Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, July 2008, p. 2657-2659, Vol. 52, No. 7
0066-4804/08/$08.00+0 doi:10.1128/AAC.01459-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Gene Amplification of the Multidrug Resistance 1 Gene of Plasmodium vivax Isolates from Thailand, Laos, and Myanmar
Mallika Imwong,1*
Sasithon Pukrittayakamee,1,2
Wirichada Pongtavornpinyo,1
Supatchara Nakeesathit,1
Shalini Nair,3
Paul Newton,4
Francois Nosten,1,5,6
Timothy J. C. Anderson,3
Arjen Dondorp,1,6
Nicholas P. J. Day,1,6 and
Nicholas J. White1,6
Department of Clinical Tropical Medicine, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand,1
The Royal Institute, Grand Palace, Bangkok, Thailand,2
Southwest Foundation for Biomedical Research, San Antonio, Texas,3
Mahosot Hospital Wellcome Trust-Mahosot-Oxford Tropical Medicine Research Collaboration Vientiane, Laos PDR,4
Shoklo Malaria Research Unit, Mae Sot, Tak, Thailand,5
Centre for Clinical Vaccinology and Tropical Medicine, Churchill Hospital, Oxford, United Kingdom6
Received 11 November 2007/
Returned for modification 22 January 2008/
Accepted 10 April 2008

ABSTRACT
Plasmodium vivax mdr1 gene amplification, quantified by real-time
PCR, was significantly more common on the western Thailand border
(6 of 66 samples), where mefloquine pressure has been intense,
than elsewhere in southeast Asia (3 of 149;
P = 0.02). Five
coding mutations in
pvmdr1, independent of gene amplification,
were also found.

TEXT
An increase in the copy number of the
Plasmodium falciparum mdr1gene is the most important determinant of mefloquine resistance
in vitro and in vivo (
3,
6-
8) and is inversely correlated with
chloroquine resistance (
1). To assess
Plasmodium vivax mdr1 gene amplification, we developed a real-time PCR method and
evaluated copy numbers and polymorphisms in
P. vivax samples
from Laos, Myanmar, and Thailand, areas with considerable differences
in antimalarial drug usage and
P. falciparum antimalarial drug
susceptibility.
Dry blood samples were collected before treatment from 215 patients with acute vivax malaria from three areas: 66 came from Tak province on the Thai-Myanmar border, 50 were from elsewhere in Thailand, 50 were from Laos, and 49 were from Myanmar. The pvmdr1 copy number was assessed by a novel real-time PCR method on a Corbett Rotor-Gene 3000 (Corbett Research, Australia). The primers and probes were PVMDR1F (CAGCCTGAAAGATTTAGAAGCCTT), PVMDR1R (CGGCTGTTGGAATCACTTTGA), PVMDR1probe (FAM-CGGAGGAGTCGAACGAAGATGGTTTTTCTT-TAMRA), PVTUBULINF (TCGCTTAACGACGTCCCC), PVTUBULINR (TGGAATGTCACAAACGCTGG), and PVTUBULINprobe (VIC-TTCCGCTTCCCCCTCCACAGG-TAMRA). A QuantiTect Multiplex PCR NoROX (Qiagen, Germany) was used, and the temperature profile was prepared according to the manufacturer's instructions. The calibrator, a single-copy control, is a plasmid that was constructed by the insertion of pvmdr1 (nucleotides [nt] 1102 to 1993) and pvtubulin (nt 14393 to 2354) fragments in a ratio of 1:1 into the pCR2.1 vector using a TOPO TA cloning kit (Invitrogen U.S.A.). β-Tubulin served as an internal control to normalize the amount of sample DNA added to the reactions. The relative amounts of the target genes were calculated by using the comparative Ct method. Copy numbers were calculated as follows: copy number = 2–
Ct. All assays with samples containing two copy numbers pvmdr1 were repeated five times, and 33% of the single copy number pvmdr1 analyses were repeated twice. The results were consistent (Fig. 1). Three fragments (496, 590, and 541 bp) of pvmdr1, which covered nt 158 to 653, 2752 to 3341, and 3683 to 4223, respectively, were amplified by PCR. Direct sequencing from PCR products was performed by using an ABI automated sequencer.
Double
pvmdr1 copies were significantly more common in Tak province
(6 of the 66 samples) than elsewhere in Thailand (0 of 50; Fisher's
exact test,
P = 0.03). In the samples from Laos (
n = 50) and
Myanmar (
n = 49), a double copy number
pvmdr1 was found in only
two and one
P. vivax isolates, respectively. Comparison of
pvmdr1 sequences with the published wild-type sequence
pfmdr1 (M29154)
revealed that the polymorphisms found in
P. falciparum (at codons
86, 184, 1034, 1042, and 1246) corresponded to homologous mutations
in
pvmdr1 (AY618622) at codons 91, 189, 1071, 1079, and 1291,
respectively (Table
1).
pvmdr1 sequences were obtained for the
21 different isolates and the Belem laboratory strain. Compared
to Sal1 as the reference wild type, 48 mutations were distributed
among five positions, but none of these mutations corresponded
to those in
pfmdr1. Four of the mutations in
pvmdr1 were nonsynonymous.
These were at codons 133, 139, 976, 1076, and 1261, which are
equivalent to codons 128, 134, 940, 1039, and 1216 in
pfmdr1 (Table
1). The recent sequencing of
pvmdr1 has revealed a single
open reading frame of 4,392 bp encoding a deduced protein of
1,464 amino acids, with 12 transmembrane segments (
2). Brega
et al. reported two SNPs (976 and 1076) in the
pvmdr1 gene,
which were not associated with chloroquine resistance in
P. falciparum. Sa et al. compared
pvmdr1 from 10 isolates with
different levels of chloroquine sensitivity and did not find
a correlation between codon mutations and resistance (
9).
Gene amplification is a potentially important resistance mechanism.
This study confirms
mdr1 amplification does occur in
P. vivax,
and this varied between geographical locations differing in
their use of antimalarial drugs. In Tak province, on the Thai-Burmese
border, mefloquine alone or in combination has been used for
23 years. In
P. falciparum intense and sustained mefloquine
pressure has been associated with high rates of selection for
pfmdr1 amplification (
13). In other areas of Thailand, Myanmar,
and Laos, there has been less exposure of parasites to mefloquine.
Gene amplifications of
pvmdr1 were significantly more common
in isolates from Tak (6 of the 66 samples) than in those from
patients from other provinces of Thailand, Myanmar, and Laos
(
P = 0.02), suggesting that there is a relationship between
the
pvmdr1 copy number and widespread deployment of mefloquine.
The degree of amplification is low currently (no more than two
copies), whereas in
P. falciparum up to five copies of
pfmdr1 have been observed in this region. Point mutations at codons
133, 139, 976, 1076, and 1261 of the
pvmdr1 gene (corresponding
to codons 128, 134, 940, 1039, and 1216, respectively, in
pfmdr1)
were found in this study. Mutations at codons 133, 139, and
1261 are located outside the transmembrane segment. Two point
mutations at codons 976 and 1076 are located in the putative
transmembrane segments X and XI. Double mutations (976 and 1076)
in these segments were found in the samples from three areas
(31%,
n = 13). The Y976F mutation in
P. vivax has been correlated
with reduced susceptibility to chloroquine (
10). This mutation,
seen in 1 of 11 Thai and 3 of 5 Myanmar isolates examined here,
may affect chloroquine efficacy against
P. vivax in this region
and is worthy of further exploration. Mutations in
pvmdr1 were
independent of
pvmdr1 amplification. Sal1, a laboratory-adapted
P. vivax strain usually regarded as the wild type, was found
to possess residue F at position 1076, while the residue L was
identified at the correspond codon in
pfmdr1 (position 1039,
accession no M29154; strain FC27, D10) and
pcmdr1 (AY123625),
suggesting that the residue L might be a neutral allele. None
of the corresponding mutations in
pfmdr1 were observed in
pvmdr1.
This suggests that there may be different mechanisms conferring
chloroquine resistance in
P. vivax compared to
P. falciparum.
Amplification of pfmdr1 has occurred multiple times in P. falciparum (5, 12). This is evident from the ready intrahost selection, the patterns of polymorphism in flanking microsatellite markers, and from the different-sized fragments of chromosome 5 regions containing pfmdr1 that are amplified in different isolates. In contrast, the fact that all P. vivax isolates carrying multiple copies of pvmdr1 have the same point mutations suggests that this gene amplification has a single origin.

ACKNOWLEDGMENTS
This work was supported by the Thailand research Fund-the Commission
on Higher Education (CHE; MRG 4980091) and the Wellcome Trust,
United Kingdom (grant GR080867).
We thank Pakorn Pengin, Naowarat Tanomsing, Ric N. Price, Mayfong Mayxay, Apichart Nontprasert, and Jean-Paul Guthmann for their help.

FOOTNOTES
* Corresponding author. Mailing address: Department of Clinical Tropical Medicine, Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Rd., Bangkok 10400, Thailand. Phone: (66) 2 354 9172. Fax: (66) 2 354 9169. E-mail:
noi{at}tropmedres.ac 
Published ahead of print on 28 April 2008. 

REFERENCES
1 - Barnes, D. A., S. J. Foote, D. Galatis, D. J. Kemp, and A. F. Cowman. 1992. Selection for high-level chloroquine resistance results in deamplification of the pfmdr1 gene and increased sensitivity to mefloquine in Plasmodium falciparum. EMBO J. 11:3067-3075.[Medline]
2 - Brega, S., B. Meslin, F. de Monbrison, C. Severini, L. Gradoni, R. Udomsangpetch, I. Sutanto, F. Peyron, and S. Picot. 2005. Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity. J. Infect. Dis. 191:272-277.[CrossRef][Medline]
3 - Cowman, A. F., D. Galatis, and J. K. Thompson. 1994. Selection for mefloquine resistance in Plasmodium falciparum is linked to amplification of the pfmdr1 gene and cross-resistance to halofantrine and quinine. Proc. Natl. Acad. Sci. USA 91:1143-1147.[Abstract/Free Full Text]
4 - Mayxay, M., S. Pukrittayakamee, P. N. Newton, and N. J. White. 2004. Mixed-species malaria infections in humans. Trends Parasitol. 20:233-240.[CrossRef][Medline]
5 - Nair, S., D. Nash, D. Sudimack, A. Jaidee, M. Barends, A. C. Uhlemann, S. Krishna, F. Nosten, and T. J. Anderson. 2007. Recurrent gene amplification and soft selective sweeps during evolution of multidrug resistance in malaria parasites. Mol. Biol. Evol. 24:562-573.[Abstract/Free Full Text]
6 - Peel, S. A., P. Bright, B. Yount, J. Handy, and R. S. Baric. 1994. A strong association between mefloquine and halofantrine resistance and amplification, overexpression, and mutation in the P-glycoprotein gene homolog (pfmdr) of Plasmodium falciparum in vitro. Am. J. Trop. Med. Hyg. 51:648-658.[Abstract/Free Full Text]
7 - Price, R. N., C. Cassar, A. Brockman, M. Duraisingh, M. van Vugt, N. J. White, F. Nosten, and S. Krishna. 1999. The pfmdr1 gene is associated with a multidrug-resistant phenotype in Plasmodium falciparum from the western border of Thailand. Antimicrob. Agents Chemother. 43:2943-2949.[Abstract/Free Full Text]
8 - Price, R. N., A. C. Uhlemann, A. Brockman, R. McGready, E. Ashley, L. Phaipun, R. Patel, K. Laing, S. Looareesuwan, N. J. White, F. Nosten, and S. Krishna. 2004. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet 364:438-447.[CrossRef][Medline]
9 - Sa, J. M., T. Nomura, J. Neves, J. K. Baird, T. E. Wellems, H. A. del Portillo. 2005. Plasmodium vivax: allele variants of the mdr1 gene do not associate with chloroquine resistance among isolates from Brazil, Papua, and monkey-adapted strains. Exp. Parasitol. 109:256-259.[CrossRef][Medline]
10 - Suwanarusk, R., B. Russell, M. Chavchich, F. Chalfein, E. Kenangalem, V. Kosaisavee, B. Prasetyorini, K. A. Piera, M. Barends, A. Brockman, U. Lek-Uthai, N. M. Anstey, E. Tjitra, F. Nosten, Q. Cheng, and R. N. Price. 2007. Chloroquine-resistant Plasmodium vivax: in vitro characterisation and association with molecular polymorphisms. PLoS ONE 2:e1089.[CrossRef]
11 - Thaithong, S., L. C. Ranford-Cartwright, N. Siripoon, P. Harnyuttanakorn, N. S. Kanchanakhan, A. Seugorn, K. Rungsihirunrat, P. V. Cravo, and G. H. Beale. 2001. Plasmodium falciparum: gene mutations and amplification of dihydrofolate reductase genes in parasites grown in vitro in presence of pyrimethamine. Exp. Parasitol. 98:59-70.[CrossRef][Medline]
12 - Triglia, T., S. Foote, D. J. Kemp, and A. F. Cowman. 1991. Amplification of the multidrug resistance gene pfmdr1 in Plasmodium falciparum has arisen as multiple independent events. Mol. Cell. Biol. 11:5244-5250.[Abstract/Free Full Text]
13 - Uhlemann, A. C., M. Ramharter, B. Lell, P. G. Kremsner, and S. Krishna. 2005. Amplification of Plasmodium falciparum multidrug resistance gene 1 in isolates from Gabon. J. Infect. Dis. 192:1830-1835.[CrossRef][Medline]
14 - Watanabe, J., and J. Inselberg. 1994. Establishing a physical map of chromosome no. 4 of Plasmodium falciparum. Mol. Biochem. Parasitol. 1:189-199.
Antimicrobial Agents and Chemotherapy, July 2008, p. 2657-2659, Vol. 52, No. 7
0066-4804/08/$08.00+0 doi:10.1128/AAC.01459-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.