Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, February 2008, p. 574-585, Vol. 52, No. 2
0066-4804/08/$08.00+0 doi:10.1128/AAC.00717-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Department of Chemistry, MS60, Rice University, 6100 Main St., Houston, Texas 77005,1 Mikrobiologisches Institut, Universität Tübingen, Auf der Morgenstelle 28, D-72076 Tubingen, Germany,2 School of Biology, University of Newcastle, Newcastle upon Tyne NE1 7RU, United Kingdom3
Received 2 June 2007/ Returned for modification 20 August 2007/ Accepted 25 November 2007
|
|
|---|
|
|
|---|
![]() View larger version (13K): [in a new window] |
FIG. 1. Structures of lactonamycin (compound 1) and lactonamycin Z (compound 2).
|
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids used in this study
|
PCR amplification of an NDP-hexose 2,3-dehydratase from S. rishiriensis. The presence of an L-rhodinose moiety in lactonamycin suggested that a nucleoside diphosphate (NDP)-hexose 2,3-dehydratase gene should reside within the lactonamycin biosynthetic gene cluster. Accordingly, several sets of degenerate oligonucleotide primers were designed to amplify an internal region of an NDP-hexose 2,3-dehydratase gene from the lactonamycin producer S. rishiriensis MJ 773-88K4. The sequences of these primers were derived from conserved domains of NDP-hexose 2,3-dehydratase genes found in antibiotic biosynthetic gene clusters of Streptomyces violaceoruber Tu22 (gra ORF27) (13), Streptomyces peucetius (dnmT) (43), Saccharopolyspora erythraea (eryBVI) (14, 49), and Streptomyces nogalater (snogH) (53). One set of degenerate primers led to the successful amplification of a 495-bp NDP-hexose 2,3-dehydratase gene fragment. The degenerate primers were N-terminal primer DHF (5'-GGSCGSTTCTTCTCSGTSGAG-3') and C-terminal primer DHR (5'-ACSGTSCGSGHGTCCATGTT-3', where S is C or G).
Cosmid library construction and screening. S. rishiriensis and S. sanglieri were grown in yeast extract-malt extract (YEME) medium (24), and genomic DNA was extracted by standard methods (24). Cosmid libraries of S. rishiensis and S. sanglieri DNA in cosmid vector pOJ446 (5) were constructed in a manner previously described (57). In a similar way, a cosmid library of S. sanglieri DNA in cosmid vector SuperCos1 was also constructed. Screening of the cosmid libraries by Southern hybridizations was carried out as previously described (57). The S. rishiriensis pOJ446 cosmid library was screened with the 495-bp NDP-hexose 2,3-dehydratase fragment amplified from S. rishiriensis by PCR, while the two S. sanglieri cosmid libraries were screened with a 1,320-bp PCR product obtained by PCR amplification of the S. rishiriensis lct36 gene.
Fermentation of S. rishiriensis MJ773-88K4. Fermentation of S. rishiriensis MJ773-88K4 was carried out according to published methods (29) and also under the conditions employed for S. sanglieri AK 623 (see below). The levels of lactonamycin production were low in both media, and reproducible antibiotic production was difficult to maintain. Analytical high-performance liquid chromatography (HPLC) detection of lactonamycin was carried out on a 4.6- by 250-mm YMC-Pack ODA-A column as described below for lactonamycin Z. The retention time for lactonamycin in this system was ca. 27 min. Small amounts of lactonamycin could be isolated from the fermentation broth by preparative HPLC using a 10- by 250-mm YMC-Pack ODS-A column and the conditions described for preparative HPLC of lactonamycin Z (see below).
Fermentation of S. sanglieri and isolation of lactonamycin Z. Fermentation of S. sanglieri AK 623 was carried out at 27°C and 120 rpm in the medium described above. The medium (100 ml) was inoculated from a spore suspension and grown at 27°C for 48 h. Fresh medium (five 200-ml portions) was then inoculated with five 10-ml samples of the seed culture, and fermentation was allowed to proceed for 96 h. The pH of the medium was readjusted to 4.5, and the mixture was centrifuged to separate the fermentation broth from the mycelium. The supernatant was extracted three times with ethyl acetate, while the mycelium was suspended in excess 50% aqueous acetone and stirred for 1 hour. The aqueous acetone extract was filtered, and the acetone was removed in vacuo. The aqueous residue was extracted three times with ethyl acetate, and the resulting extracts were combined with the ethyl acetate extracts of the fermentation broth. The total ethyl acetate extract was dried over anhydrous sodium sulfate and filtered, and the ethyl acetate was removed in vacuo. The residue was dissolved in chloroform and filtered to remove insoluble material. The filtered chloroform extract was taken to dryness in vacuo, and lactonamycin Z was isolated from the residue by preparative HPLC as described below. The estimated titer of lactonamycin Z in the fermentation broth is ca. 5 mg per liter.
HPLC analysis of lactonamycin Z. HPLC analysis was carried out with a Varian ProStar 325 UV-visible detector set at 300 nm and a YMC-Pack ODS-A column (4.6 by 250 mm). Elution was carried out by running a linear gradient over 30 min from 40:60 methanol-water containing 0.5% formic acid to 80:20 methanol-water containing 0.5% formic acid with a flow rate of 1 ml/min. Under these conditions, lactonamycin Z exhibited a retention time of ca. 21 min. For preparative applications, the same gradient was applied to a YMC-Pack ODS-A column (10 by 250 mm) with a flow rate of 3 ml/min. Approximately 1 to 2 mg of purified lactonamycin Z could be obtained from 1 liter of fermentation broth.
Preparation of lactonamycinone from lactonamycin Z.
Lactonamycinone was prepared from lactonamycin Z by a modification of the procedure used to convert lactonamycin into lactonamycinone (30). Lactonamycin Z (3.5 mg) was dissolved in 0.5 ml of spectral grade tetrahydrofuran, and 0.2 ml of 1 N HCl was added. The resulting solution was stirred at room temperature and monitored periodically by HPLC. After 67 h, the tetrahydrofuran was removed in vacuo at room temperature, and the remaining aqueous solution was diluted with 1 ml of water and extracted three times with chloroform. The combined chloroform extracts were dried, and the solvent was removed in vacuo to yield ca. 1.0 mg of lactonamycinone, which exhibited an HPLC retention time of 19 min under the same conditions used for analytical HPLC analysis of lactonamycin and lactonamycin Z. Nuclear magnetic resonance (NMR) analysis confirmed the assigned structure: 1H NMR (500 MHz, CDCl3,
values), 2.99 (1H, d, J = 17.0 Hz, H-3), 3.09 (1H, d, J = 17.0 Hz, H-3), 3.20 (3H, s, OCH3), 3.29 (3H, s, NCH3), 4.10 (1H, d, J = 9.6 Hz, H-5), 4.91 (1H, d, J = 9.6 Hz, H-5), 4.98 (2H, s, H-12), 7.31 (1H, s, H-8), 8.07 (1H, s, H-7), 9.36 (1H, s, very broad, C-9 OH), 13.70 (1H, s, broad, C-13 OH); 13C NMR (125 MHz, CDCl3), 29.2 (C-16, NCH3), 37.7 (C-3), 52.7 (C-15, OCH3), 55.0 (C-12), 73.8 (C-5), 82.6 (C-5a), 90.6 (C-14a), 109.4 (C-13a), 112.4 (C-3a), 112.9 (C-8), 116.6 (C-12b), 121.6 (C-7), 129.8 (C-6a), 141.8 (C-7a), 142.7 (C-12a), 157.4 (C-9), 164.0 (C-13), 168.9 (C-10), 170.6 (C-2), 189.5 (C-6), 192.2 (C-14). NMR spectral data for lactonamycinone have not been previously reported.
Inactivation of lactonamycin Z production by double-crossover disruption of the glycosyltransferase gene (lcz36).
Double-crossover disruption of the lactonamycin Z glycosyltransferase gene (lcz36) was carried out by using the lambda Red-mediated recombination methodology (15, 16). The PCR product required for disruption of the lcz36 gene was obtained by amplification of the 1,383-bp aac(3)IV-oriT sequence using pIJ773 as a template with primer pairs containing 39-nucleotide (nt) extensions derived from the 5' and 3' ends of the lcz36 gene. The forward and reverse primers were ZGLTF (5'-ATGTGTTCGCTCCGGGAAAAGGATTGGAGAGCATGGATGATTCCGGGGATCCGTCACC-3') and ZGLTR (5'-GGGAC CGGCCCGCCGACGCAGATGCCTGACGATTTGTCATGTAGGCTGGAGC TGCTTC-3', respectively, where the underlined portions show the 39-nt extensions). Electrocompetent cells of E. coli BW25113 (10) containing pIJ790 (Cmr) and the SuperCos1-derived cosmid pCAS2 (Carbr Kanr) containing lcz36 were prepared using the method of Gust et al. (15). The electrocompetent cells were transformed with purified PCR product using a Bio-Rad Gene Pulser II set at 200
, 25 µF, and 2.5 kV. The shocked cells were incubated in 1 ml of LB broth at 37 oC for 1 h and then selected on LB agar containing ampicillin (100 µg/ml), kanamycin (50 µg/ml), and apramycin (50 µg/ml). Transformants carrying the desired cosmid, pKOlcz36, were identified by restriction digestion of the isolated cosmids. Plasmid pKOlcz36 was then introduced into the nonmethylating E. coli ET12567 (27) containing the RP4 derivative pUZ8002 (36) and transferred into Streptomyces sanglieri AK 623 by intergeneric conjugation. For intergeneric conjugation, spores of Streptomyces sanglieri AK 623 were heat shocked at 50°C for 10 min, mixed with the E. coli cells prepared according to a standard protocol (24), and plated out on AS1 medium (1). After incubation at 30°C for 20 h, the plates were then overlaid with 3 ml of 0.7% soft tryptic soy agar containing 0.5 mg nalidixic acid and 1.25 mg apramycin. Incubation was then continued at 30°C for 5 to 7 days. Exconjugants were selected, and their antibiotic resistance was evaluated. Cosmid DNA was isolated from Kans Apr colonies, and the presence of the expected double-crossover disruption was verified by PCR amplification of the disrupted region using the following primer set: Flcz36 (5'-GGTCTTGTATCGGGAAAG-3') and Rlcz36 (5'-CCAGTACGGCAGTATGCG-3'). Sequencing of the PCR product (data not shown) and restriction digests of the amplified fragment (Fig. 2) confirmed the presence of the predicted disruption. In addition, genomic DNA was extracted from the
lcz36 disruptant, digested with BglII, and analyzed by Southern hybridization using a 916-bp probe amplified from the lcz36-lcz37 region of wild-type S. sanglieri using the following primer set: Lcz36F (5'-CGGTCACCTTCGCGTCCC-3') and Lcz36R (5'-CTCCCAGTTGCGGGCGAAG-3'). The hybridization pattern exhibited by the
lcz36 disruptant was completely consistent with the genetic alteration expected from the double-crossover disruption (Fig. 3). Fermentation of the
lcz36 disruptant and analysis of the combined organic extracts of the mycelium and fermentation broth by HPLC showed that lactonamycin Z production had been abolished. A small peak (compound X) that exhibited approximately the same retention time as the aglycone lactonamycinone was also present in the extracts, but mass spectrometry analysis indicated that compound X is not lactonamycinone (Fig. 4).
![]() View larger version (16K): [in a new window] |
FIG. 2. Verification of S. sanglieri lcz36 mutant by restriction digestion of PCR products from wild-type (WT) and mutant strains. B, BglII; X, XhoI.
|
![]() View larger version (19K): [in a new window] |
FIG. 3. Southern hybridization analysis of S. sanglieri lcz36 mutant and wild-type S. sanglieri (WT) using a 916-bp probe derived from lcz36 and lcz37. In the lcz36 mutant, lcz36 is replaced by the FLP recombination target (FRT)-aac(3)IV-oriT-FRT cassette from pIJ773. Bg, BglII.
|
![]() View larger version (13K): [in a new window] |
FIG. 4. HPLC analysis of fermentation broth from wild-type S. sanglieri (WT), the lcz36 mutant, and the complemented lcz36 mutant using HPLC conditions described in Materials and Methods. Z, lactonamycin Z; X, unknown.
|
lcz36, a derivative of the integrating plasmid pSET152 (5) was constructed. First, the thiostrepton resistance gene (tsr) from plasmid pIJ702 was amplified by PCR using the following forward and reverse primers: Tsr-XbaIF (AAAAATCTAGATCACTGACGAATCGAGGTCGAGGAAC) and Tsr-NheIR (AAAAAGCTAGCAGGCGAATACTTCATATGCGGGGATC, where the underlined bases correspond to XbaI and NheI sites, respectively). The resulting PCR fragment was digested with XbaI and NheI and then cloned into the NheI site of pSET152. A construct with the tsr gene in the same orientation as aac(3)IV of pSET152 was then identified by restriction digestion and designated pXZ152. The 0.45-kb ermEp* promoter cassette of plasmid pBS-VII-41F was PCR amplified using the following forward and reverse primers: ErmMfeI (5'-AAAAACAATTGAGCCCGACCCGAGCACGC-3') and ErmEcoRI (5'-AAAAAGAATTCCCATGGGGTCGCACCCACCGACGAC-3', where the underlined nucleotides correspond to MfeI and EcoRI sites, respectively).
The PCR product was digested with MfeI and EcoRI and then cloned into the EcoRI site of pXZ152. A construct with ermEp* promoter in the same orientation as the lacZ
gene of pSET152 was identified by restriction digestion and designated pOE152 (data and map not shown). To complement the
lcz36 mutant, the PCR primers 5'-AAAAAGAATTCATGAGAGTTCTGTTTGCT-3' and 5'-AAAAATCTAGATCAGGACCGGTGCCGGGC-3' were used to amplify the 1,284-bp lcz36 gene from S. sanglieri (EcoRI and XbaI sites of primers underlined). The purified PCR product was digested with EcoRI and XbaI and then cloned into the EcoRI-XbaI sites of pOE152 downstream of the ermEp* promoter, therefore generating the expression plasmid pOElcz36.
Complementation of the S. sanglieri AK 623
lcz36 mutant.
Plasmid pOElcz36 was introduced into E. coli ET12567/pUZ8002 and intergeneric conjugation was carried out with the
lcz36 mutant in the manner described above. Exconjugants were selected using thiostrepton at 50 µg/ml. The integration of pOElcz36 into the chromosome of mutant
lcz36 was verified by PCR (data not shown). Fermentation of S. sanglieri
lcz36 (pOElcz36) was carried out in the usual manner, and the combined organic extracts of the mycelium and fermentation broth were analyzed for the presence of lactonamycin Z by HPLC. The analysis showed that lactonamycin Z production had been restored (Fig. 4). This was confirmed by isolation and NMR characterization of lactonamycin Z from the complemented strain (data not shown). The level of lactonamycin Z production by the complemented strain was estimated to be ca. one-third that of the wild-type strain.
Administration of isotopically labeled precursors to S. sanglieri AK 623. Sterile S. sanglieri AK 623 culture medium (eight 200-ml portions) was inoculated with eight 10-ml samples of a 48-h culture of S. sanglieri grown under standard conditions. After incubation at 27°C, 120 rpm, for 48 h, a filter-sterilized aqueous solution containing 1.0 g of the labeled precursor was distributed equally to each of the eight shaking flasks, and the fermentation was allowed to continue for an additional 48 h. At the end of this time, lactonamycin Z was isolated from the fermentation broth by preparative HPLC as described above. All precursors were 99% enriched with 13C. The [2-13C, 15N]glycine was 98% enriched with 15N.
Nucleotide sequence accession numbers. The nucleotide sequences were deposited in the GenBank database and given accession numbers EU147298 and EU147299.
|
|
|---|
-lactam ring of lactonamycinone is derived from the nitrogen atom of glycine. In addition to labeling some of the carbon atoms of the
-lactam ring, both [1,2-13C2]- and [2-13C, 15N]glycine led to efficient labeling of the O-methyl and N-methyl groups of the aglycone (C-15 and C-16). However, no labeling of the O- and N-methyl groups was observed when [1-13C]glycine was administered to the fermentation. Labeling of the O-methyl and N-methyl groups by [1,2-13C2]- and [2-13C, 15N]glycine can be explained if C-2 of glycine is entering the C1 pool via metabolism of the labeled amino acid by the glycine cleavage system. The glycine cleavage system is a multienzyme complex composed of four proteins that catalyzes the oxidative decarboxylation of glycine to carbon dioxide, ammonia, and a C1 unit that is incorporated into 5,10-methylenetetrahydrofolate (34, 35). A hypothetical biosynthetic pathway for lactonamycinone based upon the results of the precursor incorporation experiments is shown in Fig. 5. In this pathway, the postulated formation of the 1,2-cis diol moiety of lactonamycinone by the formal cis ring opening of an epoxide is based upon an analogous process in TcmC biosynthesis (37), while the timing for formation of the
-lactam ring of lactonamycinone is arbitrarily shown to occur at a late stage in the pathway. |
View this table: [in a new window] |
TABLE 2. Incorporation of labeled precursors into lactonamycin Z
|
![]() View larger version (19K): [in a new window] |
FIG. 5. Hypothetical biosynthetic pathway for lactonamycinone.
|
DNA sequence analysis of lactonamycin cluster from S. rishiriensis. Sequencing a total of ca. 61 kb of DNA contained within cosmids pCSR5, pCSR8, and pCSR13 revealed the presence of 57 open reading frames (ORFs) (Fig. 6). The 57 sequenced genes and the actual or putative functions assigned to them are listed in Table 3. The borders of the lct cluster could not be defined by gene disruption experiments, since lactonamycin production could not be sustained in our laboratory. However, tentative borders can be assigned on the basis of the sequence analysis. The upstream end of the lct cluster probably begins with the 4'-phosphopantetheinyltransferase homolog lct8, since the upstream ORF (orf7) exhibits strong similarities to S-adenosylmethionine decarboxylase, an enzyme that is unlikely to be required for the lactonamycin biosynthetic pathway. The downstream border of the lct cluster is probably defined by orf57, which exhibits the signature of a transposase. The genes contained within the region from lct8 to lct56 can be divided into five groups as follows.
![]() View larger version (14K): [in a new window] |
FIG. 6. Genetic organization of the lct gene cluster from S. rishiriensis and the partial lcz gene cluster from S. sanglieri.
|
|
View this table: [in a new window] |
TABLE 3. Organization and analysis of lactonamycin gene cluster from S. rishiriensis
|
), Lct32 (KSβ), and Lct24 (acyl carrier protein [ACP]). Lct31 and Lct32 exhibit 69% and 64% identity to TcmK and TcmL, respectively, the KS
and KSβ from the TcmC biosynthetic gene cluster, respectively (19). Lct31 contains the highly conserved sequence STGCTSGLD that is found around the ketosynthase active site cysteine residue (55). The lct cluster appears to encode two ACPs, Lct24 and Lct26. Neither resides in close proximity to the ketosynthase components of the minimal PKS. Lct24 exhibits 52% identity to the PKS ACP Sim4 from the simocyclinone gene cluster as well as a high degree of similarity to ACPs from other type II PKS gene clusters. These similarities suggest that Lct24 is part of the lactonamycin minimal PKS. Lct26 exhibits the highest degree of similarity to ACPs from Rhodopseudomonas and Thermoanaerobacter sp. It is conceivable that Lct26 plays a role in the loading of glycine or a glycine derivative onto Lct31 (see Discussion). Both ACPs display the conserved LG(x)DS motif containing the serine residue that is the attachment site for a 4'-phosphopantetheine prosthetic group (21). The lct8 gene appears to encode a 4'-phosphopantetheinyltransferase. The function of this enzyme may be to convert Lct24 and Lct26 from the apo form to the holo form. Three putative polyketide cyclases, Lct27, Lct29, and Lct30, reside within the lct cluster. Lct27 exhibits 59% identity to FdmI, a cyclase from the fredericamycin gene cluster (55). Lct27 also shows high similarity to the N-terminal cyclase domain of the bifunctional protein TcmN from the Tcm cluster (50). Lct27 may catalyze cyclizations leading to the formation of an anthrone intermediate resembling TcmF2 (Fig. 5). Lct29 exhibits 43% identity to the cyclase TcmI (46), suggesting that Lct29 probably catalyzes a cyclization leading to an intermediate similar to TcmF1. Lct30 displays 49% identity to TcmJ. TcmJ has been shown to increase the production of TcmF2 in vitro, although the mode of action of TcmJ is unclear (2). An unusual feature of the lct cluster is the presence of the Lct34 thioesterase. Thioesterases are commonly found in type I PKS gene clusters and nonribosomal peptide gene clusters, but they are only rarely associated with type II PKS genes. A thioesterase gene has been reported to occur in a type II PKS gene cluster that resides on the linear pSLA2-L plasmid of Streptomyces rochei (32).
(ii) Genes encoding tailoring enzymes or proteins of unknown function.
The lactonamycin cluster encodes a relatively large number of oxygenases and oxidoreductases. Potential functions can be assigned to only two of the oxygenases. Lct41 displays 46% identity to TcmG and 46% identity to ElmG. The latter enzymes have been shown to catalyze the triple hydroxylation of TcmA2 to TcmC, a reaction leading to formation of a cis-1,2-diol function (37, 47, 54). Lct41 may be involved in the formation of the similar cis-1,2-diol moiety found in lactonamycin. Lct33 and Lct42 exhibit strong similarities to TcmH, a monooxygenase that catalyzes the oxidation of the naphthacenone TcmF1 to the naphthacenequinone TcmD3 (45). Structure determination of the related enzyme ActVA-ORF6 led to the characterization of an "antibiotic biosynthesis monooxygenase" (ABM) domain found in this family of proteins and the identification of three active site residues (Asn, Trp, and Arg) (42). Both Lct33 and Lct42 exhibit many of the conserved residues displayed by the ABM domain, but only Lct33 contains all three active site residues. This suggests that Lct33 plays a role in lactonamycin biosynthesis similar to that of TcmH in TcmC biosynthesis, while the function of Lct42 is unclear. An additional oxidative enzyme is encoded by lct10, whose translation product exhibits strong similarities to cytochrome P450 enzymes. Since lct10 is situated between genes that appear to be involved in the biosynthesis and binding of a
-butyrolactone autoregulator, it is likely that lct10 plays a role in the biosynthesis of a
-butyrolactone. The lct cluster contains one glycosyltransferase, Lct36. Lct36 is presumed to catalyze the attachment of L-rhodinose to lactonamycinone.
Two genes encoding methyltransferases are present in the lct cluster. Lct25 aligns with the C-terminal methyltransferase domain of the bifunctional protein TcmN. TcmN methylates the C-11 phenolic hydroxyl group of TcmD3 (44). It is possible that Lct25 methylates the C-13 hydroxyl group of a TcmD3 analog on the pathway to lactonamycin. The second methyltransferase is Lct35. This protein shows 50% identity to TcmO, an enzyme that methylates the C-3 phenolic hydroxyl of TcmB3 (50). Since the corresponding C-3 hydroxyl group of lactonamycin is unmethylated, it is possible that Lct35 is required for formation of the N-methyl group of lactonamycin.
Eight additional ORFs within the lct cluster encode proteins whose functions cannot be predicted from sequence analysis. The translation product of the lct16 gene exhibits strong similarity to FAD-dependent monooxygenases that catalyze the hydroxylation of aromatic rings, while lct40 and lct43 encode oxidoreductases. All three of these genes might play a role in the formation of the lactonamycin E/F ring system. The protein encoded by lct28 shows high similarity to acyl coenzyme A (acyl-CoA) synthetases and carboxylic acid adenylation enzymes. Because of the specific incorporation of glycine into lactonamycin Z, it is conceivable that Lct28 might transform glycine or a glycine derivative into the corresponding adenylate for use as the starter unit in polyketide assembly (see Discussion). Lct37 and Lct51 exhibit similarities to ester cyclases, while Lct55 exhibits high similarity to a family of membrane-bound acyltransferases. Last, Lct53 appears to encode an acyl CoA decarboxylase. No clear function can be assigned to any of these proteins.
(iii) Genes encoding enzymes for NDP-L-rhodinose biosynthesis. Lactonamycin contains an L-rhodinose moiety, which is attached to the C-5a hydroxyl group of the aglycone. Investigations of the biosynthesis of the aromatic polyketide urdamycin have identified seven genes that are required for NDP-L-rhodinose biosynthesis in Streptomyces fradiae (17). Homologs of each of these genes are present in the lactonamycin gene cluster (Table 3). The potential roles played by these genes in the formation of NDP-L-rhodinose are shown in Fig. 7.
![]() View larger version (10K): [in a new window] |
FIG. 7. Potential role played by lactonamycin genes in biosynthesis of NDP-L-rhodinose.
|
-butyrolactone signaling molecule. A similar function would be anticipated for Lct13. The role assigned to Lct13 is supported by the fact that the proteins encoded by lct9, lct11, and lct12 exhibit strong similarities to proteins required for
-butyrolactone biosynthesis (22, 23). Both Lct15 and TylS show strong similarities to the family of activator proteins, such as ActII-ORF4 and DnrI that are known as SARPs (Streptomyces antibiotic regulatory proteins) (56). The lct gene cluster contains two genes whose encoded proteins might provide S. rishiriensis with lactonamycin resistance. The first of these proteins is Lct38, which appears to be a member of the major facilitator superfamily of membrane efflux proteins. A protein in this superfamily has been found to confer resistance to the azoxy antibiotic valanimycin on the producing organism, Streptomyces viridifaciens (26). The second candidate for a lactonamycin resistance protein is encoded by lct56. Lct56 exhibits high similarity to rRNA methyltransferases. Methylation of specific 23 S rRNA nucleotides is a well-established mechanism for bacterial resistance to macrolide antibiotics (12).
(v) Genes encoding proteins associated with primary metabolism. There are four genes embedded within the lct cluster that encode proteins associated with primary metabolism. The proteins encoded by these genes, Lct18, Lct19, Lct20, and Lct52, exhibit high similarities to proteins that are required to regenerate S-adenosyl-L-methionine (AdoMet) from S-adenosylhomocysteine after the transfer of a methyl group from AdoMet. The function of these genes is presumably to supply AdoMet to the methyltransferases Lct25 and Lct35. A similar set of AdoMet biosynthetic genes has been found within the biosynthetic gene cluster of the type I polyketide antibiotic lankamycin (32).
Cloning of the lactonamycin Z biosynthetic gene cluster from S. sanglieri. Investigations with the lactonamycin producer S. rishiriensis revealed that consistent production of lactonamycin could not be maintained. Fermentations derived either from S. rishiriensis spore stocks stored at –80°C or from lyophilized spore stocks gave erratic results. Furthermore, lactonamycin production levels were negatively affected by protoplast formation and by the manipulations required to produce exconjugants. Consequently, investigations of S. sanglieri AK 623 were commenced. The production of lactonamycin Z by this organism was found to be more robust than the production of lactonamycin by S. rishiriensis. Southern hybridization of the genomic DNA of the S. sanglieri AK 623 with probes derived from the lct33, lct36, and lct53 genes showed that unique homologs of these genes exist in S. sanglieri AK 623, suggesting the existence of a similar gene cluster for lactonamycin Z (data not shown). Therefore, the lct36 gene of S. rishiriensis was amplified by PCR, labeled with 32P, and used to screen S. sanglieri cosmid libraries constructed in pOJ446 and SuperCos1. A total of 38 positive pOJ446-derived cosmids and 17 positive SuperCos1-derived cosmids were isolated. One pOJ446-derived cosmid, pCAK7, was initially chosen for sequencing, since it also exhibited strong hybridization to probes derived from the lct33 and lct53 genes (data not shown). Sequencing of ca. 13 kb of DNA from the insert in cosmid pCAK7 disclosed the presence of 15 ORFs. These ORFs are listed in Table 4. All 15 ORFs in the sequenced region of S. sanglieri DNA exhibit high similarities of genes found in the lct cluster. Furthermore, the organization of these genes is identical to that found in the lct cluster. These findings provide strong evidence that both the S. rishiriensis and S. sanglieri clusters are involved in the production of similar metabolites. The functions of the 15 lcz genes are expected to be similar or identical to those of the corresponding lct genes.
|
View this table: [in a new window] |
TABLE 4. Organization and analysis of partial lactonamycin Z gene cluster from S. sanglieri AK 623
|
lcz36 mutant was cultured under standard conditions, and the combined organic extracts of the broth and mycelium were analyzed by HPLC. The HPLC analysis (Fig. 4) showed the absence of lactonamycin Z. A complementation construct, pOElcz36, was generated by placing the ermEp* promoter in front of the lcz36 gene cloned into plasmid pXZ152. Plasmid pXZ152 was derived from the integrating plasmid pSET152 by introduction of the thiostrepton resistance gene of pIJ702. The complementation construct was introduced into the
lcz36 mutant by intergeneric conjugation. Restoration of lactonamycin Z production was confirmed by HPLC analysis (Fig. 4) and by isolation and NMR characterization of lactonamycin Z from the complemented strain (data not shown). |
|
|---|
Important insights into the biosynthesis of the aglycone core, lactonamycinone, were obtained from precursor incorporation experiments. Administration of sodium [1-13C]-, [2-13C]-, and [1,2-13C2]acetate to S. sanglieri produced labeling patterns that are consistent with the head-to-tail incorporation of nine acetate units into lactonamycinone (Table 2). The 13C-labeling pattern observed for rings E and F of lactonamycinone derived from the labeled forms of acetate can be rationalized by the oxidative cleavage of ring D of a napthacenequinone intermediate similar to TcmD3 (Fig. 5). Most significantly, no labeling of C-12 and C-12a was produced in any of these incorporation experiments. This observation suggested that the polyketide assembly process is initiated by use of an alternative starter unit. This hypothesis was confirmed by administration of [1,2-13C2]-, [1-13C]-, and [2-13C, 15N]glycine to S. sanglieri. The labeling patterns observed in lactonamycin Z derived from these precursors indicate that the nitrogen atom and both carbon atoms of glycine serve as the source of the polyketide starter unit (Table 2). The use of alternate starter units in type II aromatic polyketide assembly is rare, but not unprecedented. For example, propionate is used as the starter unit for daunorubicin biosynthesis in S. peucetius (3, 39), several short-chain carboxylic acids serve as starter units for the anthroquinones R1128A-D produced by Streptomyces sp. strain R1128 (28), and benzoate functions as the starter unit for enterocin in Streptomyces maritimus (20). The mechanism involved in the incorporation of alternative starter units varies in each of these examples (33). The lactonamycin and lactonamycin Z gene clusters exhibit several novel features that may provide a clue to the mechanism of glycine incorporation. One of these features is the presence of genes (lct28 and lcz28) that encode a protein with high similarities to acyl-CoA synthetases and carboxyl adenylation enzymes. Recent studies have identified the amino acid residues that determine the substrate specificity of enzymes or domains that catalyze the adenylation of
-amino acids (8, 48). Analysis of Lct28 and Lcz28 reveals that the specificity codes for these proteins are DLFVLCLL and DLFILCLL, respectively. Since the consensus specificity code for glycine is DILQ(L/V)G(L/M/V)I (9, 31), it appears unlikely that glycine serves as a substrate for either Lct28 or Lcz28. An alternative substrate could be sarcosine (N-methylglycine), for which a specificity code has not been clearly defined. Another novel feature of the lct and lcz gene clusters is the presence of two genes in each cluster that encode ACPs. Of these ACPs, only Lct24 and Lcz24 exhibit strong similarity to the ACPs of other type II PKSs. This suggests that the other ACPs, Lct26 and Lcz26, may play a role in the initiation of lactonamycinone biosynthesis with a glycine derivative. This hypothesis is supported by the fact that both the R1128 and frenolicin gene clusters contain an additional ACP that functions to initiate polyketide synthesis with an alternative starter unit (52). Therefore, it appears that initial stages of lactonamycinone biosynthesis may involve activation of a glycine derivative by Lct28 or Lcz28, attachment of the activated amino acid to Lct26 or Lcz26 as a thioester, and transfer of the amino acid from Lct26 or Lcz26 to the ketosynthase Lct31 or Lcz31 by thioester exchange.
A third unusual feature of the lactonamycin gene clusters is the presence of a thioesterase (Lct34 and Lcz34) in each cluster. Although thioesterase domains and stand-alone thioesterases are often found in association with type I polyketide synthases, the occurrence of thioesterases within type II polyketide gene clusters is very rare (32). Recent studies of the acyltransferase homolog ZhuC found within the R1128 PKS have shown that ZhuC exhibits thioesterase activity and selectively hydrolyzes acetyl-ACPs formed by malonyl-ACP decarboxylation (51). ZhuC therefore appears to function as an editing enzyme to remove acetate starter units that might otherwise compete with the alkyl acyl starter units. Investigations by Bisang et al. (6) have shown that the decarboxylation of malonyl-ACPs is catalyzed by the KSβ (chain length factor) of the minimal PKS and to a lesser extent by the KS
. The ability of the KSβ protein to catalyze malonyl-ACP decarboxylation is dependent upon the presence of a conserved glutamine residue. It appears likely that the KSβ proteins in the lct and lcz clusters can catalyze malonyl-ACP decarboxylation, since the conserved glutamine residue is present in the amino acid sequences of both proteins. For this reason, it is conceivable that the thioesterase encoded in each cluster may function in a similar manner to ZhuC in order to prevent initiation of lactonamycinone biosynthesis with acetate. Additional investigations will clearly be required to elucidate the details of glycine incorporation into lactonamycinone.
Thanks are also due to Ben Shen for plasmid pBS-VII-41F, Tomio Takeuchi for a culture of S. rishiriensis, and S. Yates and X. Qian for assistance with mass spectral measurements. We also acknowledge Youlin Xia for 800-MHz NMR spectra obtained at the University of Houston.
Published ahead of print on 10 December 2007. ![]()
Supplemental material for this article may be found at http://aac.asm.org/. ![]()
|
|
|---|
-butyrolactone autoregulators that switch on secondary metabolism and morphological development in Streptomyces. Proc. Natl. Acad. Sci. USA 104:2378-2383.
E is required for normal cell wall structure in Streptomyces coelicolor A3(2). J. Bacteriol. 181:204-211.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»