Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bacciaglia, A. Articles by Giovanetti, E. Search for Related Content PubMed PubMed Citation Articles by Bacciaglia, A. Articles by Giovanetti, E.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, August 2007, p. 3042-3043, Vol. 51, No. 8
0066-4804/07/$08.00+0     doi:10.1128/AAC.00249-07

LETTER TO THE EDITOR

SmaI Typeability and Tetracycline Susceptibility and Resistance in Streptococcus pyogenes Isolates with Efflux-Mediated Erythromycin Resistance

Top LETTER REFERENCES

 
In Streptococcus pyogenes, efflux-mediated macrolide resistance is encoded by the mef(A) gene and is associated with a particular resistance pattern (M phenotype) characterized by resistance, usually at a low level, only to 14- and 15-membered macrolides (10). The mef(A) gene is carried by different genetic elements, depending on whether the isolates are susceptible or resistant to tetracycline (2). In the tetracycline-susceptible isolates, mef(A) is contained in a Tn1207.1 transposon, identical to the one originally described in S. pneumoniae (9), inserted into larger genetic elements of phage origin such as Tn1207.3 (8) or 10394.4, a related 58.8-kb chimeric element (1). In the tetracycline-resistant isolates, mef(A) is linked to the tet(O) gene in a tet(O)-mef(A) chimeric element which, unlike the Tn1207.3-10394.4 family, may contain different, defective variants of the Tn1207.1 transposon and is not integrated into the chromosome within the comEC gene (2).

The most common method used to type macrolide-resistant streptococci involves restriction of genomic DNA with the SmaI endonuclease, followed by pulsed-field gel electrophoresis analysis. However, several studies have reported that some isolates with the M phenotype are nontypeable because their DNA is refractory to SmaI digestion. Since early studies, nontypeability was seen to be a characteristic of tetracycline-susceptible M-phenotype isolates (7, 11), typically carrying Tn1207.3 or 10394.4 (2, 6), whereas tetracycline-resistant M-phenotype isolates, typically carrying the tet(O)-mef(A) element (2), were usually restricted by SmaI (6). Subsequently, a DNA-modifying methyltransferase encoded by the Tn1207.3-10394.4 family was described, which acts on the SmaI recognition sequence and renders DNA refractory to cleavage by SmaI (4). Further insights were recently gained by Euler et al. (3), who identified a type II restriction-modification (R-M) cassette on 10394.4—located just downstream of Tn1207.1 in the conserved region of phage origin—formed by three open reading frames (ORFs): two encoding two subunits of a restriction endonuclease and one (spyIM) encoding the methyltransferase responsible for DNA resistance to SmaI digestion.

Three different strains from our collection of M-phenotype S. pyogenes strains were investigated: m46 [SmaI typeable, tetracycline resistant, carrying the tet(O)-mef(A) element] (2, 5, 6, 7), and Spy-1 and Spy-2 (both SmaI nontypeable and tetracycline susceptible, carrying Tn1207.3 and 10394.4, respectively) (6, 7). PCR analysis revealed the R-M cassette in strains Spy-1 and Spy-2 but not in strain m46 (nor in other tetracycline-resistant isolates containing different defective variants of the Tn1207.1 transposon [6; data not shown]). The entire region was explored by pairing primers ORF8-for (ACCGATTTGCCTCACTGCAC) and dsPOL-rev (ACCATTAGAGATGACATTCG), targeting umuC-mucB (the last ORF of Tn1207.1) and the intergenic region immediately downstream of the phage DNA polymerase gene, respectively. Whereas an amplicon of the size (10,756 bp) expected on the basis of the published sequences of Tn1207.3 (GenBank accession no. AY657002) and 10394.4 (GenBank accession no. AY445042) was obtained from strains Spy-1 and Spy-2, a smaller amplicon (7,380 bp) was obtained from strain m46 (Fig. 1). The 7,380-bp amplicon was sequenced (EMBL accession no. AM492531); sequence analysis showed that the entire R-M cassette and the adjacent ORF of Tn1207.3-10394.4 were replaced by three new ORFs encoding three hypothetical proteins. Two areas of homology with Tn1207.3-10394.4 were detected, upstream (93% homology, including umuC-mucB) and downstream (94% homology, including the phage DNA polymerase gene) of the three new ORFs (Fig. 1).

View larger version (15K): [in this window] [in a new window]

FIG. 1. ORF map of a sequenced portion of the tet(O)-mef(A) element from S. pyogenes strain m46 (EMBL accession no. AM492531) compared with the ORF map of the corresponding sequence of the Tn1207.3-10394.4 family. Striped arrows indicate the three ORFs detected only in the tet(O)-mef(A) element; black arrows indicate the four ORFs found in Tn1207.3-10394.4 instead of the three mentioned above; and white arrows indicate the ORFs common to the tet(O)-mef(A) element, Tn1207.3, and 10394.4. Gray areas indicate areas of homology. Thin arrows indicate the positions and directions of primers ORF8-for and dsPOL-rev. Other primers, not reported in the figure, were used to detect individual ORFs.

These findings contribute to conclusively clarifying why, among S. pyogenes isolates with the M phenotype, the tetracycline-resistant ones are, as a rule, SmaI typeable, while the tetracycline-susceptible ones are not. Previous studies have shown that, while the two related genetic elements (Tn1207.3 and 10394.4) typical of tetracycline-susceptible isolates are inserted into the same prophage, the tet(O)-mef(A) element typical of tetracycline-resistant isolates is inserted into a different prophage (6). The present results show that the R-M cassette encoding, in Tn1207.3-10394.4, the methyltransferase responsible for DNA resistance to cleavage by SmaI is absent in the tet(O)-mef(A) element where, together with an adjacent ORF, it is replaced by three new ORFs flanked, both upstream and downstream, by homologous regions.

 
This work was supported in part by a grant from the Italian Ministry of Education, University, and Research.

 
Published ahead of print on 11 June 2007.

Top LETTER REFERENCES

 

1
1. Banks, D. J., S. F. Porcella, K. D. Barbian, J. M. Martin, and J. M. Musser. 2003. Structure and distribution of an unusual chimeric genetic element encoding macrolide resistance in phylogenetically diverse clones of group A Streptococcus. J. Infect. Dis. 188:1898-1908.[Medline]
2
2. Brenciani, A., K. K. Ojo, A. Monachetti, S. Menzo, M. C. Roberts, P. E. Varaldo, and E. Giovanetti. 2004. Distribution and molecular analysis of mef(A)-containing elements in tetracycline-susceptible and -resistant Streptococcus pyogenes clinical isolates with efflux-mediated erythromycin resistance. J. Antimicrob. Chemother. 54:991-998.[Abstract/Free Full Text]
3
3. Euler, C. W., P. A. Ryan, J. M. Martin, and V. A. Fischetti. 2007. M.SpyI, a DNA methyltransferase encoded on a mefA chimeric element, modifies the genome of Streptococcus pyogenes. J. Bacteriol. 189:1044-1054.[Abstract/Free Full Text]
4
4. Figueiredo, T. A., S. I. Aguiar, J. Melo-Cristino, and M. Ramirez. 2006. DNA methylase activity as a marker for the presence of a family of phage-like elements conferring efflux-mediated macrolide resistance in streptococci. Antimicrob. Agents Chemother. 50:3689-3694.[Abstract/Free Full Text]
5
5. Giovanetti, E., A. Brenciani, R. Lupidi, M. C. Roberts, and P. E. Varaldo. 2003. Presence of the tet(O) gene in erythromycin- and tetracycline-resistant strains of Streptococcus pyogenes and linkage with either the mef(A) or the erm(A) gene. Antimicrob. Agents Chemother. 47:2844-2849.[Abstract/Free Full Text]
6
6. Giovanetti, E., A. Brenciani, M. Vecchi, A. Manzin, and P. E. Varaldo. 2005. Prophage association of mef(A) elements encoding efflux-mediated erythromycin resistance in Streptococcus pyogenes. J. Antimicrob. Chemother. 55:445-451.[Abstract/Free Full Text]
7
7. Ripa, S., C. Zampaloni, L. A. Vitali, E. Giovanetti, M. P. Montanari, M. Prenna, and P. E. Varaldo. 2001. SmaI macrorestriction analysis of Italian isolates of erythromycin-resistant Streptococcus pyogenes and correlations with macrolide-resistance phenotypes. Microb. Drug Resist. 7:65-71.[CrossRef][Medline]
8
8. Santagati, M., F. Iannelli, C. Cascone, F. Campanile, M. R. Oggioni, S. Stefani, and G. Pozzi. 2003. The novel conjugative transposon Tn1207.3 carries the macrolide efflux gene mef(A) in Streptococcus pyogenes. Microb. Drug Resist. 9:243-247.[CrossRef][Medline]
9
9. Santagati, M., F. Iannelli, M. R. Oggioni, S. Stefani, and G. Pozzi. 2000. Characterization of a genetic element carrying the macrolide efflux gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 44:2585-2587.[Abstract/Free Full Text]
10
10. Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817-1824.[Abstract]
11
11. Valisena, S., C. Falci, A. Mazzariol, G. Cornaglia, C. E. Cocuzza, P. Nicoletti, R. Rescaldani, and R. Fontana. 1999. Molecular typing of erythromycin-resistant Streptococcus pyogenes strains with the M phenotype isolated in Italy. Eur. J. Clin. Microbiol. Infect. Dis. 18:260-264.[CrossRef][Medline]

						A. Bacciaglia A. Brenciani P. E. Varaldo E. Giovanetti* Institute of Microbiology and Biomedical Sciences Polytechnic University of Marche 60020 Ancona, Italy
						* Phone: 39 071 2206297, Fax: 39 071 2206293, E-mail: e.giovanetti{at}univpm.it

---

Antimicrobial Agents and Chemotherapy, August 2007, p. 3042-3043, Vol. 51, No. 8
0066-4804/07/$08.00+0     doi:10.1128/AAC.00249-07

This article has been cited by other articles:

• Varaldo, P. E., Montanari, M. P., Giovanetti, E. (2009). Genetic Elements Responsible for Erythromycin Resistance in Streptococci. Antimicrob. Agents Chemother. 53: 343-353 [Full Text]  

This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bacciaglia, A. Articles by Giovanetti, E. Search for Related Content PubMed PubMed Citation Articles by Bacciaglia, A. Articles by Giovanetti, E.