Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tamang, M. D. Articles by Kim, J. Search for Related Content PubMed PubMed Citation Articles by Tamang, M. D. Articles by Kim, J.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, November 2008, p. 4159-4162, Vol. 52, No. 11
0066-4804/08/$08.00+0     doi:10.1128/AAC.01633-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Plasmid-Mediated Quinolone Resistance Determinants qnrA, qnrB, and qnrS among Clinical Isolates of Enterobacteriaceae in a Korean Hospital

Migma Dorji Tamang, Sung Yong Seol, Jae-Young Oh, Hee Young Kang, Je Chul Lee, Yoo Chul Lee, Dong Taek Cho, and Jungmin Kim^*

Department of Microbiology, Kyungpook National University School of Medicine, 101 Dongin-dong-2 ga, Jung-gu, Daegu 700-422, Republic of Korea

Received 19 December 2007/ Returned for modification 9 March 2008/ Accepted 13 August 2008

Top ABSTRACT TEXT REFERENCES

 
Screening of 368 consecutive nonreplicate clinical isolates of Enterobacteriaceae resistant to nalidixic acid and at least one extended-spectrum β-lactam revealed the presence of qnrA, qnrB, and qnrS determinants, and identified novel qnrB variants, in Citrobacter freundii isolates. This study also revealed, for the first time, the linkage of qnrB, armA, and extended-spectrum and/or AmpC-type β-lactamase genes on large conjugative plasmids.

Top ABSTRACT TEXT REFERENCES

 
Since the first plasmid-mediated quinolone resistance (PMQR) was reported in 1998 for a Klebsiella pneumoniae isolate from the United States (10), three PMQR mechanisms have been discovered. The first PMQR mechanism involves qnr genes that have been reported worldwide in various enterobacterial species (2, 4, 5, 7, 9, 10, 13, 18, 23, 24). The second consists of the AAC(6')-Ib-cr gene, which encodes a new variant of the common aminoglycoside acetyltransferase that is capable of acetylating the piperazinyl substituent of some fluoroquinolones (20) and thereby reducing their activities. A novel plasmid-mediated fluoroquinolone efflux pump protein, QepA, has recently been reported simultaneously from Japan (26) and Europe (16) as the third PMQR mechanism. A strong association of quinolone resistance with the production of extended-spectrum β-lactamases (ESBLs) or plasmid-mediated AmpC β-lactamases (pACBLs) has been observed (7, 9, 13, 18, 24). The association between qnrA and ESBL determinants for SHV-5 (12, 24), SHV-7 (24), CTX-M-9 (23), CTX-M-14 (2), CTX-M-15 (7), and VEB-1 (17) or pACBL determinants for DHA-1 (13, 24) and FOX-5 (10) has been reported repeatedly. Similarly, qnrB has been reported to be located on plasmids carrying bla genes for CTX-M-15, SHV-12 (7), or SHV-30 (4) ESBLs. In Korea, recent studies have shown a strong association between qnrB4 and bla_DHA-1 in members of the Enterobacteriaceae (14, 15).

In this study, the prevalences of the three major families of qnr determinants, and the association of qnr genes with ESBL, pACBL, and/or plasmid-mediated 16S rRNA methylase genes, among 368 nonduplicate clinical isolates of Enterobacteriaceae resistant to nalidixic acid and at least one of the extended-spectrum β-lactams (cefoxitin, cefotaxime, cefepime, aztreonam, or ceftazidime), consecutively collected during 2004 to 2006 at Kyungpook National University Hospital in the Republic of Korea, were investigated.

The qnrA, qnrB, and qnrS genes were detected by multiplex PCR as described previously (19). A total of 141 (38.3%) isolates were qnr positive. Each of the three qnr families was detected, but none of the isolates harbored two or more types of qnr genes simultaneously. The qnrA, qnrB, and qnrS genes were detected in 4 (1.0%), 135 (36.7%), and 2 (0.5%) of the total isolates, respectively. The qnrB determinants were most commonly detected in Citrobacter freundii isolates (67.9%), followed by K. pneumoniae (62.5%), Enterobacter cloacae (15.8%), and Escherichia coli (9.4%) isolates. While qnrA was detected only in E. cloacae isolates, qnrS was detected in one K. pneumoniae and one E. coli isolate (Table 1). The high prevalence of qnrB in this study is in good agreement with the findings of previous studies conducted in Korea (14) and Taiwan (25).

View this table: [in this window] [in a new window]

TABLE 1. Distribution of bla ESBL and/or pACBL and armA genes among clinical isolates of Enterobacteriaceae according to qnr determinantsa

All qnrA and qnrS amplicons were confirmed by sequencing. The sequences of the four qnrA amplicons were identical to that of qnrA1 from K. pneumoniae plasmid pMG252 (10), and those of the two qnrS amplicons were identical to that of qnrS1 from Shigella flexneri 2b plasmid pAH0376 from Japan (5). A restriction fragment length polymorphism (RFLP) protocol was developed in conjunction with the multiplex PCR, as outlined in Fig. 1, to differentiate between qnrB variants. RFLP analysis of the PCR products obtained from 135 qnrB-positive isolates revealed several variants, including 15 (4%) qnrB1, 1 (0.2%) qnrB2, 113 (30.7%) qnrB4, and 2 (0.5%) qnrB6 amplicons, and four original RFLP profiles that did not match with variants detectable by this typing protocol. Sequencing of the qnrB2 and qnrB6 amplicons and of representatives of the qnrB1 (n = 5) and qnrB4 (n = 10) amplicons confirmed their identities. In order to determine the sequences of the qnrB genes yielding unique RFLP profiles, primers QnrB-1-10-F (ATGACGCCATTACTGTATAAAAAA) and QnrB-1-10-R (CTAGCCAATAATCGCGATGCCA) were used to obtain a 681-bp PCR product. In addition to direct sequencing of amplicons obtained with the original genomic DNA, the corresponding amplicons were cloned into a pGEM-T vector (Promega, Madison, WI) and sequenced, and their sequences were confirmed and compared with known sequences by using the BLAST programs at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST). Three novel qnrB variants, which exhibited 97 to 98% nucleotide sequence identity and >98% amino acid identity with each other, were identified among the C. freundii strains (Fig. 2). As proposed in the recently published Commentary on Qnr numbering by Jacoby et al. (6), they are designated qnrB13, qnrB14, and qnrB15, respectively, and each of them codes for a 214-amino-acid protein. qnrB13 exhibits the highest degrees of nucleotide (98.9%) and amino acid (99.5%) sequence identity to qnrB2 (GenBank accession no. DQ351242), whereas qnrB14 and qnrB15 exhibit the highest degrees of nucleotide (97.7%) and amino acid (99.1%) sequence identity to qnrB9 (GenBank accession no. EF526508).

View larger version (9K): [in this window] [in a new window]

FIG. 1. Diagram showing the qnrB subtyping approach by RFLP of the 469-bp qnrB PCR product using restriction enzymes MvaI (Fermentas Inc., Hanover, MD), BglII (New England Biolabs, Beverly, MA), HindIII (Roche Diagnostics GmbH, Mannheim, Germany), and FokI (New England Biolabs, Beverly, MA).

View larger version (29K): [in this window] [in a new window]

FIG. 2. CLUSTAL W alignment of deduced amino acid sequences of the novel qnrB variants described in this study: QnrB13 (GenBank accession no. ABX72042), QnrB14 (ABX72044), and QnrB15 (ABX72227). Asterisks represent amino acid residues identical to those in the QnrB13 sequence.

A multiplex PCR to identify bla_SHV, bla_CTX-M-1-like, and bla_CTX-M-9-like genes and simplex PCRs to identify the bla_DHA-1 gene and 16S rRNA methylase genes (rmtA, rmtB, and armA) were carried out with clinical isolates and their transconjugants as described previously (3, 8, 27). The distribution of these other resistance determinants among the qnr-positive clinical isolates of Enterobacteriaceae is shown in Table 1. Of the 141 qnr-positive isolates, ESBL and/or pACBL genes were detected in 122 (86.5%). However, no ESBL and/or pACBL gene was detected among the 19 C. freundii isolates carrying qnrB variants. Upon further investigation, it was found that three of these isolates produced a β-lactamase with a pI of 5.4, consistent with bla_TEM-1, a finding that was also corroborated by nucleotide sequencing of their PCR products (data not shown). The armA gene was detected in 100 (70.9%) qnr-positive clinical isolates (Table 1), all of which were resistant to amikacin. The other 16S rRNA methylase genes (rmtA, rmtB, and rmtC) investigated were never found. Overall, 96 isolates of Enterobacteriaceae simultaneously carried qnrB4, bla_DHA-1, armA, and bla_SHV-12 with or without other ESBL genes.

By conjugation using the liquid mating method (22) at 37°C, qnr determinants carried by qnr-positive clinical isolates were transferred to E. coli J53 Azi^r or E. coli RG488 Rif^r recipients. Transconjugants were selected on Mueller-Hinton agar (Difco) plates supplemented with ampicillin (32 µg/ml) and sodium azide (200 µg/ml) or rifampin (50 µg/ml). Conjugal transfer for ampicillin resistance was successful for 70 donor isolates. However, only 32% (43 qnrB4, 2 qnrB6, and 1 qnrS isolate) of the total donor isolates transferred qnr determinants. The apparent lack of transfer of qnr determinants for the remaining 68% of the isolates could be due to their presence on nonconjugative plasmids. Alternatively, it could be due to their chromosomal location, as a result of integration of the qnr-carrying plasmid back into the chromosome. Further study should be done to prove this hypothesis. MICs were determined by the agar dilution method (11). The MICs of nalidixic acid and ciprofloxacin for the qnr-positive transconjugants were as much as severalfold higher than those for the recipients (Table 2). The transconjugants carrying qnrB6 and qnrS1 exhibited the highest increases in MICs. Overall, 35 transconjugants simultaneously carried qnrB4, bla_DHA-1, bla_SHV-12, and armA with or without other ESBL genes (Table 2). PCR-based inc replicon typing, performed for the 46 qnr-positive transconjugants using boiled DNA templates, as described previously (1), identified FIIAs, FIA, and L/M plasmids in 32, 3, and 1 transconjugant, respectively, all of which were qnrB4 positive, except for 2 that were positive for qnrB6 and qnrS1, respectively (Table 2).

View this table: [in this window] [in a new window]

TABLE 2. MICs of quinolones and distribution of ESBL and/or pACBL and armA genes among the transconjugantsa

Isolation of plasmid DNA from nine randomly selected transconjugants positive for qnrB4 (of which six also carried the bla_DHA-1, bla_SHV-12, and armA genes, and three carried different combinations of two of these genes) by the alkaline lysis method (21) revealed a large plasmid of approximately 180 kb. Southern hybridization using probes specific for the qnrB4, bla_DHA-1, bla_SHV-12, and armA genes revealed that all determinants were apparently carried on the same plasmid (Fig. 3). The plasmids derived from the transconjugants were similar in size, belonged to the FIIAs inc type, and carried the qnrB4, bla_DHA-1, bla_SHV-12, and armA genes. Furthermore, Southern hybridization of the plasmid DNAs isolated from the two transconjugants positive for qnrB6, bla_DHA-1, and armA determinants revealed that the determinants were apparently carried on the same large plasmid (data not shown). However, another, relatively smaller, nonconjugative plasmid was also hybridized with a probe specific for qnrB6 in addition to the large conjugative plasmid, indicating the presence of qnrB6 on two plasmids of different sizes in the same clinical strain but not in the corresponding transconjugants (data not shown). Thus, the spread of multidrug-resistant Enterobacteriaceae simultaneously carrying the qnrB, bla_DHA-1, bla_SHV-12, and armA genes was due mainly to dissemination of a large inc FIIAs conjugative plasmid. Although the spread of multidrug-resistant E. coli and K. pneumoniae isolates that produce both ESBLs and 16S rRNA methylases has been reported (27), and several reports have also demonstrated the association between qnr determinants and the ESBL and/or pACBL genes (7, 9, 13, 18, 24), the association between qnr determinants, ESBL and/or pACBL genes, and 16S rRNA methylase genes on the same conjugative plasmid had never been reported before.

View larger version (76K): [in this window] [in a new window]

FIG. 3. (A) Plasmid DNAs extracted from transconjugants. (B through E) Southern hybridization with the qnrB4 (B), blaDHA-1 (C), blaSHV-12 (D), or armA (E) probe. Lanes: A, pKT50654; B, pKT50774 (lacking blaSHV-12); C, pKT51151; D, pKT51196 (lacking armA); E, pKT51198; F, pKT51208; G, pKT51295; H, pKT51321 (lacking blaDHA-1); I, pKT51352; M, BAC-Tracker supercoiled marker.

In conclusion, this is the first report of the simultaneous association of qnrB, armA, and ESBL and/or AmpC β-lactamase genes on large conjugative plasmids found in clinical isolates, which consequently were resistant to almost all clinically important antimicrobial agents.

Nucleotide sequence accession numbers. The nucleotide sequences of the novel qnrB variants in C. freundii strains 05K657, 05K1560, 06K619, and 06K1424, determined in this study, have been submitted to GenBank and have been assigned accession no. EU273755, EU273756, EU273757, and EU302865, respectively.

 
This work was supported by a grant from the Korean Health 21 R&D project, Ministry of Health and Welfare, Republic of Korea (03-PJ1-PG1-CH03-0002), and in part by the Brain Korea 21 Project (2007).

 
* Corresponding author. Mailing address: Department of Microbiology, Kyungpook National University School of Medicine, 101 Dongin-dong-2 ga, Jung-gu, Daegu 700-422, Republic of Korea. Phone: 82-53-420-4845. Fax: 82-53427-5664. E-mail: minkim{at}knu.ac.kr

Published ahead of print on 25 August 2008.

Top ABSTRACT TEXT REFERENCES

 

1
1. Carattoli, A., A. Bertini, L. Villa, V. Falbo, K. L. Hopkins, and E. J. Threlfall. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63:219-228.[CrossRef][Medline]
2
2. Cheung, T. K., Y. W. Chu, M. Y. Chu, C. H. Ma, R. W. Yung, and K. M. Kam. 2005. Plasmid-mediated resistance to ciprofloxacin and cefotaxime in clinical isolates of Salmonella enterica serotype Enteritidis in Hong Kong. J. Antimicrob. Chemother. 56:586-589.[Abstract/Free Full Text]
3
3. Chia, J. H., C. Chu, L. H. Su, C. H. Chiu, A. J. Kuo, C. F. Sun, and T. L. Wu. 2005. Development of a multiplex PCR and SHV melting-curve mutation detection system for detection of some SHV and CTX-M beta-lactamases of Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae in Taiwan. J. Clin. Microbiol. 43:4486-4491.[Abstract/Free Full Text]
4
4. Gay, K., A. Robicsek, J. Strahilevitz, C. H. Park, G. Jacoby, T. J. Barrett, F. Medalla, T. M. Chiller, and D. C. Hooper. 2006. Plasmid-mediated quinolone resistance in non-Typhi serotypes of Salmonella enterica. Clin. Infect. Dis. 43:297-304.[CrossRef][Medline]
5
5. Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K. Sakae. 2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:801-803.[Abstract/Free Full Text]
6
6. Jacoby, G., V. Cattoir, D. Hooper, L. Martínez-Martínez, P. Nordmann, A. Pascual, L. Poirel, and M. Wang. 2008. qnr gene nomenclature. Antimicrob. Agents Chemother. 52:2297-2299.[Free Full Text]
7
7. Jacoby, G. A., K. E. Walsh, D. M. Mills, V. J. Walker, H. Oh, A. Robicsek, and D. C. Hooper. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178-1182.[Abstract/Free Full Text]
8
8. Kim, J., and Y. M. Lim. 2005. Prevalence of derepressed AmpC mutants and extended-spectrum β-lactamase producers among clinical isolates of Citrobacter freundii, Enterobacter spp., and Serratia marcescens in Korea: dissemination of CTX-M-3, TEM-52, and SHV-12. J. Clin. Microbiol. 43:2452-2455.[Abstract/Free Full Text]
9
9. Li, X. Z. 2005. Quinolone resistance in bacteria: emphasis on plasmid-mediated mechanisms. Int. J. Antimicrob. Agents 25:453-463.[CrossRef][Medline]
10
10. Martínez-Martínez, L., A. Pascual, and G. A. Jacoby. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797-799.[CrossRef][Medline]
11
11. National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 6th ed. Approved standard M7-A6. National Committee for Clinical Laboratory Standards, Wayne, PA.
12
12. Nazic, H., L. Poirel, and P. Nordmann. 2005. Further identification of plasmid-mediated quinolone resistance determinant in Enterobacteriaceae in Turkey. Antimicrob. Agents Chemother. 49:2146-2147.[Free Full Text]
13
13. Nordmann, P., and L. Poirel. 2005. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 56:463-469.[Abstract/Free Full Text]
14
14. Pai, H., M. R. Seo, and T. Y. Choi. 2007. Association of QnrB determinants and production of extended-spectrum β-lactamase or plasmid-mediated AmpC β-lactamase in clinical isolates of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 51:366-368.[Abstract/Free Full Text]
15
15. Park, Y. J., J. K. Yu, S. Lee, E. J. Oh, and G. J. Woo. 2007. Prevalence and diversity of qnr alleles in AmpC-producing Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii, and Serratia marcescens: a multicentre study from Korea. J. Antimicrob. Chemother. 60:868-871.[Abstract/Free Full Text]
16
16. Périchon, B., P. Courvalin, and M. Galimand. 2007. Transferable resistance to aminoglycosides by methylation of G1405 in 16S rRNA and to hydrophilic fluoroquinolones by QepA-mediated efflux in Escherichia coli. Antimicrob. Agents Chemother. 51:2464-2469.[Abstract/Free Full Text]
17
17. Poirel, L., M. Van De Loo, H. Mammeri, and P. Nordmann. 2005. Association of plasmid-mediated quinolone resistance with extended-spectrum β-lactamase VEB-1. Antimicrob. Agents Chemother. 49:3091-3094.[Abstract/Free Full Text]
18
18. Robicsek, A., G. A. Jacoby, and D. C. Hooper. 2006. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect. Dis. 6:629-640.[CrossRef][Medline]
19
19. Robicsek, A., J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 50:2872-2874.[Abstract/Free Full Text]
20
20. Robicsek, A., J. Strahilevitz, G. A. Jacoby, M. Macielag, D. Abbanat, C. H. Park, K. Bush, and D. C. Hooper. 2006. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 12:83-88.[CrossRef][Medline]
21
21. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed., p. 1.32. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
22
22. Tamang, M. D., J. Y. Oh, S. Y. Seol, H. Y. Kang, J. C. Lee, Y. C. Lee, D. T. Cho, and J. Kim. 2007. Emergence of multidrug-resistant Salmonella enterica serovar Typhi associated with a class 1 integron carrying the dfrA7 gene cassette in Nepal. Int. J. Antimicrob. Agents 30:330-335.[CrossRef][Medline]
23
23. Wang, M., D. F. Sahm, J. A. Jacoby, and D. C. Hooper. 2004. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob. Agents Chemother. 48:1295-1299.[Abstract/Free Full Text]
24
24. Wang, M., J. H. Tran, G. A. Jacoby, Y. Zhang, F. Wang, and D. C. Hooper. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47:2242-2248.[Abstract/Free Full Text]
25
25. Wu, J. J., W. C. Ko, S. H. Tsai, and J. J. Yan. 2007. Prevalence of plasmid mediated quinolone resistance determinants qnrA, qnrB, and qnrS among clinical isolates of Enterobacter cloacae in a Taiwanese hospital. Antimicrob. Agents Chemother. 51:1223-1227.[Abstract/Free Full Text]
26
26. Yamane, K., J. I. Wachino, S. Suzuki, K. Kimura, N. Shibata, H. Kato, K. Shibayama, T. Konda, and Y. Arakawa. 2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother. 51:3354-3360.[Abstract/Free Full Text]
27
27. Yan, J. J., J. J. Wu, W. C. Ko, S. H. Tsai, C. L. Chuang, H. M. Wu, Y. J. Lu, and J. D. Li. 2004. Plasmid-mediated 16S rRNA methylases conferring high-level aminoglycoside resistance in Escherichia coli and Klebsiella pneumoniae isolates from two Taiwanese hospitals. J. Antimicrob. Chemother. 54:1007-1012.[Abstract/Free Full Text]

---

Antimicrobial Agents and Chemotherapy, November 2008, p. 4159-4162, Vol. 52, No. 11
0066-4804/08/$08.00+0     doi:10.1128/AAC.01633-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Carattoli, A. (2009). Resistance Plasmid Families in Enterobacteriaceae. Antimicrob. Agents Chemother. 53: 2227-2238 [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tamang, M. D. Articles by Kim, J. Search for Related Content PubMed PubMed Citation Articles by Tamang, M. D. Articles by Kim, J.