This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lannergård, J.
Right arrow Articles by Hughes, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lannergård, J.
Right arrow Articles by Hughes, D.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, November 2008, p. 4017-4022, Vol. 52, No. 11
0066-4804/08/$08.00+0     doi:10.1128/AAC.00668-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Identification of the Genetic Basis for Clinical Menadione-Auxotrophic Small-Colony Variant Isolates of Staphylococcus aureus{triangledown}

Jonas Lannergård,1,{dagger} Christof von Eiff,2,{dagger} Gunnar Sander,2 Tina Cordes,2 Jochen Seggewiβ,2 Georg Peters,2 Richard A. Proctor,3 Karsten Becker,2 and Diarmaid Hughes1*

Microbiology Program, Department of Cell and Molecular Biology, Box 596, The Biomedical Center, Uppsala University, Uppsala S-75124, Sweden,1 Institute of Medical Microbiology, University Hospital of Münster, Domagkstrasse 10, Münster 48149, Germany,2 Department of Medical Microbiology & Immunology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin3

Received 21 May 2008/ Returned for modification 27 May 2008/ Accepted 1 September 2008


arrow
ABSTRACT
 
Small-colony variants (SCVs) of Staphylococcus aureus are associated with persistent infections and may be selectively enriched during antibiotic therapy. Three pairs of clonally related S. aureus isolates were recovered from patients receiving systemic antibiotic therapy. Each pair consisted of an isolate with a normal phenotype and an isolate with an SCV phenotype. These SCVs were characterized by reduced susceptibility to gentamicin, reduced hemolytic activity, slow growth, and menadione auxotrophy. Sequencing of the genes involved in menadione biosynthesis revealed mutations in menB, the gene encoding naphthoate synthase, in all three strains with the SCV phenotype. The menB mutations were (i) a 9-bp deletion from nucleotides 55 to 63, (ii) a frameshift mutation that resulted in a premature stop codon at position 230, and (iii) a point mutation that caused the amino acid substitution Gly to Val at codon 233. Fluctuation tests showed that growth-compensated mutants arose in the SCV population of one strain, strain OM1b, at a rate of 1.8 x 10–8 per cell per generation. Sequence analyses of 23 independently isolated growth-compensated mutants of this strain revealed alterations in the menB sequence in every case. These alterations included reversions to the wild-type sequence and intragenic second-site mutations. Each of the growth-compensated mutants showed a restoration of normal growth and a loss of menadione auxotrophy, increased susceptibility to gentamicin, and restored hemolytic activity. These data show that mutations in menB cause the SCV phenotype in these clinical isolates. This is the first report on the genetic basis of menadione-auxotrophic SCVs determined in clinical S. aureus isolates.


arrow
INTRODUCTION
 
Following the first description of an altered phenotype of Staphylococcus aureus more than 100 years ago (14), interest in staphylococcal subpopulations characterized by reduced growth on routine culture media has increased, as these variants have been linked to persistent, recurrent, and antibiotic-resistant infections (6, 25). An important part of the ability of small-colony variants (SCVs) to persist within the host probably relates to their ability to persist intracellularly in nonprofessional phagocytes, thereby shielding them from the host immune response (24, 32-34). SCVs reveal many changed physiological characteristics compared to the normal S. aureus phenotype, such as reduced pigmentation and hemolysis, and are marked by auxotrophisms for thymidine, menadione, and/or hemin (13, 24, 28, 35).

The SCV phenotype is often unstable, with some strains reverting at a high frequency to a normal colony phenotype (4, 25). Considerations that the SCV phenotype might have a regulatory basis have been addressed by experiments with aminoglycoside-induced SCVs. These hemin-auxotrophic SCV harbored two mutations, a deletion in hemH and a frame shift in hemA; both genes are involved in the biosynthesis of hemin (26). However, the actual genetic basis of the SCVs recovered from clinical specimens is still largely unknown, with an exception being two recent studies showing that thymidine-auxotrophic SCVs from cystic fibrosis patients carry mutations in the thymidylate synthase gene (tyhA) (5, 7). Thymidine-auxotrophic S. aureus SCVs show resistance to trimethoprim-sulfamethoxazole, which interferes with the tetrahydrofolic acid pathway. Thymidylate synthase (thyA) requires tetrahydrofolic acid as a cofactor to catalyze the last step of the thymidine biosynthesis pathway, which is responsible for the formation of dTMP. Thus, mutations in thyA (5, 7) provide a possible explanation for thymidine auxotrophy and the SCV phenotype.

In contrast, while many characteristics of hemin- or menadione-auxotrophic SCVs have been described in the past century (for a review, see reference 25), the molecular mechanisms responsible for these phenotypes are still not completely understood. Both hemin and menadione play a major role in electron transport (1, 3, 24, 32). Three lines of evidence suggest that biosynthesis genes for these compounds are involved in the development of clinical SCVs auxotrophic for hemin and menadione. First, supplementation of clinical SCVs with hemin or menadione completely reverses the SCV phenotype. As our original mapping of mutants and our understanding of modern genetics is based upon supplementation and mapping (linkage) of auxotrophies (22), this is an accepted principle for the biochemistry and molecular biology of microorganisms. Second, while there is some instability of the phenotype, the majority of colonies maintain the SCV phenotype for generations, suggesting a genetic mutation as the basis for the phenotype. Third, by interrupting genes of the biosynthesis pathway of hemin (hemB) and menadione (menD), we were able to reproduce the complete SCV phenotype, including hemin and menadione auxotrophy, respectively (2, 34). The mutants with these phenotypes were comprehensively characterized to obtain deeper insights into the physiological changes associated with the SCV phenotype (2, 5, 13, 28, 34, 35). Due to interrupted electron transport, these mutants exhibited decreased ATP levels and a reduced susceptibility to aminoglycosides compared to the susceptibility of their parental strains (13, 35). The resistance to aminoglycosides is caused by the reduced membrane potential of the mutants, which leads to the ineffective transport of the compound into the bacterium (3). In vitro, SCVs preferentially emerge in the presence of sublethal concentrations of aminoglycosides (1, 18, 21, 23).

Here, we report on a genetic study of three pairs of S. aureus strains recovered from patients with chronic osteomyelitis. For each pair, the menadione-auxotrophic SCVs and the S. aureus isolates with a normal phenotype were compared. In all three SCV strains, we identified mutations in menB.


arrow
MATERIALS AND METHODS
 
Strains and growth conditions. Clinical isolates of S. aureus (Table 1) were recovered from patients with chronic osteomyelitis at the University Hospital of Münster, Münster, Germany, as described previously (33). These patients were receiving systemic antibiotic therapy. Three menadione-auxotrophic SCVs were selected for further analyses on the basis of their stability (a stable SCV phenotype following several passages on solid media). Each pair, the parent strain and the SCV, was isolated in parallel or consecutively from the same patient. The S. aureus isolates were grown on Columbia sheep blood agar, tryptic soy agar, and Luria agar (LA) at 37°C for 24 to 72 h. Liquid cultures were grown in tryptic soy broth with incubation at 37°C on a shaker at 255 rpm.


View this table:
[in this window]
[in a new window]

 
TABLE 1. S. aureus strains used in this study

Auxotrophy assays. The testing of the S. aureus SCVs for auxotrophy was performed on chemically defined medium (29) with standard disks impregnated with hemin (Unipath, Basingstoke, United Kingdom) or disks impregnated with 15 µl of 100 µg/ml of menadione sodium bisulfite (Sigma Aldrich, Deisenhofen, Germany), as described previously (32, 33). Auxotrophism was identified if a zone of growth around the disks was detectable after incubation overnight at 37°C (Table 1). Strain stocks were stored frozen in Luria broth-dimethyl sulfoxide (7%) at –80°C.

MIC assays. MICs were determined with Etest strips (AB Biodisk, Solna, Sweden), as reported previously (12).

Genotyping by PFGE. To analyze the clonal relationship of the strain pairs (SCVs and isolates with a normal phenotype), SmaI digests of total bacterial DNA were resolved by pulsed-field gel electrophoresis (PFGE), as previously described in detail (32, 33).

Hemolysis assays. The hemolytic activity of the strains was assayed spectrophotometrically by measuring the amount of hemoglobin released, according to a published method (1, 34), by using horse red blood cells (hRBCs) obtained from the National Veterinary Institute (SVA), Uppsala, Sweden. The bacteria were grown overnight in tryptic soy broth (Oxoid Ltd., Basingstoke, England) at 37°C with agitation (200 rpm) in a shaker. After growth, the bacteria were pelleted by centrifugation at 3,500 x g for 7 min. The supernatants were decanted to remove hemolysins, and the same volume of phosphate-buffered saline (PBS) containing 1 mM CaCl2 and 0.5 mM MgCl2 was added. The bacteria were incubated for 1 h at 37°C to produce new hemolysin and were then pelleted (4,400 x g, 3 min), and the supernatants were filter sterilized (pore size, 0.2 µm; Sarstedt, Nümbrecht, Germany). After the hRBCs were washed three times with PBS to remove the hemoglobin, a 1.4% dilution was made in PBS containing 0.2% bovine serum albumin (BDH, VWR International Ltd., Poole, England). The filtered bacterial supernatants were added to an equal volume of the hRBC suspension. As a control for spontaneous hemolysis, PBS was added to the hRBCs. The samples and the controls were incubated for 1 h at 37°C and microcentrifuged at 13,600 x g for 10 s. The hemoglobin released was measured spectrophotometrically at A540. These values were compared to those for a series of standard hRBC dilutions (0.7%, 0.35%, 0.175%, 0.0875%, and 0.0438%) that were completely disrupted by sonication for 15 s. The standard hRBC dilutions represent 100%, 50%, 25%, 12.5%, and 6.25% total hemolysis, respectively. The results shown are the medians of at least three experiments.

PCR and DNA sequencing. Template DNA was prepared by dissolving a bacterial colony in 100 µl double-distilled H2O, adding ~100 µl 0.25-mm-diameter acid-washed glass beads (Sigma-Aldrich, Stockholm, Sweden), and mixing for 10 s to disrupt the cells. The primers used for amplification and sequencing of the S. aureus genes were designed on the basis of the publicly available genome sequences. After an initial denaturation step of 5 min at 95°C, 30 cycles of 15 s at 95°C, 15 s at 45°C, and 1 min/kb at 72°C were run. The last elongation step was prolonged to 5 min. DNA purification was performed with a QIAquick PCR purification kit (Qiagen, VWR International AB, Stockholm, Sweden), according to the manufacturer's recommendations. Sequencing reactions were carried out at Macrogen Inc. (Seoul, South Korea). The sequences were analyzed by using the Vector NTI program (version 10.3.0; Invitrogen, Carlsbad, CA). The following genes and their putative promoter regions, given here with locus tags from the publicly available strain COL genome, were sequenced (gene names in parentheses were obtained from homologous genes in other species): menA, SACOL1049; (menF), SACOL1051; menD, SACOL1052; (orf encoding putative hydrolase), SACOL1053; menB, SACOL1054; gerC, SACOL1510; ubiE (menG), SACOL1511; (menC), SACOL1843; and (menE), SACOL1844. The amplification of menB was performed with primers Sar-MenBF (CGCGAAGATAACTTTAAACAGCA) and Sar-MenBR (CCTATCGTCGCTAATAAACGA), and sequencing was done with primers Sar-MenBF2 (GGGAAAAGTTGCCATTATTT) and Sar-MenBR.

Mutation rate measurements. The rates of occurrence of growth-compensatory mutations and mutations to rifampin resistance were measured in fluctuation tests, according to the principles originally described by Luria and Delbrück for measurement of the rate of mutations to bacteriophage resistance in Escherichia coli (16). Mutation rates were calculated according to the formula µ = –(1/N) ln P0, where µ is the mutation rate per cell per generation, N is the number of cells tested per culture, and P0 is the proportion of cultures giving no mutants of the desired phenotype. To measure the rate of growth compensation, fresh colonies (strain OM1b, SCV phenotype) were suspended in 0.9% NaCl, and dilutions were spread on LA and visually scanned for fast-growing colonies after 16 to 20 h of incubation at 37°C. Each colony tested was considered to be an independent culture initiated by a single SCV cell. During the growth of a colony, fast-growing phenotypic revertants can arise by spontaneous mutation. When the suspended colonies were plated on solid medium, cells that carried preexisting mutations conferring normal growth gave rise to easily distinguishable large colonies against a background of extremely small microcolonies. To measure the rate of mutation to rifampin resistance, independent cultures were plated on LA-rifampin (100 µg/ml) and were incubated at 37°C overnight.

Selection of fast-growing compensated mutants/revertants from the SCVs. Fast-growing mutants from independent OM1b fluctuation tests were picked, purified by restreaking, and stored. The menB gene was sequenced to determine whether these fast-growing derivatives had reverted to the original wild-type sequence (normal growth) or whether they still carried the original menB mutation and had acquired an additional intragenic compensatory mutation.


arrow
RESULTS
 
Origins of SCV isolates. Three pairs of S. aureus clinical isolates (Table 1) were recovered from different patients with chronic osteomyelitis who were receiving systemic antibiotic therapy at the University Hospital of Münster. Each pair consisted of an isolate with a normal phenotype and an isolate with an SCV phenotype isolated either consecutively or concurrently from one patient. The three SCV clones differed significantly from their respective parental strains in that they were auxotrophic for menadione, had reduced susceptibility to gentamicin, and were nonhemolytic (Table 1 and Table 2). To confirm the clonal relationship within each of the three strain pairs, SmaI digests of total bacterial DNA were resolved by PFGE. Identical restriction patterns were observed for the SCV and the isolate with the normal phenotype recovered from a single patient (Fig. 1). When the strain pairs recovered from the three patients were compared to each other, different restriction patterns were, however, detectable. Regarding antimicrobial exposure prior to isolation of the SCVs, two patients, from whom SCV strains A22616/3 and OM 299/2 were recovered, had received gentamicin beads in a previous surgical procedure. Furthermore, systemic antibiotic therapy with oxacillin, clindamycin, and/or ciprofloxacin had been given to all three patients before these variants were isolated. Following recovery of the SCVs, rifampin or amoxicillin-clavulanic acid was added as an additional therapy. In all three patients, signs of infections were resolved prior to discharge from the hospital.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Genotypic and phenotypic properties of the three strain pairs and phenotypic revertants selected for normal growth from OM1b


Figure 1
View larger version (97K):
[in this window]
[in a new window]

 
FIG. 1. PFGE patterns (SmaI digest). Lane 1, bacteriophage lambda ladder PFGE marker (New England Biolabs); lane 2, S. aureus OM299/1 (normal-growth phenotype); lane 3, S. aureus OM299/2 (SCV phenotype); lane 4, S. aureus A22616/5 (normal-growth phenotype); lane 5, S. aureus A22616/3 (SCV phenotype); lane 6, S. aureus OM1a (normal-growth phenotype); lane 7, S. aureus OM1b (SCV phenotype); lane 8, bacteriophage lambda ladder PFGE marker (New England Biolabs).

Identification of mutations in menB in the SCV strains. We postulated that the menadione auxotrophy of the three SCV strains, strains A22616/3, OM299/2, and OM1b, might be caused by mutations in one of the genes involved in menadione biosynthesis. Using PCR and DNA sequencing, we therefore determined the DNA sequences of nine genes with predicted functions in menadione biosynthesis. By analyzing the men genes, several regions with highly variable base compositions in comparison to the sequences deposited in the public databases, irrespective of their phenotype, were found. The menD gene showed the highest degree of variability. However, the only differences within strain pairs were identified in the menB gene. Thus, in all three strains with the SCV phenotype, mutations were identified in the gene encoding naphthoate synthase, menB (coding sequence of 822 nucleotides [nt] and 274 codons). Strain A22616/3 carried a deletion of 9 bp from nt 55 to 63. This deletion led to the loss of four amino acids (phenylalanine, tyrosine, glutamate, and glycine) from the protein and the formation of a new triplet coding for tryptophan. Strain OM299/2 had a deletion of a single thymine (nt 687) that caused a frame shift that introduced a new stop codon at position 230. Compared to the protein of its parent strain, the protein of this SCV isolate was predicted to be truncated by 44 amino acids at the C terminus of naphthoate synthase. Finally, strain OM1b carried a base substitution mutation (underlined) at nt 698 (GGT to GTT) that caused the amino acid substitution Gly to Val at position 233.

If these mutations in menB were the cause of the SCV phenotype, we would predict that it should be possible to reverse the phenotype by reversion of the identified mutations or, in some cases, by the selection of appropriate second-site compensatory mutations within the menB gene. If, alternatively, the SCV phenotype was caused by mutations in other genes, then revertants in menB would not restore normal growth and growth compensation would not necessarily be associated with new mutations in menB. We therefore performed fluctuation assays to measure the rate of reversion of the SCV phenotype and also to collect mutants to test our prediction that growth-compensated mutants would carry genetic alterations in menB.

Rate of reversion of the SCV phenotype. The fluctuation tests of Luria and Delbrück (16) were carried out with freshly grown colonies of strains A22616/3, OM299/2, and OM1b to measure the rate of reversion from the SCV phenotype to a normal-growth phenotype. For two of the strains with the SCV phenotype, strains A22616/3 and OM299/2, no revertants were isolated and the rate of phenotypic reversion was calculated to be less than 2 x 10–10 per cell per generation. However, from SCV strain OM1b, phenotypic revertants to normal growth (Fig. 2) were isolated at a rate of 1.8 x 10–8 per cell per generation. This rate is of the magnitude that could be expected for reversion of a specific point mutation (17, 27). As a control for the general mutation rate in these strains, the rate to rifampin resistance was measured in parallel. The rate was ~10–8 for each of the strains, showing that they were not hypermutable.


Figure 2
View larger version (76K):
[in this window]
[in a new window]

 
FIG. 2. Difference between the normal-growth phenotype and the SCV phenotype for the strain pairs analyzed and for revertants to normal growth. (A) A22616/5 (normal-growth phenotype); (B) A22616/3 (SCV phenotype); (C) OM299/1 (normal-growth phenotype); (D) OM299/2 (SCV phenotype); (E) OM1a (normal-growth phenotype); (F) OM1b (SCV phenotype); (G) OM1b F2 (normal-growth revertant from OM1b); (H) OM1b F5 (normal-growth revertant from OM1b).

Sequence analysis of normal-growth revertants. The menB gene was amplified and its DNA sequence was determined (see Materials and Methods) from strains OM1a and OM1b and 23 independent mutants selected for normal growth in the fluctuation tests. The results (Table 2) showed that in every case selection of the normal-growth phenotype was associated with the acquisition of a mutation in menB. In 7 cases, this mutation was a direct reversion to the wild-type sequence (GTT to GGT, Val233Gly); in 10 cases, a new mutation in the originally mutated codon had been selected to result in an amino acid substitution (GTT to GCT, Val233Ala); in 4 cases, the original mutation remained and an additional mutation was selected in a separate codon in menB (AAA to ATA, Lys259Ile); finally, in 2 cases, a deletion of 9 nt was selected and removed the sequence corresponding to the mutated codon and the codon on either side of it (TTAGCTGTTTTACAA to TTACAA). The finding that all 23 reversions of the SCV phenotype to normal growth were associated with mutations in menB gives strong evidence that the original mutation in menB is the cause of the SCV phenotype in OM1b.

Phenotypes of the selected normal-growth revertants. If the mutation in menB is the cause of each of the phenotypes associated with the SCV (slow growth, menadione auxotrophy, reduced susceptibility to gentamicin, and reduced hemolysis), a strong prediction is that the selected normal-growth mutants with acquired mutations in menB (reversions and second-site mutations) should also show reversal of the phenotype. The selection of a normal-growth phenotype indicates that these strains are no longer auxotrophic for menadione. However, the MIC for gentamicin and hemolytic activity would not necessarily be reversed unless they were also caused by the same original mutation in menB. We measured the MIC and hemolysis phenotypes in each of the selected fast-growing mutants, and in every case, the menB growth-compensatory mutations were associated with a changes in antibiotic susceptibility (increased gentamicin susceptibility) and hemolytic activity (increased hemolysis) to levels that were indistinguishable from those in OM1a, the normal-growth parental strain (Table 2). This is the expected result if the Gly233Val mutation in menB is the cause of all of these phenotypes and the selected growth-compensatory mutations cause a simultaneous reversion of all of the phenotypes of this strain.


arrow
DISCUSSION
 
Many of the phenotypic traits that are characteristic for SCVs, such as slow growth and decreased uptake of aminoglycosides, are suggestive of a defect in electron transport, which leads to a lowered membrane potential (25), as shown in the menadione-auxotrophic SCVs studied here. Menadione is a precursor to menaquinone, a major electron carrier that contributes to maintenance of the electrochemical gradient (9, 19).

In order to identify the genetic basis of three clinical SCV strains, we sequenced nine genes with putative functions in menadione biosynthesis. In all three strains with the SCV phenotype, we identified mutations in menB, the gene encoding naphthoate synthase, an enzyme belonging to the superfamily of the crotonases (10). The function of this enzyme is to convert the benzenoid compound o-succinylbenzoyl coenzyme A to the naphthanlenoid compound 1,4-dihydroxy-2-naphthoate plus coenzyme A by catalyzing the closure of its naphthoyl ring (20). None of the menB mutations identified in the SCVs (the amino acid deletion and exchange in strain A22616/3, the 44-amino-acid truncation in strain OM299/2, and the missense mutation in strain OM1b) directly affected the putative essential catalytic amino acids serine and glutamate at positions 151 and 153, respectively, of naphthoate synthase. The conserved sequence FXXGGD at positions 71 to 76 and the GGG sequence at positions 122 to 124, which builds the oxyanion pocket of enzymes belonging to the crotonase superfamily, also seem to be unaffected (10, 11). If selection for knockout mutations had been sought, then randomly distributed frameshift mutations would have been the most likely result, similar to the thyA mutations observed in clinical thymidine auxotrophs (5, 7) and the rplF mutations identified in fusidic acid-resistant SCVs (21). While the direct involvement of the putative active site would not be predicted by the mutations, our data show that functional inactivation is possibly due to changes in the three-dimensional structure of the enzyme.

Analysis of the genetic alterations responsible for reversion of the SCV phenotype to normal growth provided convincing and compelling evidence that the Gly223Val mutation identified in menB is the sole cause of the SCV phenotype in strain OM1b. Thus, we analyzed 23 independently selected phenotypic revertants showing normal growth and found that in every case they had acquired a new mutation in menB (Table 2). These new compensatory mutations in menB included direct reversion of the original mutation that restored the wild-type amino acid residue (mutant Val 233 to wild-type Gly233), a new substitution that replaced the mutated residue (mutant Val 233 to new mutant Ala 233), a second-site mutation within menB that presumably resulted in a structure-function compensation in the MenB protein (Lys 259 to mutant Ile 259), and a deletion of the mutated residue and its immediate neighbors (deletion of residues 232, 233, and 234). The focus on the menB gene in all phenotypic revertants to normal growth showed that the mutation Gly233Val identified in menB is the sole cause of the SCV phenotype in OM1b.

In the past decade, many studies have supported the role of S. aureus SCVs in chronic and persistent infections, such as chronic osteomyelitis and persistent skin and soft tissue infections (31). The phenotypic characterization of SCVs has, however, proven to be difficult because of their apparent inherent instability: fast-growing cells are rapidly selected in cultures (4). This does not necessarily mean that mutations in SCVs are genetically more unstable than normal point mutations. The apparent instability of SCVs, i.e., their propensity to generate offspring with normal growth, either could be a consequence of an intrinsically high mutation rate associated with some or all SCVs or could be a consequence of the enormous growth advantage that any phenotypic revertant to normal growth would have among a population of SCVs. Clinically isolated thymidine-auxotrophic S. aureus SCVs have been found to be associated with hypermutability (6). We tested these alternative hypotheses for the three menadione-auxotrophic SCV strains. We performed fluctuation tests to measure the rate of reversion from the SCV phenotype to a normal-growth phenotype per cell per generation of growth. Our data for reversion of the strain OM1b SCV phenotype to a normal-growth phenotype shows that it occurred at a rate of 1.8 x 10–8 per cell per generation (for the other two SCVs tested, the rate was even lower and was <2 x 10–10). This rate of phenotypic reversion is not unusually high and is similar to the rates of mutation to spontaneous resistance to quinolones, fluoroquinolones, rifampin, and mupirocin reported in S. aureus, phenotypes that arise predominantly by point mutation (17, 27); and it is similar to the rate of selection of SCVs within the intracellular milieu (30), perhaps due to mammalian cationic proteins (15). Thus, the problem of a high frequency of reversion to normal growth when one is working with SCVs is, at least for these three isolates, a practical problem associated with the enormous growth-selective advantage that phenotypic revertants enjoy after they have arisen and not because revertants necessarily arise at a high rate. This does not exclude the possibility that for some isolates the SCV phenotype is associated with a mutator phenotype (6, 26), which in such cases could lead to greater genetic and phenotypic instability. However, none of the strains tested here was hypermutable, as evidenced by the fact that all of them had a normal rate of mutation to rifampin resistance of ~10–8.

S. aureus SCVs represent a bacterial subpopulation that is refractory to antibiotic therapy and that is composed of many genetic and phenotypic variants. These variants include hemin, menadione, and thymidine auxotrophs (25) and the recently reported fusidic acid-resistant SCVs (21). Although it has been possible to replicate some SCV phenotypes by constructing gene knockouts (2, 8, 26, 34), identification of the genetic basis for each of the various classes among naturally occurring SCVs is essential to facilitate a proper understanding of their phenotypes. This aim has recently been achieved with regard to thymidine-auxotrophic SCVs (5, 7). In this study, mutations in menB in three clinical menadione-auxotrophic SCV isolates were identified, and the reversion analyses indicated that a menB mutation is the cause of the SCV phenotype in isolate OM1b. This information significantly increases our understanding of the genetics and phenotypes of SCVs and will facilitate further efforts to identify and classify newly isolated SCVs.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants to D.H. from the Swedish Research Council (Vetenskapsrådet) and the European Union (EU 6th Program EAR project LSHM-CT-2005-518152), a Carl Trygger Stiftelse postdoctoral fellowship to D.H., and grants to C.V.E. from the Deutsche Forschungsgemeinschaft (grant EI 247/7-1) and the German Federal Ministry for Education and Science (BMBF) in the context of the Pathogenomic Network Plus (grants PTJ-BIO/0313801B and 01/KI07100).

We sincerely thank Martina Schulte, Anja Hassing, and Angela Eggemann for excellent technical assistance.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Microbiology Program, Department of Cell and Molecular Biology, Box 596, The Biomedical Center, Uppsala University, Uppsala S-75124, Sweden. Phone: 46-18-4714354. Fax: 46-18-530396. E-mail: diarmaid.hughes{at}icm.uu.se Back

{triangledown} Published ahead of print on 8 September 2008. Back

{dagger} These two authors contributed equally to the manuscript. Back


arrow
REFERENCES
 
    1
  1. Balwit, J. M., P. van Langevelde, J. M. Vann, and R. A. Proctor. 1994. Gentamicin-resistant menadione and hemin auxotrophic Staphylococcus aureus persist within cultured endothelial cells. J. Infect. Dis. 170:1033-1037.[Medline]
  2. 2
  3. Bates, D. M., C. von Eiff, P. J. McNamara, G. Peters, M. R. Yeaman, A. S. Bayer, and R. A. Proctor. 2003. Staphylococcus aureus menD and hemB mutants are as infective as the parent strains, but the menadione biosynthetic mutant persists within the kidney. J. Infect. Dis. 187:1654-1661.[CrossRef][Medline]
  4. 3
  5. Baumert, N., C. von Eiff, F. Schaaff, G. Peters, R. A. Proctor, and H. G. Sahl. 2002. Physiology and antibiotic susceptibility of Staphylococcus aureus small colony variants. Microb. Drug Resist. 8:253-260.[CrossRef][Medline]
  6. 4
  7. Becker, D., M. Selbach, C. Rollenhagen, M. Ballmaier, T. F. Meyer, M. Mann, and D. Bumann. 2006. Robust Salmonella metabolism limits possibilities for new antimicrobials. Nature 440:303-307.[CrossRef][Medline]
  8. 5
  9. Besier, S., A. Ludwig, K. Ohlsen, V. Brade, and T. A. Wichelhaus. 2007. Molecular analysis of the thymidine-auxotrophic small colony variant phenotype of Staphylococcus aureus. Int. J. Med. Microbiol. 297:217-225.[CrossRef][Medline]
  10. 6
  11. Besier, S., J. Zander, B. C. Kahl, P. Kraiczy, V. Brade, and T. A. Wichelhaus. 2008. The thymidine-dependent small-colony-variant phenotype is associated with hypermutability and antibiotic resistance in clinical Staphylococcus aureus isolates. Antimicrob. Agents Chemother. 52:2183-2189.[Abstract/Free Full Text]
  12. 7
  13. Chatterjee, I., A. Kriegeskorte, A. Fischer, S. Deiwick, N. Theimann, R. A. Proctor, G. Peters, M. Herrmann, and B. C. Kahl. 2008. In vivo mutations of thymidylate synthase (encoded by thyA) are responsible for thymidine dependency in clinical small-colony variants of Staphylococcus aureus. J. Bacteriol. 190:834-842.[Abstract/Free Full Text]
  14. 8
  15. Clements, M. O., S. P. Watson, R. K. Poole, and S. J. Foster. 1999. CtaA of Staphylococcus aureus is required for starvation survival, recovery, and cytochrome biosynthesis. J. Bacteriol. 181:501-507.[Abstract/Free Full Text]
  16. 9
  17. Gennis, R. B., and V. Stewart. 1996. Respiration, p. 217-261. In F. C. Neidhardt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, vol. 1, 2nd ed. ASM Press, Washington, DC.
  18. 10
  19. Holden, H. M., M. M. Benning, T. Haller, and J. A. Gerlt. 2001. The crotonase superfamily: divergently related enzymes that catalyze different reactions involving acyl coenzyme a thioesters. Acc. Chem. Res. 34:145-157.[CrossRef][Medline]
  20. 11
  21. Johnston, J. M., V. L. Arcus, and E. N. Baker. 2005. Structure of naphthoate synthase (MenB) from Mycobacterium tuberculosis in both native and product-bound forms. Acta Crystallogr. D Biol. Crystallogr. 61:1199-1206.[CrossRef][Medline]
  22. 12
  23. Kipp, F., K. Becker, G. Peters, and C. von Eiff. 2004. Evaluation of different methods to detect methicillin resistance in small-colony variants of Staphylococcus aureus. J. Clin. Microbiol. 42:1277-1279.[Abstract/Free Full Text]
  24. 13
  25. Kohler, C., C. von Eiff, G. Peters, R. A. Proctor, M. Hecker, and S. Engelmann. 2003. Physiological characterization of a heme-deficient mutant of Staphylococcus aureus by a proteomic approach. J. Bacteriol. 185:6928-6937.[Abstract/Free Full Text]
  26. 14
  27. Kolle, W., and H. Hetsch. 1906. Die experimentelle Bakteriologie und die Infektionskrankheiten mit besonderer Berücksichtigung der Immunitätslehre. Ein Lehrbuch für Studierende, Ärzte und Medizinalbeamte. Urban & Schwarzenberg, Berlin, Germany.
  28. 15
  29. Koo, S. P., A. S. Bayer, H. G. Sahl, R. A. Proctor, and M. R. Yeaman. 1996. Staphylocidal action of thrombin-induced platelet microbicidal protein is not solely dependent on transmembrane potential. Infect. Immun. 64:1070-1074.[Abstract]
  30. 16
  31. Luria, S. E., and M. Delbrück. 1943. Mutations of bacteria from virus sensitivity to virus resistance. Genetics 28:491-511.[Free Full Text]
  32. 17
  33. Maple, P. A., J. M. Hamilton-Miller, and W. Brumfitt. 1991. Differing activities of quinolones against ciprofloxacin-susceptible and ciprofloxacin-resistant, methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 35:345-350.[Abstract/Free Full Text]
  34. 18
  35. Massey, R. C., A. Buckling, and S. J. Peacock. 2001. Phenotypic switching of antibiotic resistance circumvents permanent costs in Staphylococcus aureus. Curr. Biol. 11:1810-1814.[CrossRef][Medline]
  36. 19
  37. Meganathan, R. 1996. Biosynthesis of the isoprenoid quinones menaquinone (vitamin K2) and ubiquinone (coenzyme Q), p. 642-656. In F. C. Neidhardt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, vol. 1, 2nd ed. ASM Press, Washington, DC.
  38. 20
  39. Meganathan, R., and R. Bentley. 1979. Menaquinone (vitamin K2) biosynthesis: conversion of o-succinylbenzoic acid to 1,4-dihydroxy-2-naphthoic acid by Mycobacterium phlei enzymes. J. Bacteriol. 140:92-98.[Abstract/Free Full Text]
  40. 21
  41. Norström, T., J. Lannergård, and D. Hughes. 2007. Genetic and phenotypic identification of fusidic acid-resistant mutants with the small-colony-variant phenotype in Staphylococcus aureus. Antimicrob. Agents Chemother. 51:4438-4446.[Abstract/Free Full Text]
  42. 22
  43. Pattee, P. A. 1981. Distribution of Tn551 insertion sites responsible for auxotrophy on the Staphylococcus aureus chromosome. J. Bacteriol. 145:479-488.[Abstract/Free Full Text]
  44. 23
  45. Proctor, R. A., and G. Peters. 1998. Small colony variants in staphylococcal infections: diagnostic and therapeutic implications. Clin. Infect. Dis. 27:419-422.[Medline]
  46. 24
  47. Proctor, R. A., P. van Langevelde, M. Kristjansson, J. N. Maslow, and R. D. Arbeit. 1995. Persistent and relapsing infections associated with small-colony variants of Staphylococcus aureus. Clin. Infect. Dis. 20:95-102.[Medline]
  48. 25
  49. Proctor, R. A., C. von Eiff, B. C. Kahl, K. Becker, P. McNamara, M. Herrmann, and G. Peters. 2006. Small colony variants: a pathogenic form of bacteria that facilitates persistent and recurrent infections. Nat. Rev. Microbiol. 4:295-305.[CrossRef][Medline]
  50. 26
  51. Schaaff, F., G. Bierbaum, N. Baumert, P. Bartmann, and H. G. Sahl. 2003. Mutations are involved in emergence of aminoglycoside-induced small colony variants of Staphylococcus aureus. Int. J. Med. Microbiol. 293:427-435.[CrossRef][Medline]
  52. 27
  53. Schmitz, F. J., A. C. Fluit, D. Hafner, A. Beeck, M. Perdikouli, M. Boos, S. Scheuring, J. Verhoef, K. Kohrer, and C. Von Eiff. 2000. Development of resistance to ciprofloxacin, rifampin, and mupirocin in methicillin-susceptible and -resistant Staphylococcus aureus isolates. Antimicrob. Agents Chemother. 44:3229-3231.[Abstract/Free Full Text]
  54. 28
  55. Seggewiss, J., K. Becker, O. Kotte, M. Eisenacher, M. R. Yazdi, A. Fischer, P. McNamara, N. Al Laham, R. Proctor, G. Peters, M. Heinemann, and C. von Eiff. 2006. Reporter metabolite analysis of transcriptional profiles of a Staphylococcus aureus strain with normal phenotype and its isogenic hemB mutant displaying the small-colony-variant phenotype. J. Bacteriol. 188:7765-7777.[Abstract/Free Full Text]
  56. 29
  57. van de Rijn, I., and R. E. Kessler. 1980. Growth characteristics of group A streptococci in a new chemically defined medium. Infect. Immun. 27:444-448.[Abstract/Free Full Text]
  58. 30
  59. Vesga, O., M. C. Groeschel, M. F. Otten, D. W. Brar, J. M. Vann, and R. A. Proctor. 1996. Staphylococcus aureus small colony variants are induced by the endothelial cell intracellular milieu. J. Infect. Dis. 173:739-742.[Medline]
  60. 31
  61. von Eiff, C. 2008. Staphylococcus aureus small colony variants: a challenge to microbiologists and clinicians. Int. J. Antimicrob. Agents 31:507-510.[CrossRef][Medline]
  62. 32
  63. von Eiff, C., K. Becker, D. Metze, G. Lubritz, J. Hockmann, T. Schwarz, and G. Peters. 2001. Intracellular persistence of Staphylococcus aureus small-colony variants within keratinocytes: a cause for antibiotic treatment failure in a patient with Darier's disease. Clin. Infect. Dis. 32:1643-1647.[CrossRef][Medline]
  64. 33
  65. von Eiff, C., D. Bettin, R. A. Proctor, B. Rolauffs, N. Lindner, W. Winkelmann, and G. Peters. 1997. Recovery of small colony variants of Staphylococcus aureus following gentamicin bead placement for osteomyelitis. Clin. Infect. Dis. 25:1250-1251.[Medline]
  66. 34
  67. von Eiff, C., C. Heilmann, R. A. Proctor, C. Woltz, G. Peters, and F. Gotz. 1997. A site-directed Staphylococcus aureus hemB mutant is a small-colony variant which persists intracellularly. J. Bacteriol. 179:4706-4712.[Abstract/Free Full Text]
  68. 35
  69. von Eiff, C., P. McNamara, K. Becker, D. Bates, X. H. Lei, M. Ziman, B. R. Bochner, G. Peters, and R. A. Proctor. 2006. Phenotype microarray profiling of Staphylococcus aureus menD and hemB mutants with the small-colony-variant phenotype. J. Bacteriol. 188:687-693.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, November 2008, p. 4017-4022, Vol. 52, No. 11
0066-4804/08/$08.00+0     doi:10.1128/AAC.00668-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lannergård, J.
Right arrow Articles by Hughes, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lannergård, J.
Right arrow Articles by Hughes, D.