Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, April 2008, p. 1419-1429, Vol. 52, No. 4
0066-4804/08/$08.00+0 doi:10.1128/AAC.00525-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Departments of Virology,1 Chemistry,2 High-Throughput Screening, Rigel Pharmaceuticals, Inc., 1180 Veterans Boulevard, South San Francisco, California 940803
Received 20 April 2007/ Returned for modification 1 June 2007/ Accepted 14 December 2007
|
|
|---|
) at blocking HCV RNA replication in the replicon model. In combination studies, R803 showed a weak synergistic effect with IFN-
/ribavirin but only additive effects with a protease inhibitor and an allosteric inhibitor of RNA-dependent RNA polymerase (20). We conclude that R803 and related heterocyclic compounds constitute a new class of HCV-specific inhibitors that could potentially be developed as a treatment for HCV infection. |
|
|---|
30,000 cases of new infection each year in the United States alone (1, 2, 46). No vaccine is currently available to prevent HCV infection. The standard treatment for HCV infection, a combination of pegylated alpha interferon (IFN-
) and ribavirin (RBV), is limited by its suboptimal response rate in a significant patient population, side effects, and affordability (11). Thus, it is critical to discover highly effective, safer therapies to improve the clinical management of HCV infection.
HCV is an enveloped RNA virus belonging to the family Flaviviridae (9). HCV clinical isolates display high heterogeneity in their genomic RNA and amino acid sequences, and they are classified into six genotypes and numerous subtypes (49). It is documented that infections by different genotypes may produce different clinical outcomes and may respond differently to IFN-
-based antiviral treatment (for a review, see reference 11). Significantly, patients infected with genotype 1 viruses, which account for approximately 70% of HCV infections in the United States, exhibit poor rates of response to the IFN-
-based treatment. An ideal antiviral should, therefore, be effective against the majority, if not all, of the HCV genotypes.
Upon entering the host cell, HCV releases its 9.6-kb genomic RNA into the cytoplasm, where it directs the translation of a single polyprotein of about 3,000 amino acids. The giant polyprotein is cotranslationally processed by host and viral proteases into structural proteins (core, E1, and E2) and nonstructural proteins (P7, NS2, NS3, NS4a, NS4b, NS5a, and NS5b). The mature nonstructural proteins (except P7 and NS2) and host factors assemble into membrane-associated RNA replication complexes, where a vast quantity of progeny viral RNA molecules are amplified from the incoming HCV genomic RNA (14, 18, 35). Although all the steps in the HCV life cycle can be targeted for drug discovery against HCV, the viral nonstructural proteins, specifically NS3 and NS5b, which encode well-defined enzymatic activities crucial for viral replication, are the major targets for antiviral discovery (10, 53). However, the replication of HCV viral RNA by the viral replication complex is quickly becoming another focus for drug discovery with the development of the HCV replicon system.
Until the establishment of HCV replicons, the analysis of HCV replication was hampered due to the lack of a robust HCV cell culture system (5, 38). The first-generation HCV replicons are human hepatoma Huh-7 cell lines carrying engineered genotype 1b subgenomic RNA with the following genome organization: HCV 5' nontranslated region (5' NTR)-neomycin phosphotransferase (NPT) gene (also referred to as the neomycin resistance [Neor] gene)-encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES)-HCV NS3-4a-4b-5a-5b-HCV 3' NTR. Subsequent studies have shown that the efficiency of replicon establishment can be enhanced substantially by incorporating cell culture-adaptive mutations, especially those in NS3 and NS5a (5, 26, 37, 38). The HCV replicon system has been an effective tool for studying viral RNA replication and virus-host interactions. It also serves as an important cell-based system with which to evaluate antiviral drugs and to reveal drug resistance mechanisms (for a review, see reference 4). Moreover, the HCV replicon presents a unique drug-screening system, allowing for the screening of compounds inhibiting the viral enzymes as well as other targets of the HCV RNA replication process in a cellular environment. Such screens would perhaps facilitate the discovery of inhibitors that block the functions of NS4b and NS5a or interrupt virus-host interactions, discoveries that cannot be readily achieved with biochemical screens. Several efforts have already been made to screen small-molecule compound libraries against different versions of the HCV replicon system (17, 47, 50, 55). Here we describe the development of an HCV replicon assay for high-throughput screening and the characterization of one of the heterocyclic hits from screens of a 230,000-member chemical library. We show that the lead compound of this hit scaffold is effective at inhibiting HCV replicons of different genotypes and can enhance the inhibitory activity of IFN-
in the replicon model.
|
|
|---|
Modification of HCV replicons. Total RNA was extracted from replicon 5-2Luc (26) and was used as a template for reverse transcription-PCR (RT-PCR) of the replicon genome using primers GAATTGGAATCGATATTGTTACAACACCCC and GTGGTCTGTTTAACGCGGCCGCTCAGAAGAAC. The RT-PCR product was cleaned and digested with restriction enzymes ClaI and NotI. The resulting 1.3-kb fragment, which contains part of the firefly luciferase gene (Luc), ubiquitin, and the NPT (Neor) gene, was gel purified. Meanwhile, plasmid pFK I341PI Luc NS3-3'/ET (36) was also digested with the restriction enzymes ClaI and NotI, and the 12.2-kb fragment was gel purified. The two DNA fragments were ligated together to generate replicon plasmid pFK I341-pI-Luc-ubi-NPT-EI-NS3-3'-UTR (referred to below as PLN). Using a similar procedure, the NS2 coding sequence was inserted between EI and NS3 of plasmid PLN to generate PLNCP, a NS2-containing replicon construct. The PLN or PLNCP plasmid was linearized with the ScaI restriction enzyme and subjected to in vitro transcription using the RiboMAX Large Scale RNA Production System-T7 (Promega, Madison, WI). After DNase I digestion and purification, the transcribed RNA (5 µg) was electroporated into Huh-7 cells as reported previously (38). The cells were then transferred to a 15-cm-diameter culture dish with Huh-7 medium (40 ml) containing 500 µg/ml G418 for selection. Colonies of surviving cells were isolated and tested for luciferase expression and viral replication. Replicon cell clones PLN5 (derived from PLN) and PLNCP54 (derived from PLNCP) expressed high luciferase activity and were expanded and used in the experiments. In addition, replicons 9-13 (38) and Huh-mono (22) from Ralf Bartenschlager were also used throughout this study.
High-throughput replicon assay. PLN5 or PLNCP54 replicon cells were plated at a density of 3,000/45 µl of Huh-7 medium/well onto 384-well plates and were incubated at 37°C under 5% CO2 for 24 h. Compounds (5 µl of 0.1 mM stock) were transferred to each well, and following 24 h of compound incubation at 37°C under 5% CO2, the culture medium and the compounds were removed, and 50% Bright-Glo solution (25 µl; Promega, Madison, WI) was added to each well. The plates were placed on a shaker at room temperature for 5 min, and luciferase activity was measured with a FLUOstar plate reader. The inhibitory effect of a hit compound was scored by comparing the luciferase activity of a compound-treated well with that of dimethyl sulfoxide (DMSO)-treated control wells.
TaqMan RT-PCR. The HCV primers and probe were designed with Primer Express software (Perkin-Elmer Applied Biosystems) and covered highly conserved 5' untranslated region sequences (sense primer, 5'-TGCGGAACCGGTGAGTACA-3'; antisense primer, 5'-CGGGTTGATCCAAGAAAGGA-3'; probe, 5'-6-carboxyfluorescein-CGGAATTGCCAGGACGACCGG-6-carboxytetramethylrhodamine-3'). Replicon 9-13 or PLNCP54 cells were plated at a density of approximately 5,000 per 90 µl per well onto a 96-well plate, and a mixture containing 90% of the Huh-7 medium, 7.2% 1x phosphate-buffered saline (PBS), 1.8% methanol, 1% DMSO, and varying concentrations of R803 or R706 (each in triplicate) was added to the cells 24 h after plating. Forty-eight hours after compound addition, total RNA was isolated from each sample using the RNeasy 96 kit (Qiagen, Valencia, CA). Replicon RNA and cellular glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA were amplified by a protocol modified from a published method (25) using the ABI Prism 7700 system (Perkin-Elmer Applied Biosystems, Foster City, CA). The 50% effective concentration (EC50) of the test compound was calculated by plotting the HCV RNA titer (normalized to the endogenous GAPDH mRNA level) against the compound concentrations.
Western blotting. Replicon 9-13 or PLNCP54 cells, plated onto 6-well plates, were treated with DMSO or a test compound for 48 h. The cells were washed with PBS and lysed in 1x sodium dodecyl sulfate (SDS) sample buffer, and the lysates were analyzed with the NuPage gel system (Invitrogen, Carlsbad, CA). The gel was blotted onto a nitrocellulose membrane, probed with a monoclonal anti-HCV NS3 antibody (Rigel, South San Francisco, CA) and a monoclonal antitubulin antibody (Sigma-Aldrich, St. Louis, MO), and then incubated with a horseradish peroxidase-conjugated secondary antibody. NS3 and cellular β-tubulin were detected by developing the membrane with a SuperSignal WestDura kit (Pierce, Rockford, IL).
BVDV and YFV assays. The activities of antiviral compounds were measured by their abilities to inhibit bovine viral diarrhea virus (BVDV)- or yellow fever virus (YFV)-induced cytopathic effects (CPE). BVDV (strain NADL; ATCC) was grown in Madin-Darby bovine kidney (MDBK) epithelial cells, and YFV (strain 17D; ATCC) was grown in Vero cells. Cells were plated at 1 x 104/well in 96-well plates. After overnight incubation at 37°C under 5% CO2, the culture medium was removed and a pretitered aliquot of virus (sufficient to cause complete cell killing at the time of maximal CPE development [100% tissue culture infective dose]) was added to each well. Immediately following infection with the virus, a DMSO control or increasing doses of R803 were added. At the end of the infection assay, cell viability was determined using CellTiter 96 reagent (Promega, Madison, WI) on a VMax plate reader (Molecular Devices, Sunnyvale, CA). The drug concentration that reduced the virus-induced CPE by 50% (EC50) and the concentration that caused a 50% reduction in cell numbers in the absence of virus infection (CC50) were calculated.
PV-Luc replicon assay. Plasmid PV-Luc (32) was linearized with the PvuI restriction enzyme and subjected to in vitro transcription using the RiboMAX Large Scale RNA Production System-T7 (Promega, Madison, WI). After DNase I digestion and purification, the transcribed RNA (5 µg) was electroporated into Huh-7 cells at 270 V and 950 µF on a Gene Pulser II system according to the manufacturer's specifications (Bio-Rad). The cells were then dispensed into white 96-well plates at a density of 10,000/90 µl/well. R803 was serially diluted in compound diluent (10% DMSO, 20% methanol) and added to each well in a volume of 10 µl. The plates were incubated for 18 h at 37°C under 5% CO2 before luciferase activity was determined using the Bright-Glo luciferase assay kit (Promega, Madison, WI).
Compound and/or IFN-
treatment.
Replicon 9-13 cells were plated onto 6-well plates 24 h prior to the treatment. Serial dilutions of R803 were made in a mixture containing 90% of the culture medium, 7.2% 1x PBS, 1.8% methanol, 1% DMSO, 20 µM RBV, and varying concentrations of IFN-
for a fixed-ratio dose-response study. The cells were treated with the designated combinations of R803 (0 to 80 nM concentrations) and IFN-
(0 to 4 IU/ml) plus 20 µM RBV for 72 h; then they were washed with PBS, lysed in SDS loading buffer, and analyzed by Western blotting as described above.
HCV IRES IVT assay. Plasmid pT7-RL-HCV IRES-FL was linearized via restriction enzyme and transcribed using the Message Machine kit (Ambion, Inc., Austin, TX) to produce dicistronic RNAs that translate Renilla luciferase in a cap-dependent manner and firefly luciferase under the control of the HCV IRES (genotype 1b). In vitro translation (IVT) reaction mixtures (25 µl) were assembled by mixing TnT kit components according to the manufacturer's instructions (Promega, Madison, WI) with the addition of 2 µl of 0.01 mg/ml dicistronic RNA and 1 µl of R803 at various concentrations dissolved in DMSO. Reaction mixtures were incubated for 1 h at 30°C and analyzed using the Dual Luciferase reporter assay kit (Promega, Madison, WI). Luciferase activities were measured on a Luminoskan Ascent luminometer (Thermo Systems, Waltham, MA) and reported as the ratio of firefly (HCV IRES) to Renilla (cap) luciferase counts.
NS2-3 IVT assay. A pET-24b vector encoding NS2-3 (amino acids 94 to 217 of NS2 and 1 to 181 of NS3, genotype 1a; generously provided by Charlie Rice) was used to program 25-µl rabbit reticulolysate reactions (TnT kit; Promega, Madison, WI). The reaction conditions of kit components were those recommended by the manufacturer, but they were further supplemented with 20 µM ZnCl2, 9 µCi Redivue [35S]methionine (GE Healthcare, Chicago, IL), and 1 µl of R803 at various concentrations dissolved in DMSO. Reaction mixtures were incubated for 3.5 h at 30°C, reactions were halted by addition of 4 volumes of SDS loading buffer, and products were subjected to NuPage gel (10%) analysis. The gel was then dried and exposed to a phosphorimaging plate, and the phosphorimaging plate was imaged using a Typhoon 9410 imager (Molecular Dynamics, Sunnyvale, CA). Bands corresponding to NS2-3, NS3, and NS2 were quantified by using ImageQuant 5.2 software in order to calculate the extent of proteolytic processing as a percentage of total translated NS2-3.
Biochemical assays for NS3-4aprotease, NS3NTPase, and NS5bRdRp.
His-tagged viral enzymes were cloned into the pET vector system (EMD Chemicals, San Diego, CA), expressed, and purified according to the manufacturer's instructions. NS3-4aprotease was assayed by its ability to cleave a fluorogenic substrate (catalog no. M-2235; Bachem, Torrance, CA) using a reaction condition modified from a published method (23). The nucleoside triphosphatase (NTPase) assay was performed in 96-well plates using a malachite green reagent as previously described (30). Briefly, in a 25-µl assay volume, 5 µl of R803 dissolved in 20% DMSO was mixed with 5 pmol of NS3, 2.5 mM poly(U), 200 mM HEPES (pH 7.4), 3 mM MgCl2, 2 mM dithiothreitol, and 100 µg/ml bovine serum albumin for 5 min at 25°C. The reaction was initiated by adding 2.5 mM ATP to the mixture, followed by a 30-min incubation at 25°C. The reaction was terminated with the addition of 100 µl of malachite green solution (0.034% malachite green, 1.05% ammonium molybdate, and 0.04% Tween 20) and 100 µl of 34% sodium citrate. Color development was allowed for 15 min at 25°C, and A630 was measured on a plate reader. The amount of NTP hydrolyzed was then calculated from an inorganic phosphate standard curve. For the NS3helicase unwinding assay, the DNA "trap" oligomer (5'-GCCTCGCTGCCGTCGCCA-3'OH) was radiolabeled using [
-32P]ATP and polynucleotide kinase (New England Biolabs, Beverly, MA) and then annealed to the unlabeled DNA ("long") oligomer (5'-TGGCGACGGCAGCGAGGCTTTTTTTTTTTTTTTTTTTT-3'OH) to generate a heteroduplex unwinding substrate. Reaction mixtures (20 µl) containing 1 nM heteroduplex DNA, 50 to 200 nM NS3helicase (amino acids 166 to 632 of NS3), 5 mM HEPES (pH 7.4), 3.75 mM MgCl2, 125 µg/ml bovine serum albumin, 1.25 mM dithiothreitol, and 1 µl of varying concentrations of R803 diluted in DMSO were preincubated for 15 min at room temperature. The unwinding reaction was initiated by adding 5 µl of 40 mM ATP, mixing, and incubating the reaction mixtures for 10 min at 37°C. Reactions were terminated using 6.3 µl 5x stop buffer (250 mM Tris-HCl [pH 7.5], 20 mM EDTA, 0.5% SDS, 0.1% NP-40, 0.1% bromophenol blue, 0.1% xylene cyanol, 50% glycerol, 250 nM unlabeled "trap" oligomer). Analysis of reaction samples consisted of electrophoresis through a 20% polyacrylamide-1x Tris-borate-EDTA (TBE) gel at 250 V for 60 min, exposure to a phosphorimaging plate, and visualization using a Typhoon 9410 imager. The resulting image was quantified with ImageQuant software (version 5.2). To assay NS5bRdRp (RNA-dependent RNA polymerase), a 427-base HCV 3' NTR RNA was generated by in vitro transcription and was used as an RNA template. Threefold serial dilutions of R803 were prepared in DMSO, and 1 µl of each dilution was added to a 12.5-µl mixture containing 40 mM Tris-Cl (pH 7.5), 50 mM KCl, 5 mM MgCl2, and 20 nM NS5b, followed by a 5-min preincubation. The reaction was then initiated by adding a mixture of the RNA template with NTPs (5 nM RNA, 5 mM [each] ATP, GTP, and CTP, 2 µM UTP, and 0.1 µl [
-33P]UTP [GE Healthcare, Chicago, IL]). The reaction mixture was incubated at 25°C for 2 h; then the reaction was terminated with 25 µl of 2x TBE-urea sample buffer, and the product was heated at 70°C for 5 min. One-fifth of the RNA products were separated by electrophoresis on a 6% TBE-urea gel (Invitrogen, Carlsbad, CA). The labeled RNA products were analyzed using a Typhoon 9410 imager as described above.
Transient transfection and VTF-T7 infection (TTI) assay. HEK 293 cells were seeded at a density of 4 x 105/well in 2 ml of DMEM supplemented with 10% fetal calf serum and 2 mM L-glutamine. The following day, 25 µM chloroquine was added to the culture, and cells were transfected with 2 µg of plasmid pPLNCP or pHuh-mono (both contained a T7 promoter) using the calcium phosphate "bubble" precipitation method. Briefly, a transfection cocktail was prepared by mixing 2 µg of DNA, 130 µl of H2O, and 20 µl of 2 M CaCl2. A 150-µl aliquot of 2x Hepes buffered saline (HBS) (pH 7.0 to 7.1) was added to the cocktail by bubbling with a pipette immediately for 5 to 10 s, and the cells were transfected by gently agitating the solution with the medium. Approximately 3 h after the transfection, the medium was replaced with fresh DMEM, and VTF-T7 virus (ATCC) was added to the cells at a multiplicity of infection of 1. One hour after the VTF-T7 infection, the medium-virus mixture was replaced with fresh Huh-7 medium containing DMSO or the test compound. Cells were harvested 48 h after compound addition and lysed by adding 1x SDS loading buffer (Invitrogen, Carlsbad, CA). The expression and processing of NS2, NS3, and NS5b were detected by Western blotting.
Determination of drug interaction in vitro.
In vitro drug interactions were assessed using a modified fixed-ratio isobologram method (12). Briefly, predetermined EC50s were used to decide the top concentrations of the individual drugs to ensure that the EC50 fell near the midpoint of a six-point serial dilution. Top concentrations used were 0.08 µM for R803, 4 IU/ml for IFN-
, 0.008 µM for BILN 2061, and 4 µM for the RdRp inhibitor (19). The top concentrations were used to prepare fixed-ratio solutions at ratios of 4:0, 3:1, 2:2, 1:3, and 0:4 of R803 and the partner drug. The mixed-drug solutions were then serially diluted and tested on replicon cells. EC50s were calculated for each drug combination, and fractional 50% inhibitory concentrations (FIC50) were calculated (12). A mean FIC50 greater than 1 indicates an antagonistic effect, a mean FIC50 equal to 1 indicates an additive effect, and a mean FIC50 less than 1 indicates a synergistic effect between the drugs tested in combination.
|
|
|---|
or other known HCV inhibitors. Among the colonies screened, replicons PLN5 and PLNCP54 showed high-level HCV RNA replication and superior luciferase signals suitable for compound screening in a 384-well format. We anticipated that such screens could identify a wide range of inhibitors, targeting either viral or cellular proteins essential for HCV RNA replication. In addition, compounds inhibiting NS2/3 cleavage could be identified by differential screens using the PLN5 and PLNCP54 replicons. A high-throughput screen format (see Materials and Methods) was developed by optimizing cell density, compound dilution and addition procedures, duration of compound treatment, and luciferase reporter measurement. The initial hits from the screen were then confirmed and evaluated for potency using serially diluted compounds. In the meantime, the cytotoxicity indexes of the hit compounds were also evaluated over the same range of compound concentrations to determine the therapeutic windows of the hit compounds.
![]() View larger version (14K): [in a new window] |
FIG. 1. Schematic presentation of the gene organization of the replicons. The dark vertical bars adjacent to the HCV 5' NTR represent amino acids 1 to 16 of HCV core (22, 38). Hygror, hygromycin resistance gene; Ubi, ubiquitin.
|
50% of replicon luciferase activity at 10 µM. Hits were further confirmed on the replicon cells by using a threefold serial dilution together with a cytotoxicity assay. The confirmed hit rate is 0.27%, with hits being defined as compounds with an EC50 (the concentration that inhibits HCV replication by 50%) below 10 µM and a CC50 (the concentration that inhibits cell viability by 50%) of 10-fold over the EC50. R706, a diphenyl heterocyclic compound containing a dichloroacetamide moiety (Fig. 2A), was the most potent hit, with an EC50 of 90.56 ± 15.99 nM by the luciferase assay (Fig. 2B). The R706 series was chosen for further characterization because of its outstanding potency among all the scaffolds. Western blot analysis showed that R706 dose-dependently inhibited replicon PLNCP54, with an EC50 of 110 nM and a CC50 of
3 µM as estimated by the levels of HCV NS3 and cellular β-tubulin, respectively (Fig. 3C). Similar EC50s and CC50s were obtained with the Huh-mono replicon (Fig. 1) by Western blotting (data not shown), suggesting that R706 did not inhibit the NPT (Neor) gene, the EMCV IRES, or the luciferase reporter. TaqMan RT-PCR analysis further confirmed that R706 treatment resulted in a dose-dependent reduction in HCV RNA levels in the replicon, with an EC50 of 114.93 ± 10.64 nM after normalization to the level of endogenous GAPDH mRNA (Fig. 2C). The EC50s from the three different assays were in the same range, and the differences might be attributed, at least in part, to the differences in the decay rates of the respective assay indicators, since the half-lives of firefly luciferase, HCV NS3, and HCV RNA are 3.68 h (31), 11.5 to 17.5 h (R. Bartenschlager, personal communications), and 12 h (16), respectively. Taken together, these results demonstrated that R706 was a potent HCV replicon inhibitor, effective at reducing viral RNA and protein production.
![]() View larger version (17K): [in a new window] |
FIG. 2. R706, a substituted diphenyl heterocyclic compound identified from a high-throughput replicon screen. (A) Chemical structure of R706. (B and C) Antireplicon activity was measured by luciferase-based (B) and TaqMan RT-PCR-based (C) assays. HCV RNA ge, HCV RNA genome equivalent copies. The data shown are from a single representative experiment and were reproduced several times. The luciferase- and TaqMan-based experiments were performed in triplicate. Error bars, standard deviations.
|
![]() View larger version (54K): [in a new window] |
FIG. 3. R803 is a lead compound derived from structure-activity iterations of the R706 scaffold. (A) Chemical structure of R803. (B) Dose-dependent inhibition of HCV RNA replication determined by TaqMan RT-PCR. The experiment was performed in triplicate. Error bars, standard deviations. The data shown are from a single representative experiment and were reproduced several times. HCV RNA ge, HCV RNA genome equivalent copies. (C) R803 versus R706 in a Western blot-based replicon assay. (D) Antireplicon activity of R803 with various human serum concentrations in the culture medium.
|
3-fold improvement over the activity of the parent compound, R706. The potency of R803 against the replicon was also confirmed by both Western blotting and TaqMan RT-PCR to be about 37 nM and 54.67 ± 4.11 nM, respectively (Fig. 3B and C). It has been demonstrated that certain antiviral compounds show markedly reduced activity in vivo or in cell-based assays because of their great propensity to bind serum proteins (44). Since R803 has a high rate (>99%) of protein binding (data not shown), it was important to address whether protein binding would weaken R803's anti-HCV activity. Thus, the EC50 of R803 was measured in replicon cells cultured in media containing increasing concentrations of human serum (Irvine Scientific). Western blot analysis demonstrated that elevation of the human serum concentration, up to 25% (vol/vol) of the culture medium, had only a negligible effect on the potency of R803 (Fig. 3D). It is possible that the compound was already bound to the proteins in the culture medium before the addition of human serum and that the addition of human serum did not affect that binding. Further increases in the serum concentration resulted in reduced cell viability (data not shown), prohibiting effective evaluation of R803 under these culture conditions.
To assess the general effect of R803 on cell proliferation, a panel of primary cells and transformed human cell lines were treated with increasing doses of R803 for 48 h, and the effect on cell proliferation was measured by an MTS-based cell viability assay. The CC50 of R803 was found to range from 2 µM to
10 µM, depending on the cell type and proliferation status (Table 1). It is noteworthy that R803 had no detectable cytotoxic effects on cultured primary human hepatocytes at compound concentrations as high as 10 µM, either by measuring cell viability using MTS-based analysis (Table 1) or by quantifying enzymes released from damaged hepatocytes (data not shown). To calculate the therapeutic window (the CC50/EC50 ratio) in the cell culture model, the antiviral activity and cytotoxicity of R803 were evaluated simultaneously in PLNCP54. With the antiviral activity at 28.77 ± 7.44 nM and the cytotoxicity at 2.66 ± 0.54 µM, the therapeutic window was calculated to be 92.
|
View this table: [in a new window] |
TABLE 1. Effect of R803 on the viability of cultured human cellsa
|
Antiviral specificity of R803. To examine antiviral specificity, R803 was tested against heterologous, positive-strand RNA viruses, such as PV, YFV, and BVDV, in cell culture. Specifically, R803 was assayed in a PV replicon system, in which the region of the PV genome encoding viral structural proteins was replaced by the firefly luciferase coding sequence (32). Increasing doses of R803 were added to Huh-7 cells transfected with the PV replicon RNA, and the level of RNA replication was monitored by quantifying firefly luciferase activity. No difference was noticed between mock (DMSO) treatment and R803 treatment, suggesting that the compound did not have anti-PV activity. Similarly, R803 did not inhibit the BVDV- or YFV-induced CPE in cultured MDBK or Vero cells, respectively. PV is a prototype positive-strand RNA virus, and BVDV and YFV are HCV-related members of the family Flaviviridae. Despite the fact that HCV and these RNA viruses express homologous viral enzymes and share common replication strategies, R803 was active only in HCV replicon assays (Table 2), an observation strongly suggesting that R803 is an HCV-specific inhibitor.
|
View this table: [in a new window] |
TABLE 2. Antiviral specificity of R803a
|
30 nM) than against the genotype 2a replicon (EC50,
1,000 nM). Analogous genotype-differential responses to R803 were also observed in HCV culture assays involving genotype 1a and 2a viruses (unpublished data).
![]() View larger version (43K): [in a new window] |
FIG. 4. R803 induced differential responses in HCV replicons derived from genotype 1a, 1b, and 2a isolates. HCV replicons derived from genotype 1a (29), 1b (41), and 2a (24) were treated with varying concentrations of R803 for 48 h, and the cell lysates were analyzed by Western blotting using a genotype 1b NS3-specific monoclonal antibody and a β-tubulin antibody (A) or a genotype 2a NS3-specific monoclonal antibody and a β-actin antibody (B and C). The data shown are from a single representative experiment and were reproduced several times.
|
40 µM in biochemical assays for HCV NS2-3 cysteine protease or at R803 concentrations of
10 µM against NS3-4aprotease, NS3NTPase/helicase, or NS5bRdRp (Table 3). |
View this table: [in a new window] |
TABLE 3. Summary of EC50s of individual target assays for R803a
|
1 µM, inhibited neither the IRES-controlled protein translation nor the HCV proteases in the treated cells. In contrast, BILN 2061, a published inhibitor of NS3-4aprotease (27), was active in blocking NS3-4a-mediated protein processing (Fig. 5).
![]() View larger version (57K): [in a new window] |
FIG. 5. Evaluation of R803 and BILN 2061 by a TTI assay. R803 (A) or BILN 2061 (B) was tested by a transient-transfection-VTF-T7 infection assay. Cells were lysed and subjected to Western blot analysis with an HCV NS5b-specific monoclonal antibody. The data shown are from a single representative experiment and were reproduced several times.
|
Taken together, the available data suggest that R803 did not show a significant inhibitory effect on the viral IRES, NS2-3protease, NS3-4aprotease, NS3NTPase/helicase, or NS5bRdRp. These data, however, did not exclude the possibility that R803 might inhibit one of these viral functions presented only in the viral replication complex inside replicon cells.
Antiviral effect of R803 combined with IFN-
or viral enzyme inhibitors in the replicon.
The potential interaction between R803 and IFN-
/RBV therapy was assessed in the replicon model by a modified fixed ratio isobologram method (12). Stock solutions of R803 and IFN-
were mixed in a fixed ratio and serially diluted for the determination of antiviral potency against the replicon. The FIC50 of the R803-IFN-
combination for this specific mixing ratio was calculated. More FIC50s would be generated using several different mixing ratios of R803 and IFN-
. All the FIC50s would then be used to calculate a mean FIC50 to evaluate the interaction between R803 and IFN-
. A mean FIC50 score of 1 indicates an additive effect, <1 indicates a synergistic effect, and >1 indicates an antagonistic effect between the two test compounds (12). The RBV concentration was fixed at 20 µM because the commercial RBV displayed a cytotoxic effect in the replicon at higher concentrations. This also helped to simplify the study. The combination of R803 and IFN-
/RBV scored a mean FIC50 of 0.90 ± 0.05, indicating a weak synergy between the test compounds. Moreover, the combination did not cause any notable cytotoxic effect when cellular tubulin was used as an indicator (data not shown). These results clearly demonstrated that R803 is not only compatible with IFN-
/RBV but could also enhance its anti-HCV activity in the replicon model.
Similarly, studies were designed to elucidate the combination of R803 and BILN 2061, an active-site inhibitor of HCV NS3-4aprotease (27). The results show that the combination of R803 and BILN 2061 scored a mean FIC50 of 1.05 ± 0.12 in the replicon model. As a result, no synergy was found between R803 and BILN 2061. Another experiment that studied the combination of R803 and an allosteric RdRp inhibitor (19) scored a mean FIC50 of 1.09 ± 0.05, also indicating an additive effect between R803 and this RdRp inhibitor. The number might indicate a very slight antagonistic effect, but it is too close to differentiate.
Comparison of R803 and IFN-
in the replicon model.
Further studies were performed to compare the efficacies of R803 and IFN-
in the replicon during extended treatment. Specifically, replicon cells were treated with either the DMSO control, 500 nM R803, or 25 IU/ml of IFN-
(approximately 15 times the EC50 of the respective agents based on the Western blot assay). Cells were split at a dilution of 1:4 every 2 to 3 days, and RNA samples were taken at each split to measure HCV RNA levels by TaqMan RT-PCR. Media containing fresh DMSO, R803, or IFN-
were added at each cell split to maintain continuous treatment. During the 14-day treatment period, replicon cells that were exposed to 500 nM R803 showed a gradual decrease in viral RNA levels; on day 14 the HCV RNA titer was reduced more than 1,000-fold. In contrast, parallel treatment with 25 IU/ml IFN-
yielded an
22-fold reduction in the HCV RNA titer after 14 days of treatment (Fig. 6A). Moreover, no viral RNA rebound was observed after the cessation of R803 treatment (Fig. 6B), suggesting that the compound had a potential to "cure" the replicon.
![]() View larger version (40K): [in a new window] |
FIG. 6. IFN- versus R803 in the replicon model. (A) 9-13 replicon cells were treated with either 25 IU/ml of IFN- or 500 nM R803 (approximately 16 times the EC50 of the respective agent) for 14 days, and cell samples were collected at each time when cells were split. The HCV RNA titer of each sample was measured by TaqMan RT-PCR and normalized to the level of endogenous GAPDH mRNA. (B) Replicon cells were treated with 500 nM R803 for 14 days and were then switched to 1% DMSO alone for 12 days; cells were collected at each split as specified, and the HCV RNA titer was measured and normalized to the level of GAPDH mRNA (solid bars). Replicon cells treated with 25 IU/ml IFN- for 14 days were switched to either 1% DMSO (striped bars) or 500 nM R803 (shaded bars) for 12 days. Samples were withdrawn and analyzed as described above. The detection limit for TaqMan RT-PCR in this study was approximately 50 to 100 HCV RNA genome equivalents (ge)/ng of GAPDH mRNA. The data shown are from a single representative experiment and were reproduced several times. The experiments were performed in triplicate. Error bars, standard deviations.
|
(Fig. 6A). To test whether those HCV replicons that survived IFN-
treatment would respond to R803 treatment, replicon cells treated with 25 IU/ml IFN-
for 14 days were switched to either DMSO or 500 nM R803 for an additional 2 weeks. The HCV RNA titer with R803 dropped from 3.2 x 105 genome equivalents/ng of GAPDH mRNA to a level around the detection limit of the TaqMan RT-PCR (Fig. 6B), whereas the titer for the DMSO control group remained unchanged (Fig. 6B). These results indicate that the IFN-
-refractory HCV RNA population was sensitive to R803 treatment. |
|
|---|
On the other hand, replicon screens have disadvantages. Considerable effort is required to dissect the molecular mechanism of replicon inhibition by small-molecule inhibitors. Drug resistance genotyping is a classic method to identify the target of a given compound. Indeed, the method has been successfully used to map drug-resistant alleles for inhibitors of NS3-4aprotease (33, 39) and NS5bRdRp (42, 43). It is noteworthy that these inhibitors were all derived from biochemical screens or structure-based drug design with defined viral enzyme targets. There are no reports thus far of successful identification of targets for any compound derived from a replicon screen. The lack of target identification may reflect the fact that the replicon-based screen is still at an early stage or, more likely, that the lack of viral exit and entry in HCV replicon cells makes genetic selection of resistant variants more difficult, if not impossible. In the case of the R803 scaffold, the mechanism of action remains elusive despite extensive biochemical and cell-based analysis of potential on-target activity and genetic selection and analysis of R803-resistant replicons. In particular, the lengthy selection with R706 or R803 led to the selection of replicons that either showed reduced compound permeability or had accumulated multiple mutations, each of which contributed only weak resistance to R803 (data not shown). We conclude that R803 does not inhibit the activity of NS2-3protease, NS3-4aprotease, NS3NTPase/helicase, the HCV IRES, or NS5bRdRp under the described assay conditions. The current data cannot distinguish whether the actual target is of viral or cellular origin. Nonetheless, R803 is a specific inhibitor targeting a critical event in the HCV RNA replication cycle, and it has no detectable inhibitory activity against PV, YFV, or BVDV, an HCV-related positive-strand RNA virus. In a recent experiment with chimpanzees chronically infected by HCV, administration of a derivative of R803 reduced the viral titer by 1 to 2 log units after 7 days of treatment (unpublished data). In the meantime, simultaneous monitoring of the elevated liver enzymes of the chimpanzees over the treatment period showed no obvious liver damage. These data also indicated that the compound probably has a specific antiviral mechanism rather than inhibiting viral replication by a nonspecific cytotoxic mechanism.
It is intriguing that genotypes 1 and 2a displayed differential responses (>30-fold shift in EC50) to R803 treatment in both replicon and live-virus assays. This finding indicates that R803 probably inhibits a viral target, or perhaps a cellular factor(s) that is involved in HCV replication in a genotype-specific manner. Ongoing analysis of R803 in 1b/2a intergenotypic chimeras may provide additional hints regarding its mechanism of action. Due to the high degree of sequence heterogeneity among HCV genotypes (e.g., genotype 1b and 2a differ by approximately 30% at the amino acid level), it is not surprising for an HCV inhibitor to show differential antiviral effects against different HCV genotypes, both in the HCV replicon model (40) and in human clinical studies (20, 48). It is clinically desirable to broaden the antiviral spectrum of R803-like HCV inhibitors by further structure-activity iterations, and the replicon model would be a crucial reagent for the selection of inhibitors with cross-genotype activities.
The TTI assay has been widely used in functional analyses of viral and cellular proteins, such as the analysis of HCV polyprotein processing (15). It is also a useful cell-based system, complementary to the HCV replicon, for the study of a compound's antiviral mechanism. Because the TTI assay uncouples HCV RNA translation and protein cleavage processes from the HCV RNA replication cycle, it allows the analysis of the potential impacts of antiviral compounds on the HCV IRES, NS2-3protease, and NS3-4aprotease in a single cycle of protein translation and proteolytic processing. For instance, TTI testing of BILN 2061 yielded the accumulation of unprocessed viral protein precursors, a phenotype expected for an NS3-4a serine protease inhibitor. We also identified replicon inhibitors capable of blocking viral IRES-mediated translation with the TTI assay (unpublished data).
Significant progress has been made recently in the development of efficient HCV replication systems, such as replicons expressing green fluorescent protein (45), as well as the fully infectious genotype 2a virus culture (8, 34, 51, 54). It is plausible to use these systems to isolate drug-resistant viral populations and perhaps elucidate a viral target for R803 or other inhibitors identified by high-throughput replicon screens.
R803 has a number of attractive properties: as a simple chemical entity, R803 can be made by short convergent synthesis; it is readily scaleable from commercially available starting materials; and it contains sites suitable for chemical optimization (D. A. Goff et al., unpublished data). As an antiviral agent, R803 exhibits anti-HCV potency and selectivity and has the potential to be used in combination with IFN-
and/or other classes of HCV inhibitors. In the HCV replicon model, it induces far fewer drug-resistant replicon clones than other known inhibitors of NS3-4aprotease and NS5bRdRp (data not shown). We conclude that R803 and its derivatives constitute a class of novel HCV inhibitors that can be explored as potential HCV therapeutic agents.
Published ahead of print on 28 January 2008. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»