27), arginine-aminoglycoside conjugates (25), intercalators (32), chemically modified aptamers (15, 22), and TAR RNA decoys (8, 29, 43). In addition, quinolones have been shown not only to inhibit HIV replication but also to be inhibitory to human cytomegalovirus, varicella-zoster virus, and herpes simplex virus types 1 and 2 (41, 46). The mechanism of inhibition of these human herpesviruses remains to be discovered.
Animal models have played an important role in HIV pathogenesis studies and in preclinical evaluations of therapeutic strategies. Two well-established xenochimeric models have been developed by transplanting immunodeficient mice with either human peripheral blood leukocytes (hu-PBL-SCID mice) (30, 31) or pieces of human fetal tissues containing hematopoietic cells (SCID-hu Thy/Liv mice) (28, 33). Furthermore, thymopoiesis in the SCID-hu Thy/Liv mouse model was also used to generate latently infected cells, thus further expanding its utility (3, 9). More recently, multiple researchers have been able to develop a functional human immune system in central and peripheral lymphoid organs of newborn Rag2/
c/ mice by injection of human CD34+ hematopoietic cells (6, 7, 48). This mouse model of HIV infection shows great promise for future pathogenesis studies as well as for the evaluation of new drug treatments. Although these in vivo models closely resemble HIV infection in humans, we developed a rather simple and artificial SCID mouse model of HIV-1 latency to evaluate the potential of HIV reactivation inhibitors in a faster, more cost-effective way. This xenochimeric model is based on the engraftment of latently HIV-1-infected promyelocytic OM-10.1 cells into SCID mice in which HIV-1 can be reactivated in vivo by the administration of human tumor necrosis factor alpha (hTNF-
). This study represents the first proof of concept that quinolone-based drugs are inhibitory to HIV-1 replication in vivo and that they may prevent virus reactivation from the artificial viral reservoir.
|
|
|---|
![]() View larger version (4K): [in a new window] |
FIG. 1. Structural formulas of the 6-DFQ derivatives HM-12 and HM-13.
|
Assessment of antiviral drug activity in acutely infected M/M. One day after separation (i.e., 6 days after being plated), M/M were treated with various concentrations of drugs (HM-12 and HM-13) and then exposed to 2,000 pg/ml of HIV-1 (BaL). Two hours after virus challenge, M/M were washed to remove the viral inoculum, and complete medium containing the appropriate drugs was replaced. M/M were then cultured for the duration of the experiments by replenishing them with fresh complete medium and drugs every 7 days. Supernatants were collected at different time points (7 and 14 days) for assessment of virus production by analysis of HIV-1 p24 production with a commercially available kit (Bio-Rad). The p24 antigen evaluation was repeated at later time points in selected experiments. The geometric mean of p24 Gag antigen production for replicates in each experiment was used to determine the effective drug concentration where 50% or 90% of viral replication was inhibited (EC50 and EC90, respectively) by linear regression of the log of the percent HIV-1 p24 production (compared to that in untreated controls) versus the log of the drug concentration.
Assessment of antiviral drug activity in chronically infected M/M. M/M were defined as being chronically infected when no new rounds of infection occurred in cultures in vitro and the p24 production remained stable. Our previous experience demonstrated that such a chronic infection status starts on day 10 after virus challenge. For this purpose, M/M were challenged with 2,000 pg/ml of HIV-1 BaL (in the absence of any drug) on day 0. At the time that chronic infection was established, M/M were carefully washed at least twice to remove any virus present in the supernatants, replenished with fresh complete medium containing HM-12 or HM-13 at the same dose used for the acute treatment, and cultured under the same conditions as described before. Each drug concentration was run in triplicate or quadruplicate, while positive controls were run in sextuplicate. The supernatants of HIV-1-infected M/M were collected on days 13, 17, and 20, and the drugs were re-added at these time points at the appropriate concentrations. The supernatants of the cell cultures taken at 17 and 20 days were assessed to determine virus production in the presence or absence of drugs by measuring HIV p24 production.
Assessment of antiviral drug activity in latently infected M/M.
The activity values for the quinolone derivatives against latent HIV-1 infection were based on the inhibition of p24 antigen production in OM-10.1 and U1 cells after stimulation with hTNF-
(Roche Diagnostics Belgium) and phorbol myristate acetate (PMA; Sigma Chemical Co., Bornem, Belgium). Briefly, OM-10.1 and U1 cells (500,000 cells/ml) were incubated in the presence or absence of the compounds for 2 h in 48-well plates. After this short incubation period, the cell cultures were stimulated with 1 ng/ml of hTNF-
or 0.02 µM of PMA, followed by two transfers of 200 µl to a 96-well plate for cytotoxicity evaluation. After a 2-day incubation period at 37°C, the cell culture supernatants were collected from the 48-well plates and examined for their p24 antigen levels with an HIV-1 p24 enzyme-linked immunosorbent assay kit (NEN, Brussels, Belgium). The cytotoxicities of the compounds for both latently HIV-1-infected OM-10.1 and U1 cells in the 96-well plates were based on 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability staining, as previously described (35).
Quantitative real-time PCR.
Quantitative determinations of full-length viral RNA in the latently HIV-1-infected cell lines OM-10.1 and U1 were done by real-time detection based on TaqMan technology, using the plasmid pHIV-RT-Q as a standard and pGAPDH-Q as an internal control. Cells were seeded into 24-well plates at a density of 750,000 cells per well and exposed to different concentrations of the compounds for 1 h. Next, 1 ng/ml of hTNF-
or 0.02 µM of PMA was added to the cell cultures, and they were incubated further overnight at 37°C. The next day, cells were collected, and RNAs were extracted using the TRIzol method (Invitrogen, Merelbeke, Belgium). PCRs were performed in 96-well optical reaction plates, with a final volume of 25 µl per well. Each PCR mix contained 5 µl RNA sample added to a mixture of 12.5 µl of TaqMan one-step reverse transcription-PCR master mix, 1.25 µl endogenous GAPDH control mixture, a 600 nM concentration (each) of primers HIV-RT-F and HIV-RT-R, and 250 nM of the TaqMan HIV RT probe (ATAAATGGACAGTACAGCCTATAGTGCTGCCAGA, with the reporter dye 6-carboxyfluorescein at the 5' end and the quencher dye 6-carboxytetramethylrhodamine at the 3' end). Real-time PCR was performed on an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA) under the following conditions: 30 min at 48°C for reverse transcription, 10 min at 95°C for enzyme activation, and 45 cycles of amplification (15 s at 95°C and 1 min at 60°C), with measurement of fluorescence at the end of each elongation step. All assays included two negative controls (water) and a dilution series of the plasmid pHIV-RT-Q, which contained a 93-bp fragment from the RT gene of HIV-1, as well as the endogenous control plasmid pGAPDH-Q, containing the complete human GAPDH gene. The detection of GAPDH RNA was conducted using a TaqMan predeveloped assay reagent containing a VIC/6-carboxytetramethylrhodamine-labeled TaqMan probe (Applied Biosystems, Foster City, CA). A standard curve of the cycle threshold values was constructed for each PCR assay in order to automatically calculate the sample quantities, using software for data analysis (26). All samples were performed in duplicate.
Animal experiments.
Male SCID mice of reproductive age (4 to 6 weeks old) were bred at the Rega Institute under specific-pathogen-free conditions and were used throughout the experiments. SCID mice were inoculated intraperitoneally with 107 latently HIV-1-infected OM-10.1 cells. Four animals were used for each experimental condition. On days 19, 20, and 21 postinoculation (p.i.), two groups of four SCID mice were injected intraperitoneally once daily with the dimethyl sulfoxide-dissolved quinolones HM-12 and HM-13 at a dose of 50 mg/kg of body weight/day. One hour later on day 21 p.i., drug-treated as well as untreated SCID mice were injected intraperitoneally with 40 µg of hTNF-
, obtained from Pieter Rottiers of the Department for Molecular Biomedical Research (VIB/UGent). All mice were anesthetized on day 22 p.i., blood samples were collected by cardiac puncture, and the mice were sacrificed. Viral loads were measured by analysis of HIV-1 p24 antigen and viral RNA load determination with the serum. Additionally, hTNF-
levels were quantified using an hTNF-
-specific enzyme-linked immunosorbent assay kit (Roche Diagnostics Belgium). Finally, different vital tissues of the mice were examined histologically.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Inhibitory effects of the 6-DFQs HM-12 and HM-13 on acutely and chronically HIV-1-infected human M/M
|
or PMA exposure, a dramatic (
1,000-fold) increase in HIV-1 expression occurred in both M/M cell lineages, which was set as 100% (Fig. 2). In the presence of various concentrations of quinolone derivatives HM-12 and HM-13, a dose-dependent inhibition of viral p24 production was observed in both latently HIV-1-infected cell lines. Similar inhibition was noted, irrespective of the stimulation conditions (hTNF-
or PMA), at compound concentrations far below cytotoxic concentrations. HM-12 and HM-13 inhibited HIV-1 production in OM-10.1 cell cultures by 50% (EC50) at concentrations of 0.054 µg/ml and 0.045 µg/ml, respectively, when stimulated with hTNF-
, while stimulation with PMA resulted in comparable EC50 values of 0.039 µg/ml and 0.04 µg/ml, respectively. The 50% cytotoxic concentrations (CC50) of HM-12 and HM-13 in OM-10.1 cells were around 5 µg/ml. A selectivity index (CC50/EC50) of approximately 125 could be reached for both compounds (Fig. 2). Evaluation of both quinolones in latently HIV-1-infected U1 cells upon hTNF-
and PMA stimulation resulted in a similar concentration-dependent inhibition of virus production, though with slightly increased cytotoxicity.
![]() View larger version (30K): [in a new window] |
FIG. 2. Inhibitory effects of HM-12 and HM-13 on hTNF- - and PMA-induced expression of HIV-1 in OM-10.1 and U1 cells. The cells were incubated with the compounds for 2 h, stimulated with either 1 ng/ml hTNF- (black bars) or 0.02 µM PMA (white bars), and further incubated for 48 h. Supernatants were then collected for p24 antigen quantification, and the p24 levels are expressed as percentages of the control value (no compound). Cell cultures were examined for cell viability ( ) by using the MTT method. All experiments were carried out in quadruplicate, and results are presented as mean values with standard deviations (1 µg/ml HM-12 equals 2.32 µM, and 1 µg/ml HM-13 equals 2.38 µM).
|
or PMA. In this context, we made a construct that contains a 93-bp fragment from the RT gene of HIV-1 to serve as a standard for quantification of the population of full-length viral mRNAs. The small amount of viral transcripts quantified under unstimulated conditions was subtracted from the amount measured in all stimulated samples once all data were normalized using the quantification results obtained for the endogenous control GAPDH. Following hTNF-
and PMA stimulation of the latently HIV-1-infected OM-10.1 and U1 cells, we observed a 1,000-fold increase in viral mRNA production. The mRNA production in samples representing stimulation conditions in the absence of inhibitor was set as 100% and used as a reference to express the effects of the quinolones HM-12 and HM-13 on HIV-1 transcription in latently HIV-1-infected cells (Fig. 3). As shown in Fig. 3, both compounds were endowed with remarkable suppressive effects on HIV-1 transcription in OM-10.1 and U1 cells upon stimulation with either hTNF-
or PMA. HM-12 and HM-13 inhibited viral mRNA production in OM-10.1 cell cultures by 50% at concentrations of 0.067 µg/ml and 0.060 µg/ml, respectively, when stimulated with hTNF-
, while stimulation with PMA resulted in 50% inhibitory values of 0.032 µg/ml and 0.040 µg/ml, respectively. The dose-dependent decrease of HIV-1 mRNA production observed in the OM-10.1 and U1 cell cultures upon quinolone treatment closely correlated with their inhibitory effect on viral p24 production from the latently HIV-1-infected cells upon stimulation with hTNF-
and PMA.
![]() View larger version (25K): [in a new window] |
FIG. 3. Inhibitory effects of HM-12 and HM-13 on HIV-1 RNA transcription in latently HIV-1-infected OM-10.1 and U1 cell lines after stimulation with 1 ng/ml hTNF- (black bars) or 0.02 µM PMA (white bars). Total RNA was isolated from the cells by the TRIzol RNA extraction method. Quantification of full-length viral RNA was assessed by real-time PCR, amplifying a 93-bp fragment of the HIV-1 RT gene by using TaqMan technology. In order to obtain HIV-1 RNA amounts, correction was included, using GAPDH as an endogenous control. All experiments were carried out in quadruplicate, and results are presented as mean values with standard deviations (1 µg/ml HM-12 equals 2.32 µM, and 1 µg/ml HM-13 equals 2.38 µM).
|
3 weeks after inoculation with OM-10.1 cells, plasma viral loads were increased 10- to 100-fold compared to those in untreated mice without any visible signs of agony or fatality (Fig. 4). As shown in Fig. 4, the plasma viral load was monitored by HIV-1 p24 antigen (panel A) and HIV-1 RNA (panel B) measurements. It was found that both parameters (p24 concentration and number of HIV-1 RNA copies) correlated well with one another. Therefore, both parameters were used to evaluate the effects of the quinolone derivatives on hTNF-
-induced virus production in vivo. Initially, we investigated HM-13 by intraperitoneal administration at a drug dose of 50 mg/kg once daily for a period of 3 days prior to hTNF-
administration. Approximately 18 h after hTNF-
stimulation, the viral load was analyzed and found to contain as much HIV-1 as that found in the absence of stimulation. This result was repeated in an independent experiment and confirmed the complete suppressive effect of HM-13 on viral reactivation in this artificial in vivo model (Fig. 4A and B). Additionally, the quinolone derivative HM-12 at a dose of 50 mg/kg/day administered for a period of 3 days was also found to be endowed with a pronounced inhibitory effect on viral reactivation in vivo. In order to obtain insights on the hTNF-
plasma levels present 18 h after intraperitoneal administration to the mice, we quantified, in parallel with the viral p24 levels, the hTNF-
levels in the plasma and observed values ranging between 900 and 1,900 pg/ml under all tested conditions, in the absence or presence of HM-12 or HM-13 (Fig. 4C). Finally, pathological examination of the mice revealed poorly differentiated promyelocytic tumors involving the whole peritoneal cavity. No extra-abdominal localizations were found, however, either in thoracic organs or in the brain. Within the abdomen, tumor tissue was found along lymphatics in the peritoneum, the abdominal lymph nodes, and the liver (Fig. 5). Remarkably, the pancreas was heavily inflicted. At 4 weeks, almost no pancreatic parenchyma was left, with major tumor growth resulting in death.
![]() View larger version (21K): [in a new window] |
FIG. 4. Evaluation of the effects of quinolone derivatives on viral reactivation in a novel artificial in vivo model of HIV-1 latency upon hTNF- stimulation. Viral loads were measured in the blood samples by analysis of HIV-1 p24 antigen levels and by viral RNA load determinations. In parallel, hTNF- levels were quantified in plasma.
|
![]() View larger version (151K): [in a new window] |
FIG. 5. Detail of the liver. The lumens of dilated lymph vessels along a portal vein are filled with promyelocytic tumor cells. The image was stained with hematoxylin and eosin. Magnification, x200.
|
|
|
|---|
or PMA. Since we found that HM-12 and HM-13 inhibited the production of viral mRNAs at concentrations in the ng/ml range, we proved that both quinolone compounds act at a postintegrational step in the HIV-1 replication cycle by inhibiting HIV-1 transcription.
Since these results and all previous data concerning the quinolones were obtained in vitro, we aimed to establish the anti-HIV potency of these HIV-1 transcription inhibitors in vivo. For this purpose, we developed an artificial but novel xenochimeric model of HIV-1 latency in which HIV-1 could be recovered from the bloodstream within 18 h of exposure of the animals by using hTNF-
. Virus production was quantified by the p24 level as well as the viral RNA load in plasma. It was found that both parameters closely correlated with each other. Using this animal model, we provide the first evidence of a potent anti-HIV activity of quinolone-based drugs in vivo. Initially, we evaluated HM-13 for its effect on the reactivation of HIV-1 from the artificial viral reservoir and found that the compound had a pronounced suppressive effect on viral reactivation in vivo under experimental conditions where no visible signs of drug toxicity could be detected before and after the SCID mice were sacrificed. The quinolone analogue HM-12 was also endowed with a marked anti-HIV activity in this artificial SCID mouse model of HIV-1 latency. Since both quinolones represent lead compounds, we plan to search and test for a larger number of compounds with optimal antiviral/cytotoxic properties in order to find clinically effective agents.
The quinolone derivatives are known as an important class of broad-spectrum antibacterials. The molecular mechanism of antibacterial action (i.e., prokaryotic DNA gyrase [topoisomerase II] and topoisomerase IV) is clearly different from the mechanism of anti-HIV action. Therefore, it is obvious that optimization of quinolone derivatives must show pronounced antiviral activity in the absence of appreciable antibacterial activity. This is important in view of the risk of potential resistance development in quinolone-exposed bacteria upon frequent or continuous drug exposure. Since the quinolones act at a postintegration stage in the replication cycle of HIV, they markedly slow down virus replication and should be interesting candidate drugs to be combined with entry, integrase, or reverse transcriptase inhibitors. It would also be interesting to find out whether the quinolone derivatives act synergistically when combined with HIV protease inhibitors that act at a late stage in the virus infection cycle.
In conclusion, we have shown that quinolone-based drugs are inhibitory to viral reactivation from an artificial latent HIV-1 reservoir both in vitro and in vivo. Since this study is the first to demonstrate anti-HIV activity of quinolones in vivo, it certainly prompts further investigations on the potential of the quinolones in the treatment of HIV-1 infection.
. These investigations were supported by grants from the European Commission (grant no. QLRT 2000-00291 and QLRT 2001-01311 and René Descartes Prize 2001 no. HPAW-2002-90001), the Geconcerteerde Onderzoeksacties Vlaanderen (project no. GOA-2005/19), the Fonds voor Wetenschappelijk Onderzoek Vlaanderen (FWO project no. G.0267.04), and the Ministero dell'Università e della Ricerca (PRIN 200403779_2004).
Published ahead of print on 22 January 2007. ![]()
|
|
|---|
c/ mice. Proc. Natl. Acad. Sci. USA 103:15951-15956.
c/ (RAG-hu) mouse model. Retrovirology 3:76.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»