AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AAC.00961-07v1
52/2/393    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gozdek, A.
Right arrow Articles by Boguszewska-Chachulska, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gozdek, A.
Right arrow Articles by Boguszewska-Chachulska, A. M.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, February 2008, p. 393-401, Vol. 52, No. 2
0066-4804/08/$08.00+0     doi:10.1128/AAC.00961-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

NS3 Peptide, a Novel Potent Hepatitis C Virus NS3 Helicase Inhibitor: Its Mechanism of Action and Antiviral Activity in the Replicon System{triangledown}

Agnieszka Gozdek,1 Igor Zhukov,1,2 Agnieszka Polkowska,1 Jaroslaw Poznanski,1 Anna Stankiewicz-Drogon,1 Jerzy M. Pawlowicz,1 Wlodzimierz Zagórski-Ostoja,1 Peter Borowski,3 and Anna M. Boguszewska-Chachulska1*

Institute of Biochemistry and Biophysics PAS, Warsaw, Poland,1 National Institute of Chemistry, SI-1001, Lubljana, Slovenia,2 Institute of Environmental Protection, John Paul II Catholic University of Lublin, Lublin, Poland3

Received 25 July 2007/ Returned for modification 17 September 2007/ Accepted 12 November 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hepatitis C virus (HCV) chronic infections represent one of the major and still unresolved health problems because of low efficiency and high cost of current therapy. Therefore, our studies centered on a viral protein, the NS3 helicase, whose activity is indispensable for replication of the viral RNA, and on its peptide inhibitor that corresponds to a highly conserved arginine-rich sequence of domain 2 of the helicase. The NS3 peptide (p14) was expressed in bacteria. Its 50% inhibitory activity in a fluorometric helicase assay corresponded to 725 nM, while the ATPase activity of NS3 was not affected. Nuclear magnetic resonance (NMR) studies of peptide-protein interactions using the relaxation filtering technique revealed that p14 binds directly to the full-length helicase and its separately expressed domain 1 but not to domain 2. Changes in the NMR chemical shift of backbone amide nuclei (1H and 15N) of domain 1 or p14, measured during complex formation, were used to identify the principal amino acids of both domain 1 and the peptide engaged in their interaction. In the proposed interplay model, p14 contacts the clefts between domains 1 and 2, as well as between domains 1 and 3, preventing substrate binding. This interaction is strongly supported by cross-linking experiments, as well as by kinetic studies performed using a fluorometric assay. The antiviral activity of p14 was tested in a subgenomic HCV replicon assay that showed that the peptide at micromolar concentrations can reduce HCV RNA replication.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hepatitis C virus (HCV) is a positive-strand RNA virus of the Flaviviridae family (11). HCV infection, affecting 3% of the world population, leads to chronic hepatitis in up to 85% of the cases, in 10 to 20% of the cases it develops into cirrhosis that requires constant treatment and provokes permanent infirmity, while 1 to 5% of chronically infected patients are diagnosed with hepatocellular carcinoma (9). No efficient treatment exists; even the new dual therapy with pegylated interferon alpha 2a or 2b and ribavirin is effective only in up to 60% of the cases, depending on the genotype of the virus and the duration of the treatment (21). To date, no vaccine against HCV has been developed in spite of numerous attempts and advanced trials, principally because of the high variability of the RNA genome and association of HCV particles with host lipoproteins and immunoglobulins (1, 15). Thus, nonstructural proteins involved in viral replication are being examined as targets of antiviral therapy. One of them is NS3 (serine protease/RNA helicase), whose helicase activity is indispensable for replication of the viral RNA (25). The helicase part of NS3 folds into three domains of comparable size (domains 1, 2, and 3) that form a triangular molecule. Five structures of the NS3 helicase have been resolved by X-ray crystallography. The latest resolved structure shows two helicases bound to a single DNA molecule and reveals an apparent interface between two protein molecules (33). The existence of oligomeric structures of the NS3 helicase is supported by cross-linking experiments in solution (27). A recently reported biochemical model suggests that the monomeric NS3 helicase is functional but that multiple NS3 helicase molecules are required for optimal processivity (13, 28, 44, 45).

The main difference between all NS3 helicase structures available concerns the position of domain 2 in relation to domains 1 and 3. Domain 2 is connected to domains 1 and 3 via flexible linkers, which allow it to freely rotate relative to domains 1 and 3. In some structures, domain 2 is rotated away from domain 1 in an "open" conformation, while in other structures domain 2 is closer to domain 1 in a "closed" conformation.

All helicases crystallized to date contain domains that resemble domains 1 and 2, but none of them resembles domain 3 (16, 24). Several experiments, e.g., the deletion of 97 amino acids from C terminus of NS3 (22) or studies on the mutation of the tryptophan residue in position 501 of NS3 (W501) (29, 42), revealed that domain 3 is indispensable for nucleic acid (NA) binding and unwinding. The NA is bound in a negatively charged pocket between domains 1, 2, and 3. This site is not conserved in cellular enzymes and therefore might represent a promising target for the engineering of specific helicase inhibitors that are nontoxic for cell proteins.

Peptide inhibitors are quite attractive candidates for antiviral agents. It is relatively easy to design a peptide that fits a studied protein, regardless of the size and chemical properties of the target site. Moreover, in many cases it has been found that isolated peptides, whose sequences correspond to a fragment of a protein, have a strong tendency to adopt the same conformation as they have in the protein (14). Selected inhibitors may lead to the development of efficient peptidomimetics to inhibit virus attachment, entry, or replication. Examples of peptide-derived inhibitors, for which the inhibitory activity was confirmed, include an interface peptide acting as a dimerization inhibitor of the human immunodeficiency virus type 1 (HIV-1) protease (17) and enfuvirtide - HIV-1 entry inhibitor, a peptide derived from the viral envelope protein gp41 (43). As a result of the growing knowledge concerning the structure and functions of HCV proteins and the availability of the HCV replicon system (2, 32), a subset of antiviral agents comprising direct peptide-derived inhibitors of HCV enzymes such as protease and polymerase has been developed in recent years. The most advanced peptidomimetic inhibitors are directed against the HCV NS3/4A serine protease, e.g., BILN-2061, VX-950, and SCH503034 (26, 29, 34, 46).

A set of peptides whose sequences correspond to the arginine-rich motif VI of domain 2 of the HCV helicase (genotype 1b) have undergone detailed studies by P. Borowski et al. (6, 7). The first experiments performed with a radioactive helicase assay revealed the inhibitory activity of these peptides (of various lengths and composition) and pointed at a peptide composed of 14 amino acids (p14, RRGRTGRGRRGIYR) as the best helicase inhibitor (P. Borowski, Polish patent application PL378824).

Here we present further studies using an overexpressed peptide and the fluorometric helicase activity assay that confirm the potent inhibitory activity of p14. The mechanism of action of the peptide was studied by using various biophysical methods. We demonstrate that p14 can inhibit replication of subgenomic HCV replicons in the Huh-7 cell culture system.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Peptide cloning, expression, and purification. High-pressure liquid chromatography (HPLC)-purified oligonucleotides carrying the p14 peptide sequence (in boldface) with HindIII (in boldface italics) and BamHI (in italics) cohesive ends added at the 5' or 3' ends were purchased from Sigma (sense, 5'-AGCTTTGGATGCGCCGTGGCCGCACCGGTCGTGGTCGCCGTGGCATTTATCTGAG-3'; antisense, 3'-AACCTACGCGGCACCGGCGTGGCCAGCACCAGCGGCACCGTAAATAGCGACTCCTAG-5'). An additional methionine codon (ATG) was added downstream of the 5' HindIII restriction site to create a cyanogen bromide (CNBr) digestion site. The insert obtained by annealing both oligonucleotides was cloned into the Hind III/BamHI sites of the pMM1436 plasmid, a derivative of pAED4 (5), fused to the sequence of a hydrophobic leader peptide (tryptophan operon with the internal deletion {Delta}trpLE1413 [36]), targeting the construct to inclusion bodies. The ligation product was introduced into the Escherichia coli DH5{alpha} strain by electroporation and selected on the basis of restriction digestion of isolated plasmids. The proper sequence of the construct was confirmed by sequencing. Protein overexpression was carried out in the E. coli HMS174(DE3) strain in LB medium supplemented with ampicillin (100 µg/ml). An overnight culture diluted 100-fold was induced with 0.4 mM IPTG (isopropyl-β-D-thiogalactopyranoside) at an optical density at 600 nm of 0.8 and harvested after 3 h. The bacteria were lysed by sonication in 50 mM Tris-HCl (pH 8.8), 15% glycerol, 100 mM MgCl2, 10 mM MnC12, and 10 µg of DNase I/ml and then centrifuged. The pellet was resuspended in 50 mM Tris-HCl (pH 8.8), 1% Nonidet P-40 (NP-40), 1% deoxycholic acid, 1 mM EDTA, and 200 mM NaC1 and then sonicated and centrifuged. The pellet was dissolved in 6 M guanidine hydrochloride and 50 mM Tris-HCl (pH 8.8), sonicated, and diluted 10-fold with water. The precipitate was centrifuged, suspended in 70% formic acid, and incubated with CNBr for 2.5 h. The mixture was diluted 10-fold with water and freeze-dried. The peptide was extracted from the lyophilysate with water and purified on a semipreparative C18 column (ZORBAX) in a 0 to 90% water-acetonitrile gradient in the presence of 0.1% trifluoroacetic acid. The concentration of the peptide was determined at 280 nm using the molar extinction coefficient of 1,420 M–1 cm1. The extinction coefficient was calculated on the basis of the protein composition by using the ProtParam program from the Expasy website (http://us.expasy.org). Extracts and eluates were analyzed by 17% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by Coomassie blue staining.

Expression and purification of recombinant proteins. The expression and purification of the full-length HCV helicase and its domain 2 were performed as previously described (4). Domain 1 of the HCV helicase was cloned into the bifunctional YpET-30a vector, a recombinant of pET-30a (Clontech) and pFL38, kindly provided by M. Zagulski (Institute of Biochemistry and Biophysics [IBB]), by using homologous recombination in the Saccharomyces cerevisiae BY strain. This method relies on plasmid gap-repair by PCR-generated cassettes (50). Oligonucleotide primers were obtained from the Laboratory of DNA Sequencing and Oligonucleotide Synthesis, IBB. The HCV-1 cDNA template (accession no. AAA45676) (23) was used to PCR amplify domain 1 with a sense primer (GTTTAACTTTAAGAAGGAGATATACATATGGTGGACTTTAT CCCTGTGGAG) and an antisense primer (CGGATCTCAGTGGTGGTGGTGGTGGTGAGGGGTGGCGGTGGCGAGC) that covered the His6 tag coding sequence from the vector (nucleotides corresponding to the sequence of domain 1 are indicated in boldface). Total DNA was isolated from yeast; recombinant plasmids were identified by PCR and amplified in E. coli DH5{alpha}. The correct sequence of the construct was confirmed by restriction digestion and sequencing. Protein overexpression was carried out in the E. coli BL21(DE3)/LysE strain in LB medium supplemented with kanamycin (50 µg/ml). Cells were grown at 37°C until the cultures reached an optical density at 600 nm of ~1.0; they were induced with 1 mM IPTG and harvested after 4 h at 37°C. The recombinant protein was purified according to the protocol established for proteins purified from insect cell cultures (4). The concentration of the HCV helicase domain 1 was determined at 280 nm using the molar extinction coefficient of 7,680 M–1 cm–1, which was calculated on the basis of protein composition by the ProtParam program. Extracts and eluates were analyzed by 15% SDS-PAGE, and proteins were visualized by Coomassie blue staining.

Peptide CD analysis. Far UV-circular dichroism (CD) spectra were measured in a cell with a 10-mm path length at 200 to 270 nm with an AVIV 202 spectropolarimeter. The sample of 10 µM peptide was prepared in 50 mM sodium phosphate buffer (pH 7.6) and 0.3 M NaCl. The experimental parameters were as follows: temperature, 25°C; bandwidth, 1 nm; wavelength step, 1 nm; and averaging time, 3 s.

Helicase assay. The fluorometric assay was performed as described by Boguszewska-Chachulska et al. (3), with some modifications. Helicase assays (in 60 µl) were performed in 30 mM Tris-HCl (pH 7.5), 6 mM MnCl2, 0.075% Triton X-100, and 0.05% sodium azide, with 10 nM double-stranded DNA (dsDNA) substrate, 1.5 mM ATP, and 125 nM capture strand. The enzyme (10 nM) was preincubated with the peptide without ATP for 15 min at the room temperature. The unwinding reaction was started by the addition of ATP and was carried out at 37°C for 60 min in a Synergy HTi fluorescence reader (Biotek).

ATPase assay. The ATPase assay was performed as described previously (3, 4). The peptide was tested up to a concentration of 100 µM. The reactions were carried out in 25 µl of reaction buffer with 100 nM helicase for 60 min at 30°C.

Cross-linking protocol. Cross-linking reactions were carried out in 15 µl in a solution composed of 50 mM HEPES (pH 8.0), 150 mM NaCl, and 6 mM freshly prepared sulfo-EGS (Pierce). The protein concentrations were 20 and 80 µM for the NS3 helicase and the peptide, respectively. Some samples were supplemented with 1 mM ATP and 6 mM Mn2+ or with dsDNA with a 5' five-base single-stranded DNA and a 3' five-base single-stranded DNA tail. The DNA concentration varied between 0.2 and 2.6 µM, depending on the sample. After 30 min of incubation at room temperature, the reactions were quenched by addition of 7 µl of 3x gel loading buffer (0.2 M Tris-HCl [pH 6.8], 8% SDS, 2.88 M β-mercaptoethanol, 40% glycerol, 0.4% xylene cyanol, and 0.4% bromophenol blue), the samples were boiled for 3 min, and then separated by 15% SDS-PAGE. Proteins were visualized by Coomassie blue staining, whereas DNA was visualized by UV light at 254 nm in the gel placed on a silica gel chromatography plate (Merck Art. 5735).

NMR studies. Nuclear magnetic resonance (NMR) experiments were performed on Varian Unity + 500, Varian Inova 400, Varian Inova 750, and Bruker AvanceII 750 NMR spectrometers. The NMR spectrometers were equipped at least in three channels, a gradient unit in the z direction, and an inverse 1H/13C/15N probehead. The cryo probehead was used to record the NMR spectra on a Bruker AvanceII NMR spectrometer. The temperature was stabilized at 277 K in all measurements unless otherwise indicated. The 1H, 13C, and 15N chemical shifts reported were referenced using external DSS (2,2-dimethyl-2-silapentane-5-sulfonate sodium salt), where 13C and 15N signals were referenced indirectly using 0.251449530 and 0.101329118 ratios for 13C and 15N nuclei, respectively (49). All NMR datasets were processed by using the NMRPipe software (12) and analyzed with the aid of the SPARKY program (18).

p14 peptide assignments. The 15N-labeled p14 peptide was obtained by growing bacteria in M9 medium supplemented with a mixture of vitamins (5 µg of thiamine, 1 µg of biotin, 1 µg of choline chloride, 1 µg of folic acid, 1 µg of nicinamide, 1 µg of calcium pantothenate, 1 µg of pyridoxal, and 0.1 µg of riboflavine/ml), 1 mM MgSO4, 0.1 mM CaCl2, 0.001 mM FeCl3, and 0.08% 15NH4Cl. To prepare an NMR sample, 15N-labeled peptide was dissolved in 90%/10% H2O/D2O, 50 mM phosphate buffer, and 200 mM KCl to a final 0.8 mM concentration. The pH was stabilized at 6.5 or 7.5 (uncorrected values). The two-dimensional (2D) NMR spectra were recorded on a Varian Unity + 500 NMR spectrometer at 298 K. The homonuclear 2D total correlation spectroscopy (TOCSY) and 2D rotating-frame Overhauser enhancement spectroscopy (ROESY) experiments were recorded with mixing times 80 and 300 ms, respectively. The spectral widths of 6,000 Hz in both dimensions were used to record 1024 x 256 complex data points in {omega}1 and {omega}2 frequencies, respectively. The 2D 1H-15N heteronuclear single quantum correlation (HSQC) spectrum was recorded with 6,000 x 1,600 Hz spectral widths and 1,024 x 128 complex data points in the 1H and 15N directions, respectively.

Studies on p14 binding to the HCV helicase and its domains. The interaction of the HCV helicase, domains 1 and 2, with the peptide was evaluated by using the T2 relaxation filtered NMR technique (20). The experiments were performed on either a Varian Unity+ 500 or a Varian Inova 400 NMR spectrometer. A typical NMR sample was prepared by diluting the proteins to 0.1 mM in 90%/10% H2O/D2O, 50 mM phosphate buffer and 200 mM KCl. The pH was stabilized at 7.5 (uncorrected value). Peptide-protein complex formation was traced after the addition of 0.1 to 0.3 mM peptide from a stock solution. The process of binding of the peptide to either the full-length HCV helicase or domains 1 and 2 was traced by comparative analysis of 1H 1D NMR spectra recorded with or without a T2 relaxation filter (20). We usually used 128 scans, a 1.4-s recycle delay, and T2 relaxation filters as long as 400 ms in these experiments.

Sequence-specific assignment of HCV helicase domain 1. The 13C, 15N double-labeled domain 1 of the HCV helicase was obtained as 15N-labeled p14 with the addition of 0.2% [13C]glucose. The NMR sample was prepared by diluting the double-labeled protein in 90%/10% H2O/D2O, 20 mM Tris-HCl, and 0.5% glycerol to 0.4 mM. The pH was stabilized at 7.5 (uncorrected value). Sequence-specific assignments of backbone amide resonances of domain 1 were performed on the basis of the 3D heteronuclear HNCA spectrum of domain 1 recorded at 281 K on a Bruker AvanceII NMR spectrometer equipped with a cryo probehead. The 1H, 13C, and 15N sequence-specific assignment data available in BioMagResBank (http://www.bmrb.wisc.edu) under accession number 4885 (30) were also used.

Titration experiments. The uniformly 15N-labeled domain 1 was obtained similarly to the double-labeled protein, without the addition of [13C]glucose to the medium. NMR samples of 15N-labeled 0.1 mM domain 1 were prepared in 90%/10% H2O/D2O with 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 5 mM dithiothreitol, and 0.5% glycerol. Peptide-domain 1 interactions were studied with various concentrations (0.15 to 0.3 mM) of unlabeled peptide. The titration experiments were performed on a Varian Inova 750 NMR spectrometer by using a series of 2D 1H-15N HSQC spectra recorded with 12,000 x 3,500 Hz for the 1H and 15N spectral widths, respectively.

Chemical shift mapping. The total chemical shift difference {Delta}{delta} was calculated as follows:

Formula
where {Delta}{delta}N and {Delta}{delta}H are the chemical shift differences of nitrogen and hydrogen, respectively. A weighting factor of 5 was used because the spectrum width of 15N is about fivefold larger than that of 1H.

Geometry optimization. Interacting residues were identified and mapped on the domain 1 structure derived from the Protein Data Bank (PDB ID 2F55) (33), while initial coordinates of the peptide were obtained on the basis of the domain 2 fragment R461 to R474 from the same helicase structure (the amino acid positions are those of the full-length NS3 protein), with the exchange of one amino acid (S470 in the NS3 sequence to R10 in the peptide sequence). The peptide in its extended conformation was docked to domain 1 on the side found on the basis of limited data from titration experiments, with the aid of the X-PLOR program (10). A total of 995 structures were generated by using the simulated annealing protocol (38, 39). During the search of possible geometries the backbone structure of the protein in the complex was fixed, but the side chains were allowed to move. The final structures of the complexes were obtained by the Powell algorithm of energy minimization implemented in the X-PLOR package (10). All simulations were based on standard X-PLOR "parallhdg" and "topallhdg" topology and parameter files. Upon initial rounds of simulations, the only distance restraints were applied for Y13 in p14 that appeared strongly bound based on the NMR titration data, and F238 and Y241 were selected as its putative partners in domain 1. Based on the population analysis of various intermolecular salt bridges, the most abundant bridges were introduced as the distance restraints used in the next rounds of simulated annealing protocol. Finally, a total of 995 rounds of simulated annealing using five distance restraints were performed to obtain the final model of the peptide complexed with domain 1. In 199 of 995 simulations an additional constraint on the distance between I12 and L236 was applied, but this raised the energy significantly. The best 20 structures, chosen based on the criterion of the lowest energy of the complex, were selected as representations of the complex structure (the structure of the lowest energy is presented). We adopted these results to predict a model of binding of the peptide to the full-length helicase.

Cells and viruses. The human hepatoma cell line Huh-7 and the plasmid pFK-luc-ubi-neo/NS3-3'/Con1/5.1 carrying the subgenomic HCV genotype 1 (con1) replicon with the luc-ubi-neo (reporter/selective) fusion gene (47) were kindly provided by R. Bartenschlager (Department of Molecular Virology, University of Heidelberg, Heidelberg, Germany). Stable Huh-7 clones carrying persistently replicating subgenomic HCV replicons were obtained using the protocol described by Lohmann et al. (31) with minor modifications. Huh-7 cells were grown in Dulbecco modified essential medium (DMEM; Invitrogen) with a high glucose concentration (4.5 g/liter), supplemented with 2 mM L-glutamine, 1x nonessential amino acids, 100 U of penicillin/ml, 100 µg of streptomycin/ml, and 10% fetal bovine serum (Sigma); for cells carrying the luc-ubi-neo replicon, 250 µg G418 (Geneticin; Invitrogen)/ml was added to the medium. Cells were grown at 37°C in 5% CO2.

Anti-HCV replicon studies. The conditions of the assay applied to test the antiviral activity of the peptide were based on the protocol developed by Paeshuyse et al. (40). Briefly, a logarithmic culture of replicon-carrying cells was grown, the cells were then seeded at the density of 5 x 103 cells per well in a 96-well tissue culture-treated white optical bottom plate (Nunc) in complete DMEM supplemented with 250 µg of G418/ml. After 24 h at 37°C, the medium was removed, and serial dilutions of the inhibitor (1, 4, 20, 40, 60, 80, and 160 µM) were added in 100 µl of fresh DMEM without G418. For comparison, serial dilutions of the control peptide YEVHHQKLVFFAEDV, expressed and purified as p14 (kindly provided by E. Gospodarska [IBB]), and ribavirin (ICN Biochemicals) were used at concentrations of 1, 4, 10, 20, 40, 80, and 160 µM and 20, 50, 100, 200, 250, 500, and 1,000 µM, respectively. After 4 days at 37°C, the medium was removed, and 40 µl of 1:1 Glo lysis buffer and Bright-Glo luciferase assay system solution (Promega) were added to each well. After 2 min of incubation, the luminescence was measured in a Synergy HTi (Biotek). The experiment was carried out five times with three replicates for each compound concentration. The 50% effective concentration (EC50) was defined as the peptide concentration that reduced luminescence by 50%.

Cytotoxicity assay. As in the replicon assay, the Huh-7 cells carrying the replicon were seeded at a density of 5 x 103 cells per well in 96-well tissue culture-treated plates (Sarstedt) in complete DMEM supplemented with 250 µg of G418/ml. After 24 h at 37°C, the medium was removed, and serial dilutions of the inhibitor or controls were added in 100 µl of fresh DMEM without G418. After 3 days at 37°C, the medium was removed, and 100 µl of DMEM with 0.5 mg of thiazolyl blue tetrazolium bromide (MTT; Sigma)/ml was added. The plates were incubated for 3 to 4 h at 37°C, the medium with MTT was removed, and 100 µl of 0.04 N HCl in absolute isopropanol was added to solubilize the precipitated converted dye. The absorbance of the dye was measured at 570 nm and the absorbance of the background at 650 nm, by using a Synergy HTi (Biotek). The experiment was carried out five times with three replicates for each compound concentration. After background subtraction, 50% cytotoxic concentration (CC50) was calculated as the concentration of the compound that inhibited cell growth by 50%.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Peptide expression, purification, and structural analysis. The peptide (p14) of 14 amino acids (RRGRTGRGRRGIYR), expressed in bacterial cells as a fusion with a hydrophobic leader peptide, was separated from the leader by CNBr cleavage and purified by HPLC (Fig. 1) with a yield of about 4 mg per liter and a high degree of purity (ca. 99%) that was additionally confirmed by mass spectroscopy. The peptide was further submitted to CD analysis to examine whether it adopts a secondary structure. The results obtained indicate that it is almost unfolded at neutral pH.


Figure 1
View larger version (53K):
[in this window]
[in a new window]

 
FIG. 1. Coomassie blue-stained 17% SDS-PAGE of HPLC peptide purification. Lanes: 1, sample before HPLC, after cleavage of the leader peptide with BrCN; 2 to 6, successive eluates from HPLC in the acetonitrile-water gradient; lane 7, prestained protein marker (NEB).

 
Inhibition of the HCV helicase. To test the inhibitory activity of p14, the fluorometric helicase activity assay was applied, as described by Boguszewska-Chachulska et al. (3). The compound was tested at 0.05 to 1.6 µM as shown in Fig. 2. The inhibitory activity of the peptide varied considerably from one experiment to another, probably due to peptide instability. The IC50 value was 725 ± 109 nM, indicating that the peptide is a very efficient NS3 helicase inhibitor.


Figure 2
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 2. Inhibition of the helicase activity by the peptide inhibitor (p14). Each point represents the mean of three independent experiments consisting of four replicates. Bars indicate standard deviations.

 
Additional experiments were designed to determine the mechanism of peptide action on helicase activity (Fig. 3). The first experiment was performed with various enzyme concentrations (10, 20, and 40 nM; Fig. 3A), and the second one with various substrate concentrations (10, 20, 40, and 80 nM; Fig. 3B); in both experiments the same constant concentration of peptide (800 nM) was used, close to its IC50 value. The results are presented as the percent activity of the helicase tested in the same conditions without the inhibitor. The results indicate that the level of inhibition strongly depends on the enzyme concentration because increasing concentrations of helicase reduce the inhibitory effect of the peptide, abolishing it completely at 40 nM helicase. It seems, however, that a possible interaction (or competition) with dsDNA is not of such importance because an eightfold increase in substrate concentration (to 80 nM) is unable to suppress the inhibition. The results obtained suggest that direct binding of the peptide to the enzyme occurs.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 3. Influence of increasing concentrations of helicase (A) and dsDNA substrate (B) on the level of helicase inhibition by p14 (800 nM). Each result is the mean of three independent experiments, with four replicates for each concentration. Bars indicate standard deviations. (C) Influence of increasing concentrations of peptide on the ATPase activity of the NS3 helicase. Each point represents three independent experiments consisting of two replicates. Bars indicate standard deviations.

 
ATPase assay. Various concentrations of the peptide (1, 5, 10, 50, and 100 µM) were tested in three independent experiments consisting of two replicates each. The results are presented as the percent activity of the helicase tested without the inhibitor in the same conditions (Fig. 3C). No inhibitory effect was observed in the range of peptide concentrations tested. Thus, it seems that the mechanism of action of the peptide is not correlated with inhibition of the ATPase activity of the HCV helicase.

Cross-linking studies. The oligomerization of NS3, as well as interaction between the peptide inhibitor and the helicase, was investigated by protein-protein cross-linking using sulfo-EGS (NHS ester), which is a homobifunctional water-soluble cross-linking agent with a spacer length of 16.1 Å. This reagent enters the reaction with the amino group at the N terminus and the side chain amino groups of the lysine residues in the protein (there are 16 lysine residues in the NS3 helicase) and forms stable amide bonds, along with the release of the N-hydroxysulfosuccinimide group. Cross-linking studies with the NS3 helicase (20 µM) and the cross-linker sulfo-EGS (6 mM) produced higher-molecular-weight bands that could correspond to helicase dimers (Fig. 4). The presence of DNA in the samples significantly increased the amount of dimer form (lanes 4, 5, and 6). In lane 15 with the peptide and DNA without helicase, the migration of 50% of the peptide was retarded, indicating that cross-linking between the peptide and DNA occurred. Other factors such as the presence of ATP or Mg2+ had no detectable effect on the efficiency of formation or distribution of the cross-linking products (lines 9 and 10). Our results demonstrate that DNA contributes to dimer formation and that the presence of ATP or Mn2+ does not influence dimerization. The peptide (80 µM) prevented the formation of the helicase dimer. Moreover, the presence of both the protein and the peptide prevented interaction between the peptide and the DNA. This suggests direct interaction between the peptide and the helicase.


Figure 4
View larger version (62K):
[in this window]
[in a new window]

 
FIG. 4. NS3 helicase cross-linking reaction with sulfo-EGS in the presence or absence of the peptide inhibitor and DNA. Proteins were detected by Coomassie blue staining, and DNA was visualized at 254 nm. The concentrations applied were 20 µM NS3 helicase; 80 µM p14; 6 mM sulfo-EGS; 6 mM Mn2+, 1 mM ATP; and 0.2, 1.3, or 2.6 µM DNA as indicated at the top of the figure. Lane 1, prestained molecular marker (Fermentas).

 
NMR studies. The 1H and 15N resonance assignment for the p14 peptide was based on a combination of 2D ROESY, 2D TOCSY, and 15N-1H HSQC experiments using a standard approach. Despite the strong overlap of arginine 1H resonances, 12 of the 13 signals expected in 15N-1H HSQC spectrum were detected and unequivocally assigned. The remaining resonance of R2 was detected only in a low-pH peptide solution.

Direct comparison of the 1H NMR spectra of the peptide recorded in the presence of the helicase and its domain 2 to that of the free peptide revealed changes in the peptide spectrum induced by addition of the protein. A significant movement was observed for the well-separated I12 aliphatic resonances, which fortunately did not overlap with the protein-originating signals. Addition of the full-length helicase to the peptide solution caused disappearance of the two I12 resonance signals (Fig. 5, marked by arrows), whereas almost no effect was observed when domain 2 was added. This clearly indicates that domain 2 is not a target for the interaction with p14. The 1D T2 relaxation filtering experiments (20) performed on the p14 peptide alone and with domain 1 of the NS3 helicase demonstrated efficient binding of the peptide to domain 1 (data not shown).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 5. Comparison of the high-field region of the 1H NMR spectrum of p14 alone with spectra recorded in the presence of potential protein targets. The black arrows mark I12 resonances, undergoing changes upon addition of the HCV helicase. The absence of these changes, when domain 2 is added, indicates that domain 2 is not a good target for p14.

 
The comparison of a series of 15N-1H HSQC spectra recorded for p14 displayed the existence of small, but noticeable changes induced upon addition of domain 1 of the HCV helicase (Fig. 6A). This effect was attributed mostly to the 12IYR14 fragment, pointing to the C-terminal part of the peptide as crucial for the interaction with the NS3 helicase and its domains.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 6. (A) 15N-1H spectrum of 15N-enriched p14 recorded in the absence (black) and presence (gray) of domain 1. The small, but significant changes observed for I12, Y13, and R14 clearly suggest that the C-terminal fragment of p14 is strongly bound to the protein. (B) 1H-15N HSQC spectra of 15N-labeled HCV helicase domain 1 (0.1 mM) in the absence (blue) and presence (red) of unlabeled peptide (0.15 to 0.3 mM). Interaction with the peptide causes chemical shift perturbations. Peaks that changed their location are labeled with the assigned one-letter amino acid code and the residue position in the full-length NS3 protein.

 
The interaction of p14 with domain 1 of the HCV helicase was also monitored on the 2D 1H-15N HSQC spectrum of the 15N enriched protein titrated by the p14 solution. The spectra of the protein alone and with the unlabeled peptide, acquired to detect putative interacting residues, are presented in Fig. 6B. The assignment was based on a simple "pattern matching" with the previously recorded 1H-15N HSQC spectrum of domain 1. About 82% of nonproline amino acids were assigned to the signals on the 1H-15N HSQC spectrum of domain 1. A full assignment was not achieved because the spectrum lacked 23 signals and, moreover, two amino acids in our domain 1 construct were different than in the construct described by Liu and Wyss (30), and one methionine was added at the N terminus. According to Liu and Wyss (30), 12 of the missing peaks are presumed to originate from the N-terminal region comprising amino acids T185 to S189 and from the Walker A motif of the conserved sequence, corresponding to amino acids T205 to S211. These resonances probably appeared in the spectrum of domain 1 with the peptide in the region limited by chemical shifts of nitrogen (109 to 111 ppm) and hydrogen (8.3 to 8.7 ppm) (Fig. 6B). The regions mentioned above are in an extended conformation; 34 peaks that changed their positions are depicted in Fig. 6B. The perturbations of the total chemical shift calculated are presented in Fig. 7. Since the full assignment of both peptide-bound and free domain 1 could not be obtained, for peaks that were assigned only in one spectrum the chemical shift difference was measured as the distance to the nearest peak to determine the lower limitation of the perturbation (48). For six residues the change in resonance location, {Delta}{delta}, exceeded 0.1 ppm: H201, H203, A233, C292, and two others that could not be identified. Five residues displayed {Delta}{delta} in the range of 0.04 to 0.1 ppm: K244, D285, and three other residues that could not be unambiguously assigned. For the remaining residues, changes in {Delta}{delta} did not exceed 0.04 ppm. The residues putatively interacting with p14 are clustered in four regions at the surface of domain 1, all of them located close to the domain 1 and 2 interface in the entire NS3 helicase. This clustering is reflected in their {Delta}{delta} distribution (Fig. 7): A233 to K244 represent a part of an {alpha}-helix, while three adjacent parts correspond to the N-terminal β-sheet (V199 to H203), the C-terminal residues (L320 to A323) and the metal ion-binding loop (D290 to C292). The residues of highest interest are H201, H203, A233, D285, K244, and C292, which surround an acidic area with the exception of D285. Taking into account that the size of the peptide limits the area of interaction, we conclude that some chemical shift differences arise only from conformational changes in protein structure only upon peptide binding and are not due to peptide proximity.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 7. Total chemical shift difference calculated according to the equation (1) of the backbone 15N and 1H resonances of the HCV helicase domain 1 upon interaction with the peptide as a function of the position of the residue in the full-length NS3 protein.

 
For peptide docking to domain 1 the following restraints were chosen. The only tyrosine in the peptide was fixed inside a cavity between F238 and Y241. Four salt bridges between the protein's acids and the peptide's arginines were fixed as follows: R14 to D290, R9 to E291, R7 to D296, and R1 to D308 (Fig. 8A). This selection is rather arbitrary but supported by two facts. First, the peptide spreads close to the residues identified as binding sites and, second, according to the map of potential energy, the proposed restraints place the peptide in the negatively charged pocket between domains 1, 2, and 3 that constitutes a good target for the positively charged peptide.


Figure 8
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 8. (A) Model of peptide interaction with domain 1. A color scheme is used to mark amino acids that were not assigned (white), those whose resonances were unperturbed (yellow), those whose change in chemical shift was <0.1 ppm (orange), and those whose change in chemical shift was >0.1 ppm (red). (B) Model of the p14 peptide binding to the entire NS3 helicase obtained by MD simulations on the basis of data from chemical shift mapping experiments performed on domain 1. The peptide (green) is twisted around domain 1, filling the clefts between domains 1 and 2, as well as between domains 1 and 3 of the NS3 helicase. Structural alignment of the NS3 helicase (PDB ID 2f55) with the SF2 helicase RecQ bound to an ATP analog (PDB ID 1OYY) gave a rough position of ATP (yellow) bound to the HCV helicase. Two key residues in DNA binding (T269, domain 1; W501, domain 3) are marked in blue. The sequence of p14 corresponding to the motif VI in domain 2 is marked in blue.

 
NS3 peptide is an inhibitor of subgenomic HCV replication in Huh-7 cells. The subgenomic HCV replicon I389 luc-ubi-neo/NS3-3'/Con1/5.1, used here, carries the HCV 5' untranslated region with the internal ribosome entry site directing the expression of a luc-ubi-neo fusion gene, an internal ribosome entry site from encephalomyocarditis virus that directs translation of the HCV NS3 to NS5B region, and the HCV 3' untranslated region. The expression of luc-ubi-neo gene enables the concurrent selection of neomycin/G418-resistant cells with replicating HCV RNA and measurement of RNA replication by using an indirect but easy and sensitive method, based on the determination of the activity of the reporter protein luciferase (47). Replicon-bearing cells were treated for 4 days with concentrations of p14 and control peptide ranging from 1 to 160 µM and of ribavirin ranging from 50 to 1,000 µM. The level of HCV RNA replication remaining in the cells was determined by measuring the luminescence signal. The addition of p14 reduced the level of HCV RNA in a dose-dependent manner. Concentrations of the peptide up to 60 µM significantly inhibited HCV RNA replication, and simultaneously no cytotoxic effect was observed. The presence of the peptide even intensified cell growth by ca. 20% compared to control cells. A similar observation was made for IFN alfa-2b (Schering-Plough)-treated cells, as well as for other helicase inhibitors studied in the replicon system (data not shown). We assume that this is correlated with replicon loss since this effect was not observed for Huh-7 cells without the replicon. The EC50, CC50, and therapeutic index (TI; i.e., CC50/EC50) values obtained for p14, control peptide, and ribavirin are listed in Table 1. In comparison to other compounds in development, e.g., VX-950 with an EC50 of 0.354 µM and TI of 230 (41), p14 has low efficacy as an HCV replication inhibitor. However, it is difficult to compare results obtained for p14 in replicon cells to those for other compounds since no data on activity of helicase inhibitors in the replicon system have been reported to date. Moreover, the results of HCV replication inhibition have been presented solely for already-modified peptides (26, 29), and these values should not be compared to those for an unmodified peptide.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Inhibition of HCV RNA replication by the p14 peptide, ribavirin, and the control peptidea

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
As presented above, the p14 peptide possesses a potent anti-helicase activity with an IC50 of 725 nM in the fluorometric helicase activity assay, indicating that it is one of the most efficient NS3 helicase inhibitors cited in the literature (3, 8, 19), as well as when compared to other inhibitors tested in the same system, for which IC50 values exceeded 17 µM (3). Subsequent experiments with various concentrations of the enzyme and substrate enabled us to reveal more facts on the mechanism of action of the peptide. The experiment with increasing enzyme concentrations at constant inhibitor concentration suggested the possibility of direct binding of the peptide to the helicase. Simultaneously, a similar experiment with increasing substrate concentrations indicated that the level of inhibition was independent of substrate concentration. The direct interaction between the peptide and helicase was confirmed by further NMR studies. According to Dyson and Wright (14), peptide fragments of proteins can adopt their native structures in solution. Our preliminary explanation of how p14 inhibits the helicase activity assumed that the free peptide might mimic part of domain 2 and thus interact with domain 1 (via an ATP molecule) as does the original helicase motif VI. Thus, interference by the peptide might prevent movements of domain 2 in relation to other domains of the helicase and therefore cause enzyme inhibition. However, our CD and NMR measurements showed that p14 adopted random coil structures and that this tendency was independent of the presence or absence of helicase in the solution. Thus, the mechanism of inhibition could be different. The comparison of the 1H NMR spectra of the p14 peptide recorded in the presence of the entire helicase and its domain 2 to that of the free peptide indicates that the peptide binds to the full-length enzyme while domain 2 is not a target of interaction. Consequently, during subsequent NMR studies we focused only on the interaction between the peptide and domain 1. The results of relaxation filtering experiments performed for p14 alone and for p14 in the presence of domain 1 indicate that p14 efficiently binds to domain 1 of the HCV helicase. A comparison of a series of 15N-1H HSQC spectra recorded for the peptide alone and upon addition of domain 1, as well as a series of spectra recorded for the 15N-labeled domain 1 alone and with the peptide, allowed us to identify the principal amino acid residues on both molecules engaged in this interaction. The peptide residues crucial for helicase binding are Y13 that anchors the C-terminal part of p14 in the hydrophobic pocket on domain 1 and the adjacent amino acids I12 and R14. These NMR data drove us to create a model of the peptide-domain 1 interaction (Fig. 8A) and, on this basis, to create a model of the peptide-helicase binding (Fig. 8B). According to this model, the p14 peptide in its extended conformation is twisted around domain 1, partially filling the clefts between domain 1 and domain 2, as well as between domain 1 and domain 3. In this position the peptide should not affect the ATPase activity of the helicase. This result is supported by the ATPase assay, clearly indicating that the peptide does not inhibit the NS3 ATPase activity. Moreover, some of peptide arginines may coordinate ATP binding and hydrolysis, instead of the arginine from motif VI of domain 2. Several significant changes in chemical shift were observed in the part of the domain 1 facing domain 3 (Fig. 8A). The part of the peptide interacting with the interface between these two domains certainly prevents NA from binding the helicase. At least two amino acids (T269 and W501, Fig. 8B) crucial for NA binding are blocked while the peptide is bound to the helicase. Our results from cross-linking experiments strongly support these assumptions. According to Levin and Patel (27) the helicase alone is capable of forming oligomers, but in the presence of DNA most of the helicase molecules form dimers. Mackintosh et al. (33) crystallized the helicase dimer bound to a single oligonucleotide (PDB ID 2F55). In the dimer structure, the oligonucleotide is bound to each helicase particle within the cleft formed at the interface of domains 1 and 2 with domain 3. Our results confirmed the observation concerning the contribution of DNA to dimer formation and the fact that the presence of ATP or Mn2+ did not influence dimerization. The presence of the peptide disabled formation of the helicase dimer. Moreover, the presence of both the protein and the peptide prevented interaction between the peptide and the DNA (Fig. 4). This suggests direct interaction between the peptide and the helicase and clearly proves that the interaction occurs through the same interface as DNA binding. In our opinion the mechanism of peptide inhibition mainly relies on blocking the NA binding site. One of the plausible hypotheses assumes that an interaction between these three molecules may occur when the helicase encounters the NA-bound peptide during its translocation along the NA (similarly to streptavidin displacement from 5'-biotinylated oligonucleotides)(37).

Our results from the HCV replicon system indicate that the p14 peptide reduces HCV RNA replication in a dose-dependent manner, although the window between inhibition of RNA replication and cytotoxicity is narrow (TI = 1.8). The impact of the peptide on replicon cells varied among the five experiments performed, in some experiments even giving EC50 values as low as 40 µM. The precise EC50 is difficult to assess since the peptide may aggregate or undergo disintegration. Thus, the actual TI can be higher than calculated on the basis of the experiments performed. Peptide cytotoxicity may be due to the kinase inhibitory activity of the peptide, as well as to interaction of the peptide with cellular NA, but possible peptide aggregation might also be involved in these effects. Arginine-rich peptides can enter cells with high efficiency, but mainly by endocytosis, followed by partial degradation in endosomes (35). Thus, the difference between EC50 and IC50 may be a result of p14 degradation by cellular proteases and aggregation. Still p14 has a better TI than ribavirin in our HCV replicon system and, as a positively charged peptide, it can efficiently penetrate cells. Therefore, we consider it to be a good starting point for the design of anti-helicase peptidomimetic agents with improved stability in the cell and thus enhanced anti-HCV activity. Modified p14 could be used as a component of a multidrug anti-HCV therapy that would target various viral proteins, since it is one of the most efficient anti-helicase agents published and the only one for which the antiviral activity was demonstrated to date.


    ACKNOWLEDGMENTS
 
This study was partially supported by the EC grant FP5 RTD QLK2-CT-2002-01079 and MNiSW grant 2P05A 038 29.

We thank Hartmut Oshkinat (Leibniz Institute for Molecular Pharmacology, Berlin, Germany) and Oliver Ohlenschlager (Fritz Lipmann Institute, Jena, Germany) for access to Bruker AvanceII 750 and Varian Inova 750 NMR spectrometers, Peter Schmieder (Leibniz Institute for Molecular Pharmacology, Berlin, Germany) for technical assistance, Mariusz Krawczyk for help with the helicase and replicon assays, Maciej Maciejczyk (Cornell University, Ithaca, NY) for inspiring discussions, and Anne-Lise Haenni (Institut Jacques Monod, Paris, France) for careful reading of the manuscript and helpful suggestions.


    FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Biochemistry and Biophysics PAS, ul. Pawinskiego 5a, 02-106 Warsaw, Poland. Phone: 48 22 592 24 17. Fax: 48 22 658 46 36. E-mail: annach{at}ibb.waw.pl Back

{triangledown} Published ahead of print on 26 November 2007. Back


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Andre, P., F. Komurian-Pradel, S. Deforges, M. Perret, J. L. Berland, M. Sodoyer, S. Pol, C. Brechot, G. Paranhos-Baccala, and V. Lotteau. 2002. Characterization of low- and very-low-density hepatitis C virus RNA-containing particles. J. Virol. 76:6919-6928.[Abstract/Free Full Text]
  2. Bartenschlager, R. 2006. Hepatitis C virus molecular clones: from cDNA to infectious virus particles in cell culture. Curr. Opin. Microbiol. 9:416-422.[CrossRef][Medline]
  3. Boguszewska-Chachulska, A. M., M. Krawczyk, A. Najda, K. Kopanska, A. Stankiewicz-Drogon, W. Zagorski-Ostoja, and M. Bretner. 2006. Searching for a new anti-HCV therapy: synthesis and properties of tropolone derivatives. Biochem. Biophys. Res. Commun. 341:641-647.[CrossRef][Medline]
  4. Boguszewska-Chachulska, A. M., M. Krawczyk, A. Stankiewicz, A. Gozdek, A. L. Haenni, and L. Strokovskaya. 2004. Direct fluorometric measurement of hepatitis C virus helicase activity. FEBS Lett. 567:253-258.[CrossRef][Medline]
  5. Bolewska, K., D. Krowarsch, J. Otlewski, L. Jaroszewski, and A. Bierzynski. 1995. Synthesis, cloning, and expression in Escherichia coli of a gene coding for the Met8->Leu CMTI I: a representative of the squash inhibitors of serine proteinases. FEBS Lett. 377:172-174.[CrossRef][Medline]
  6. Borowski, P., K. Oehlmann, M. Heiland, and R. Laufs. 1997. Nonstructural protein 3 of hepatitis C virus blocks the distribution of the free catalytic subunit of cyclic AMP-dependent protein kinase. J. Virol. 71:2838-2843.[Abstract]
  7. Borowski, P., K. Resch, H. Schmitz, and M. Heiland. 2000. A synthetic peptide derived from the nonstructural protein 3 of hepatitis C virus serves as a specific substrate for PKC. Biol. Chem. 381:19-27.[CrossRef][Medline]
  8. Borowski, P., S. Schalinski, and H. Schmitz. 2002. Nucleotide triphosphatase/helicase of hepatitis C virus as a target for antiviral therapy. Antivir. Res. 55:397-412.[CrossRef][Medline]
  9. Brass, V., D. Moradpour, and H. E. Blum. 2006. Molecular virology of hepatitis C virus (HCV): 2006 update. Int. J. Med. Sci. 3:29-34.[Medline]
  10. Brunger, A. T. 1992. The X-PLOR software manual, version 3.1 Yale University Press, New Haven, CT. http://atb.csb.yale.edu/xplor/.
  11. Choo, Q. L., G. Kuo, A. J. Weiner, L. R. Overby, D. W. Bradley, and M. Houghton. 1989. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 244:359-362.[Abstract/Free Full Text]
  12. Delaglio, F., S. Grzesiek, G. W. Vuister, G. Zhu, J. Pfeifer, and A. Bax. 1995. NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR 6:277-293.[Medline]
  13. Dumont, S., W. Cheng, V. Serebrov, R. K. Beran, I. Tinoco, Jr., A. M. Pyle, and C. Bustamante. 2006. RNA translocation and unwinding mechanism of HCV NS3 helicase and its coordination by ATP. Nature 439:105-108.[CrossRef][Medline]
  14. Dyson, H. J., and P. E. Wright. 1993. Peptide conformation and protein folding. Curr. Opin. Struct. Biol. 3:60-65.[CrossRef]
  15. Forns, X., J. Bukh, and R. H. Purcell. 2002. The challenge of developing a vaccine against hepatitis C virus. J. Hepatol. 37:684-695.[CrossRef][Medline]
  16. Frick, D. N. 2007. The hepatitis C virus NS3 protein: a model RNA helicase and potential drug target. Curr. Issues Mol. Biol. 9:1-20.[Medline]
  17. Frutos, S., R. A. Rodriguez-Mias, S. Madurga, B. Collinet, M. Reboud-Ravaux, D. Ludevid, and E. Giralt. 2007. Disruption of the HIV-1 protease dimer with interface peptides: structural studies using NMR spectroscopy combined with [2-(13)C]-Trp selective labeling. Biopolymers 88:164-173.[CrossRef][Medline]
  18. Goddard, T. D., and D. G. Kneller. 2004. SPARKY 3.110. University of California, San Francisco. http://www.cgl.ucsf.edu/home/sparky.
  19. Gordon, C. P., and P. A. Keller. 2005. Control of hepatitis C: a medicinal chemistry perspective. J. Med. Chem. 48:1-20.[CrossRef][Medline]
  20. Hajduk, P. J., R. P. Meadows, and S. W. Fesik. 1997. Discovering high-affinity ligands for proteins. Science 278:. 497:499.[CrossRef]
  21. Hayashi, N., and T. Takehara. 2006. Antiviral therapy for chronic hepatitis C: past, present, and future. J. Gastroenterol. 41:17-27.[CrossRef][Medline]
  22. Jin, L., and D. L. Peterson. 1995. Expression, isolation, and characterization of the hepatitis C virus ATPase/RNA helicase. Arch. Biochem. Biophys. 323:47-53.[CrossRef][Medline]
  23. Kim, D. W., Y. Gwack, J. H. Han, and J. Choe. 1995. C-terminal domain of the hepatitis C virus NS3 protein contains an RNA helicase activity. Biochem. Biophys. Res. Commun. 215:160-166.[CrossRef][Medline]
  24. Kim, J. L., K. A. Morgenstern, J. P. Griffith, M. D. Dwyer, J. A. Thomson, M. A. Murcko, C. Lin, and P. R. Caron. 1998. Hepatitis C virus NS3 RNA helicase domain with a bound oligonucleotide: the crystal structure provides insights into the mode of unwinding. Structure 6:89-100.[Medline]
  25. Lam, A. M., and D. N. Frick. 2006. Hepatitis C virus subgenomic replicon requires an active NS3 RNA helicase. J. Virol. 80:404-411.[Abstract/Free Full Text]
  26. Lamarre, D., P. C. Anderson, M. Bailey, P. Beaulieu, G. Bolger, P. Bonneau, M. Bos, D. R. Cameron, M. Cartier, M. G. Cordingley, A. M. Faucher, N. Goudreau, S. H. Kawai, G. Kukolj, L. Lagace, S. R. LaPlante, H. Narjes, M. A. Poupart, J. Rancourt, R. E. Sentjens, R. St George, B. Simoneau, G. Steinmann, D. Thibeault, Y. S. Tsantrizos, S. M. Weldon, C. L. Yong, and M. Llinas-Brunet. 2003. An NS3 protease inhibitor with antiviral effects in humans infected with hepatitis C virus. Nature 426:186-189.[CrossRef][Medline]
  27. Levin, M. K., and S. S. Patel. 1999. The helicase from hepatitis C virus is active as an oligomer. J. Biol. Chem. 274:31839-31846.[Abstract/Free Full Text]
  28. Levin, M. K., Y. H. Wang, and S. S. Patel. 2004. The functional interaction of the hepatitis C virus helicase molecules is responsible for unwinding processivity. J. Biol. Chem. 279:26005-26012.[Abstract/Free Full Text]
  29. Lin, K., R. B. Perni, A. D. Kwong, and C. Lin. 2006. VX-950, a novel hepatitis C virus (HCV) NS3-4A protease inhibitor, exhibits potent antiviral activities in HCV replicon cells. Antimicrob. Agents Chemother. 50:1813-1822.[Abstract/Free Full Text]
  30. Liu, D., and D. F. Wyss. 2000. Sequence-specific 1H, 15N and 13C resonance assignments for an engineered arginine-rich domain of the hepatitis C virus NS3 RNA helicase. J. Biomol. NMR 18:279-280. (Letter.)[CrossRef][Medline]
  31. Lohmann, V., F. Korner, A. Dobierzewska, and R. Bartenschlager. 2001. Mutations in hepatitis C virus RNAs conferring cell culture adaptation. J. Virol. 75:1437-1449.[Abstract/Free Full Text]
  32. Lohmann, V., F. Korner, J. Koch, U. Herian, L. Theilmann, and R. Bartenschlager. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-113.[Abstract/Free Full Text]
  33. Mackintosh, S. G., J. Z. Lu, J. B. Jordan, M. K. Harrison, B. Sikora, S. D. Sharma, C. E. Cameron, K. D. Raney, and J. Sakon. 2006. Structural and biological identification of residues on the surface of NS3 helicase required for optimal replication of the hepatitis C virus. J. Biol. Chem. 281:3528-3535.[Abstract/Free Full Text]
  34. Malcolm, B. A., R. Liu, F. Lahser, S. Agrawal, B. Belanger, N. Butkiewicz, R. Chase, F. Gheyas, A. Hart, D. Hesk, P. Ingravallo, C. Jiang, R. Kong, J. Lu, J. Pichardo, A. Prongay, A. Skelton, X. Tong, S. Venkatraman, E. Xia, V. Girijavallabhan, and F. G. Njoroge. 2006. SCH 503034, a mechanism-based inhibitor of hepatitis C virus NS3 protease, suppresses polyprotein maturation and enhances the antiviral activity of alpha interferon in replicon cells. Antimicrob. Agents Chemother. 50:1013-1020.[Abstract/Free Full Text]
  35. Melikov, K., and L. V. Chernomordik. 2005. Arginine-rich cell penetrating peptides: from endosomal uptake to nuclear delivery. Cell Mol. Life Sci. 62:2739-2749.[CrossRef][Medline]
  36. Miozzari, G. F., and C. Yanofsky. 1978. Translation of the leader region of the Escherichia coli tryptophan operon. J. Bacteriol. 133:1457-1466.[Abstract/Free Full Text]
  37. Morris, P. D., A. K. Byrd, A. J. Tackett, C. E. Cameron, P. Tanega, R. Ott, E. Fanning, and K. D. Raney. 2002. Hepatitis C virus NS3 and simian virus 40 T antigen helicases displace streptavidin from 5'-biotinylated oligonucleotides but not from 3'-biotinylated oligonucleotides: evidence for directional bias in translocation on single-stranded DNA. Biochemistry 41:2372-2378.[CrossRef][Medline]
  38. Nilges, M., G. M. Clore, and A. M. Gronenborn. 1988. Determination of three-dimensional structures of proteins from interproton distance data by dynamical simulated annealing from a random array of atoms: circumventing problems associated with folding. FEBS Lett. 239:129-136.[CrossRef][Medline]
  39. Nilges, M., J. Kuszewski, and A. T. Brunger. 1991. Sampling properties of simulated annealing and distance geometry, p. 451-455. In J. Hoch (ed.), Computational aspects of the study of biological macromolecules by nuclear magnetic resonance spectroscopy. Plenum Press, Inc., New York, NY.
  40. Paeshuyse, J., L. Coelmont, I. Vliegen, J. Van hemel, J. Vandenkerckhove, E. Peys, B. Sas, E. De Clercq, and J. Neyts. 2006. Hemin potentiates the anti-hepatitis C virus activity of the antimalarial drug artemisinin. Biochem. Biophys. Res. Commun. 348:139-144.[CrossRef][Medline]
  41. Perni, R. B., S. J. Almquist, R. A. Byrn, G. Chandorkar, P. R. Chaturvedi, L. F. Courtney, C. J. Decker, K. Dinehart, C. A. Gates, S. L. Harbeson, A. Heiser, G. Kalkeri, E. Kolaczkowski, K. Lin, Y. P. Luong, B. G. Rao, W. P. Taylor, J. A. Thomson, R. D. Tung, Y. Wei, A. D. Kwong, and C. Lin. 2006. Preclinical profile of VX-950, a potent, selective, and orally bioavailable inhibitor of hepatitis C virus NS3-4A serine protease. Antimicrob. Agents Chemother. 50:899-909.[Abstract/Free Full Text]
  42. Preugschat, F., D. P. Danger, L. H. Carter III, R. G. Davis, and D. J. Porter. 2000. Kinetic analysis of the effects of mutagenesis of W501 and V432 of the hepatitis C virus NS3 helicase domain on ATPase and strand-separating activity. Biochemistry 39:5174-5183.[CrossRef][Medline]
  43. Root, M. J., and H. K. Steger. 2004. HIV-1 gp41 as a target for viral entry inhibition. Curr. Pharm. Des. 10:1805-1825.[CrossRef][Medline]
  44. Serebrov, V., and A. M. Pyle. 2004. Periodic cycles of RNA unwinding and pausing by hepatitis C virus NS3 helicase. Nature 430:476-480.[CrossRef][Medline]
  45. Tackett, A. J., Y. Chen, C. E. Cameron, and K. D. Raney. 2005. Multiple full-length NS3 molecules are required for optimal unwinding of oligonucleotide DNA in vitro. J. Biol. Chem. 280:10797-10806.[Abstract/Free Full Text]
  46. Venkatraman, S., S. L. Bogen, A. Arasappan, F. Bennett, K. Chen, E. Jao, Y. T. Liu, R. Lovey, S. Hendrata, Y. Huang, W. Pan, T. Parekh, P. Pinto, V. Popov, R. Pike, S. Ruan, B. Santhanam, B. Vibulbhan, W. Wu, W. Yang, J. Kong, X. Liang, J. Wong, R. Liu, N. Butkiewicz, R. Chase, A. Hart, S. Agrawal, P. Ingravallo, J. Pichardo, R. Kong, B. Baroudy, B. Malcolm, Z. Guo, A. Prongay, V. Madison, L. Broske, X. Cui, K. C. Cheng, Y. Hsieh, J. M. Brisson, D. Prelusky, W. Korfmacher, R. White, S. Bogdanowich-Knipp, A. Pavlovsky, P. Bradley, A. K. Saksena, A. Ganguly, J. Piwinski, V. Girijavallabhan, and F. G. Njoroge. 2006. Discovery of (1R,5S)-N-[3-amino-1-(cyclobutylmethyl)-2,3-dioxopropyl]- 3-[2(S)-[[[(1,1-dimethylethyl)amino]carbonyl]amino]-3,3-dimethyl-1-oxobuty l]- 6,6-dimethyl-3-azabicyclo[3.1.0]hexan-2(S)-carboxamide (SCH 503034), a selective, potent, orally bioavailable hepatitis C virus NS3 protease inhibitor: a potential therapeutic agent for the treatment of hepatitis C infection. J. Med. Chem. 49:6074-6086.[CrossRef][Medline]
  47. Vrolijk, J. M., A. Kaul, B. E. Hansen, V. Lohmann, B. L. Haagmans, S. W. Schalm, and R. Bartenschlager. 2003. A replicon-based bioassay for the measurement of interferons in patients with chronic hepatitis C. J. Virol. Methods 110:201-209.[CrossRef][Medline]
  48. Williamson, R. A., M. D. Carr, T. A. Frenkiel, J. Feeney, and R. B. Freedman. 1997. Mapping the binding site for matrix metalloproteinase on the N-terminal domain of the tissue inhibitor of metalloproteinases-2 by NMR chemical shift perturbation. Biochemistry 36:13882-13889.[CrossRef][Medline]
  49. Wishart, D. S., C. G. Bigam, J. Yao, F. Abildgaard, H. J. Dyson, E. Oldfield, J. L. Markley, and B. D. Sykes. 1995. 1H, 13C, and 15N chemical shift referencing in biomolecular NMR. J. Biomol. NMR 6:135-140.[Medline]
  50. Zagulski, M., D. Kressler, A. M. Becam, J. Rytka, and C. J. Herbert. 2003. Mak5p, which is required for the maintenance of the M1 dsRNA virus, is encoded by the yeast ORF YBR142w and is involved in the biogenesis of the 60S subunit of the ribosome. Mol. Genet. Genomics 270:216-224.[CrossRef][Medline]


Antimicrobial Agents and Chemotherapy, February 2008, p. 393-401, Vol. 52, No. 2
0066-4804/08/$08.00+0     doi:10.1128/AAC.00961-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AAC.00961-07v1
52/2/393    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information