Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, June 2007, p. 2092-2099, Vol. 51, No. 6
0066-4804/07/$08.00+0 doi:10.1128/AAC.00052-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
,
Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, Maryland 21205
Received 14 January 2007/ Returned for modification 2 March 2007/ Accepted 30 March 2007
|
|
|---|
|
|
|---|
Despite the discovery of the persister phenomenon over 60 years ago (3), the mechanism behind bacterial persistence has been elusive as the persisters represent a small fraction of the bacterial population and are constantly changing. The first molecular study of bacterial persistence was carried out by Moyed and Bertrand in 1983 when a gene in Escherichia coli called hipA, whose mutation caused about a 100- to 1,000-fold increase in penicillin-tolerant persister bacteria, was identified (16). hipA forms an operon with hipB as a toxin-antitoxin (TA) module where HipA as a toxin is tightly regulated by the repressor HipB, which forms a complex with HipA (4). A mutant hipA7 containing two mutations (G22S and D291A) (12) is involved in persistence to different antibiotics and to stress conditions (8, 18), although how hipA7 mediates persister formation is unclear. Most recently, HipA has been shown to be a serine kinase (6). The significance of HipAB in bacterial persistence in some gram-negative bacteria that have HipA homologs (8, 12) cannot explain the universal persister phenomenon in other gram-negative bacteria, especially gram-positive bacteria that do not have HipA homologs. Based on the microarray analysis of E. coli persisters not killed by ampicillin (10), Lewis and colleagues proposed a persister model where persister formation is dependent on various TA modules, such as HipBA and RelBE, which can inhibit peptidoglycan, RNA and DNA synthesis, and protein synthesis (4, 17), leading to multidrug tolerance (10). The overexpression of toxins such as HipA (8, 13, 21), RelE (10), and MazF (13, 21) could increase persister formation. However, a recent study showed that the overexpression of unrelated toxic proteins, such as heat shock protein DnaJ and protein PmrC, also caused higher persister formation (21). This finding challenges the significance of TA modules as a specific and universal mechanism for persister formation. In this study, we report the identification of a new persister gene, phoU, whose inactivation causes pan-susceptibility to various antibiotics and stresses, and propose a new model of persister formation based on PhoU as a persister switch.
|
|
|---|
Bacterial strains, construction of mutant library and library screen, DNA manipulations, inverse PCR, and DNA sequencing.
E. coli K-12 W3110 is F mcrAmcrB IN(rrnD-rrnE)1 lambda. Bacteriophage
NK1316, containing Tn10 kan cI857 Pam80 nin5 b522 att (11), was used for the construction of the E. coli transposon mutant library. Wild-type E. coli K-12 strain W3110 was subjected to mini-Tn10 (kanamycin) transposon mutagenesis using a method described previously (11). The mutant library consisting of 11,748 clones was grown in LB medium containing 50 µg/ml kanamycin in 384-well plates overnight. The library in 384-well plates was replica transferred to fresh LB medium in 384-well plates, which were incubated at 37°C for 5 h to log phase when ampicillin was added to 100 µg/ml. The plates were further incubated for 24 h when the library was replica transferred to LB plates to score for clones that failed to grow after ampicillin exposure.
Inverse PCR was used to localize the mini-Tn10 insertions in mutant E. coli. Two oligonucleotide primers at the end of IS903 of the mini-Tn10 derivative 103 (11) were synthesized (primer I, 5'-TTA CAC TGA TGA ATG TTC CG-3', and primer II, 5'-GTC AGC CTG AAT ACG CGT-3'). Chromosomal DNA of mutant strains was isolated and digested by the restriction enzyme HaeII or AvaII, and DNA restriction fragments were then circularized using T4 DNA ligase (Invitrogen). The PCR cycling parameters were 1 min at 96°C, followed by 30 cycles, each consisting of 10 s at 96°C, 30 s at 55°C, and 2 min at 65°C. PCR products were subjected to DNA sequencing with primer I as the sequencing primer. The DNA sequences of the PCR products were subjected to a homology search in the NCBI database using the BLAST algorithm.
The primers used for the construction of the plasmid containing a functional phoU gene are F(5'CGCATATGTTATGTACCTGGGCGAATTG3') and R (5'CCGGATCCTCATTATTTGTCGCTATCTTTCC3'). The purified PCR product was cloned using a pCR8/GW/TOPO TA cloning kit (Invitrogen, Carlsbad, Calif.) according to the manufacturer's protocol. The plasmid construct containing the phoU gene and a vector control were used to transform the PhoU mutant by electroporation. The deletion mutants of phoR, phoB, phoU, hipA, and hipAB were constructed as described previously by Datsenko and Wanner (7).
Susceptibility of PhoU mutant to various antibiotics. MICs and minimum bactericidal concentrations (MBCs) of ampicillin, gentamicin, trimethoprim, and norfloxacin were determined by using serial twofold dilutions of the antibiotics in LB broth. The initial cell densities were 106 to 107 bacteria/ml of log phase cultures, and the samples were incubated for 16 h at 37°C. The MIC was recorded as the minimum drug concentration that prevented visible growth, and the MBC was recorded as the drug concentration that reduced CFU by 100-fold over the seeded inoculum.
The susceptibilities of the log phase and stationary-phase PhoU mutant and wild type W3110 cultures to various antibiotics, including ampicillin (100 µg/ml), norfloxacin (3 µg/ml), gentamicin (20 µg/ml), trimethoprim (16 µg/ml), and PZA (2 mg/ml), were evaluated in a drug exposure experiment in MOPS minimal medium (pH 5.0). The antibiotic exposure was carried out over a period of several hours to 10 days at 37°C without shaking. Aliquots of bacterial cultures exposed to antibiotics were taken at different time points and washed in saline before plating for viable bacteria (CFU) on LB plates.
The sensitivity of bacterial strains to antibiotics or stresses was also assessed by the Kirby-Bauer method (2) using paper discs. E. coli bacteria were grown to log phase (108 bacteria) in LB broth. An inoculum from this culture was spread across the surfaces of LB plates to provide confluent growth. Nitrocellulose discs (7 mm in diameter) soaked with appropriate antibiotics or stress agents (100 mM H2O2) were placed on the agar surface. After incubation at 37°C for 48 h, the diameter of the zone of growth inhibition was measured and scored according to the size of the zone of inhibition, which is directly proportional to the sensitivity of the organism to the antibiotic. The results obtained were reproducible.
Susceptibility of PhoU mutant to various stresses. Overnight cultures of the PhoU mutant and the wild-type strain W3110 grown in LB broth at 37°C were incubated with acid, pH 4, at 37°C and 58°C, respectively, and incubated for various times, and the number of CFU per milliliter was determined by plating serial dilutions of cells on LB plates. For carbon starvation, cultures were grown overnight in M9 minimal medium with 0.4% glucose and then washed twice with saline. The cultures were diluted 1:100 in saline and incubated without shaking at 37°C at different time points. The susceptibilities of the PhoU mutant and the wild-type strain W3110 to weak acids were tested by incorporating salicylate (80 µg/ml) and pyrazinoic acid (230 µg/ml) into LB agar with acid at pH 5.0 in an MIC experiment wherein the growth inhibition was assessed by visible growth after incubating the LB plates at 37°C overnight.
DNA microarray analysis and qRT-PCR. The Affymetrix E. coli Genome 2.0 array was used in DNA microarray analysis of the PhoU mutant with the wild-type strain W3110 as a control. The PhoU mutant and the wild-type strain were grown in MOPS minimal medium overnight, and the RNA was isolated using a MasterPure RNA purification kit and reverse transcribed for making probes for array hybridization. The array was performed according to the manufacturer's instructions at the Johns Hopkins Malaria Research Institute Gene Array Core Facility. Triplicate samples of the PhoU mutant and the wild-type strain W3110 were used for each individual array (six arrays total), and the array data were analyzed using SAM (significance analysis of microarrays) software. For quantitative real-time PCR (qRT-PCR), the SuperScript III Platinum SYBR green one-step qRT-PCR kit was used. For qRT-PCR, the phoU primers were TATTGGCGACGTGGCGGAC and ATGAATGACGCGACAAGACG; the phoE primers were TCAACTGACTGGTTATGGTCG and TGTTGAAATACTGGTTTGCGC; and the fliA primers were ACTTGACGATCTGCTACAGG and TAGCGGTTTACAACGAGCTG.
|
|
|---|
PhoU mutant is more susceptible to various antibiotics. Since persisters are known to be tolerant or nonsusceptible to different antibiotics (14, 15, 26), we tested the susceptibilities of the PhoU mutant and the wild-type strain W3110 as a control to a variety of antibiotics, including ampicillin, norfloxacin, gentamicin, tetracycline, and trimethoprim. Interestingly, the PhoU mutant was found to be more susceptible than W3110 to all the antibiotics tested in both MIC and MBC experiments (Table 1). The PhoU mutant was generally 2- to 10-fold more susceptible than the wild-type strain to various antibiotics (Table 1). The higher susceptibility of the PhoU mutant than the wild-type strain to various antibiotics was also shown by a larger inhibition zone in the paper disc assay (Table 2). The transformation of the PhoU mutant with the functional phoU gene conferred increased resistance to the antibiotics compared to the wild-type level in the MIC/MBC experiments (Table 1) and also in the paper disc zone inhibition assay (Table 2).
|
View this table: [in a new window] |
TABLE 1. MIC and MBC determination for W3110 and JHU-313a
|
|
View this table: [in a new window] |
TABLE 2. Sensitivity of the E. coli PhoU mutant (JHU-313) and the complemented strain to antibiotics and peroxide as measured by zone of inhibitiona
|
![]() View larger version (18K): [in a new window] |
FIG. 1. Killing curve of the PhoU mutant and the wild-type strain W3110 upon ampicillin treatment (A) and the effect of complementation with the functional phoU gene (B). Log phase cultures of the E. coli PhoU mutant and wild-type W3110 and the PhoU mutant transformed with the phoU gene and the vector control were exposed to ampicillin 100 µg/ml for various times up to 3 h. The viability of the bacterial cultures was determined by CFU counts on LB plates. Error bars indicate standard deviations.
|
|
View this table: [in a new window] |
TABLE 3. Survival of the PhoU mutant and wild type E. coli strain W3110 with antibiotic exposure over timea
|
|
View this table: [in a new window] |
TABLE 4. Persister specificitya
|
![]() View larger version (20K): [in a new window] |
FIG. 2. Susceptibilities of the PhoU mutant JHU-313 and E. coli wild-type strain W3110 to stresses and energy inhibitors. More experimental details are described in Materials and Methods. (A) Susceptibilities to starvation in saline. (B) Susceptibilities to acid at pH 4.0 in LB. (C) Susceptibilities to energy inhibitors, 1 mM CCCP and 5 mM DCCD in MOPS minimal medium at pH 5.0. Error bars indicate standard deviations.
|
The PhoU mutant was also more sensitive than the wild-type W3110 to hydrogen peroxide, and the complementation of the PhoU mutant with the functional phoU gene restored peroxide resistance (Table 2). Under anaerobic conditions, the PhoU mutant was more susceptible than the wild-type strain, with about 100-fold fewer viable bacteria after 3 days of incubation. In an acid, pH 4.0, exposure experiment, the PhoU mutant was more sensitive to acid at pH 4.0 than was the wild type for the stationary-phase bacteria, such that after 7 days of exposure, no viable bacteria were recovered from the PhoU mutant, whereas the wild type had about 108 CFU/ml (Fig. 2B). The defect in survival in acid at pH 4.0 for the PhoU mutant was restored by complementation with the functional phoU gene, whereas the PhoU mutant transformed with the vector control remained as susceptible as the mutant itself (Fig. 2B). The PhoU mutant was also more susceptible than the wild-type strain W3110 to the energy inhibitors N,N'-dicyclohexylcarbodiimide (5 mM) (an F1F0 ATPase inhibitor) and CCCP (1 mM) (a proton carrier that dissipates proton motive force), such that there was an approximately 1,000-fold drop in CFU count in the PhoU mutant over that of the wild-type strain W3110 after 1 day of exposure in MOPS minimal medium at pH 5.0 (Fig. 2C). In addition, the PhoU mutant was more sensitive to the weak acids salicylic acid (80 µg/ml) and pyrazinoic acid (230 µg/ml) at pH 5.0, as shown by lack of growth at one-third the MIC compared with that of the wild-type strain W3110, which was resistant under such conditions (not shown).
Since weak acid susceptibility in Mycobacterium tuberculosis is correlated with susceptibility to the frontline tuberculosis drug PZA (a weak acid pyrazinoic acid amide) (29), a persister drug that depletes membrane energy, kills nonreplicating persister tubercle bacilli, and shortens the tuberculosis therapy (27, 28), we determined the susceptibility of the PhoU mutant to PZA. Interestingly, the stationary-phase PhoU mutant was more susceptible to PZA than was the wild-type strain W3110 (2 mg/ml at pH 5.0 in MOPS minimal medium) (Fig. 3). The PhoU mutant and wild-type strain had similar beginning CFU (108/ml) counts, and there was little difference in CFU counts between the two strains on the first day of incubation with PZA (Fig. 3). However, upon extended incubation, the stationary-phase PhoU mutant was much more susceptible to PZA by day 3 and was completely sterilized at day 6, whereas the stationary-phase wild-type strain W3110 had 6.7 x 106 CFU/ml remaining (Fig. 3). The log phase PhoU mutant was less susceptible than the stationary-phase PhoU mutant to PZA but was more susceptible to PZA than the log phase wild-type strain W3110 was, such that by day 10, the log phase PhoU mutant was completely killed, whereas the log phase wild-type W3110 had about 106 CFU/ml left (Fig. 3). These findings are surprising considering that normal-growing E. coli is highly resistant to PZA with a MIC of >2 mg/ml at pH 5.0 in the MIC experiment (22).
![]() View larger version (7K): [in a new window] |
FIG. 3. Susceptibilities of the log phase and stationary-phase PhoU mutant and the wild-type strain W3110 to pyrazinamide (2 mg/ml) exposure in MOPS minimal medium at pH 5.0. Error bars indicate standard deviations.
|
|
View this table: [in a new window] |
TABLE 5. Genes in the PhoU mutant JHU-313 that are upregulated twofold and above in DNA microarray analysis relative to wild-type strain W3110a
|
|
View this table: [in a new window] |
TABLE 6. Survival of the deletion mutants phoB, phoR, and phoBR with antibiotic exposure
|
|
View larger version (6K): [in a new window] |
FIG. 4. Expression of PhoU in E. coli wild-type strain W3110 in response to nutrient availability by Western blot analysis. Bacterial extracts were loaded onto a 14% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel. After electrophoresis and electrotransfer, the nitrocellulose membrane was stained with polyclonal antiserum against E. coli PhoU peptides to monitor PhoU expression. Lane 1, 27-kDa molecular mass marker; lane 2, W3110 grown overnight in MOPS minimal medium with 2 mM K2HPO4; lane 3, log phase growth of W3110 grown in rich LB medium; lane 4, stationary-phase growth of W3110 grown in LB medium.
|
|
|
|---|
PhoU was originally identified as a specific negative regulator for the Pho regulon (19). However, our findings that the PhoU mutant has such a diverse phenotype as being highly susceptible to various antibiotics (ampicillin, norfloxacin, gentamicin, tetracycline, and trimethoprim) and stress conditions (starvation, heat, peroxide, acid pH, weak acids, and energy inhibitors), along with our array data that show higher metabolic activity, as demonstrated by increased expression of flagella synthesis genes and energy production genes (Table 5), strongly suggest that the function of PhoU is beyond its role in phosphate metabolism and that it serves as a global negative regulator that shuts down cellular metabolism to facilitate persister formation. The very striking induction of numerous flagella and chemotaxis genes, along with increased expression of energy production enzymes in the PhoU mutant, suggest that loss of the negative regulator PhoU makes the cells hyperactive and makes them try to "escape" or seek nutrients. The highly metabolically active status of the cells provides an explanation for why the PhoU mutant is more susceptible to various antibiotics and stresses. PhoU as a negative regulator causes the PhoU mutant to lose the ability to suppress the metabolic processes necessary for persister formation so that no persisters can be produced, causing the cells without PhoU to become more susceptible to antibiotics and stresses. Our finding of increased expression of energy production and flagella and chemotaxis genes in the PhoU mutant is also consistent with the previous observation that E. coli persisters had decreased expression of energy production genes and flagella genes (13). This study provides the first evidence that PhoU is a master regulator involved in persister formation and whose inactivation leads to the loss of persisters as the underlying mechanism for the increased sensitivity to antibiotics and stresses.
It has previously been shown that the pstSCAB-phoU operon expression manifests the interesting property of "phase variation" as demonstrated by switching on and off in response to diverse environmental changes, such as the type of medium (rich medium versus minimal medium) and carbon source and the age of bacteria (19), which are associated with conditions that facilitate persister formation. Based on our findings on the role of PhoU in persister formation and the effect of nutrient availability on PhoU expression (Fig. 4) and the "phase variation" property of the pstSCAB-phoU operon (19), we propose a new persister model with PhoU as a master switch whose expression correlates with persister formation as follows. When bacteria are growing in the presence of sufficient nutrients (including phosphate) in rich medium such as LB medium, PhoU, as a negative regulator for cellular metabolism, is repressed or not expressed in the majority of the bacterial population (Fig. 4), which makes the bacteria susceptible to antibiotics and stresses. However, a small number of bacteria express low amounts of PhoU because of incomplete repression of the pstSCAB-phoU operon due to "phase variation," presumably caused by competing transcription activators and repressors in the promoter region of this operon (24), thus causing low level oscillatory or rhythmic transcription of the pstSCAB-phoU operon in response to changes in fluctuating environments, which allows persister formation in a small number of bacteria even during log phase growth. However, as bacteria enter stationary phase or encounter nutrient starvation, including phosphate starvation, PhoU is induced and expressed to a higher level (Fig. 4), which allows more persisters to form. The function of PhoU is to serve as a negative global regulator, which suppresses the overall cellular metabolic activity of the bacteria by affecting the genes or proteins involved in energy production, membrane transporters, etc., to facilitate persister formation, although the exact mechanism by which PhoU suppresses the cellular metabolic activity remains to be determined.
Our persister model based on PhoU, which needs to be confirmed by further studies, seems to best explain the pleiotropic phenotype of persisters that exhibit tolerance to various antibiotics and stresses and also the stochastic nature of persister generation in response to fluctuating environmental changes. Since PhoU is widely present in many gram-negative and gram-positive bacteria, PhoU is likely to be involved in persistence in other bacteria. It is of interest to note that M. tuberculosis, which is notorious for its persistence (15, 26), has two PhoU homologs, PhoY2 and PhoY1, in its genome (5). Persister bacteria pose enormous public health problems (14, 15, 26). Our finding that PhoU is a persister switch has implications for the design of new drugs that target persister bacteria and may find application for improved treatment of many persistent bacterial infections.
We thank Diane Griffin for support and encouragement; A. Jedlicka and A. Scott at the Gene Array Core Facility, Johns Hopkins Malaria Research Institute, for help with the microarray experiment; and Yanqin Yang for help with the array data analysis.
Published ahead of print on 9 April 2007. ![]()
Supplemental material for this article may be found at http://aac.asm.org/. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»