This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tortorano, A. M.
Right arrow Articles by Viviani, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tortorano, A. M.
Right arrow Articles by Viviani, M. A.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, July 2008, p. 2683-2685, Vol. 52, No. 7
0066-4804/08/$08.00+0     doi:10.1128/AAC.00272-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Species Distribution and In Vitro Antifungal Susceptibility Patterns of 75 Clinical Isolates of Fusarium spp. from Northern Italy{triangledown}

Anna Maria Tortorano,1* Anna Prigitano,1 Giovanna Dho,1 Maria Carmela Esposto,1 Claudia Gianni,2 Anna Grancini,3 Cristina Ossi,4 and Maria Anna Viviani1

Department of Public Health—Microbiology—Virology, Università degli Studi di Milano, Milan, Italy,1 Department of Dermatology, Scientific Institute, S. Raffaele Hospital, Milan, Italy,2 Microbioloy Laboratory, Fondazione IRCCS Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, Milan, Italy,3 Laboraf, San Raffaele Scientific Institute, Milan, Italy4

Received 27 February 2008/ Returned for modification 28 March 2008/ Accepted 20 April 2008


arrow
ABSTRACT
 
Fusarium isolates from 75 Italian patients were identified by molecular methods, and their susceptibilities to antifungals were tested in vitro. Fusarium verticillioides was the species most frequently isolated from deep-seated infections, and F. solani was the species most frequently isolated from superficial infections. F. solani isolates showed high azole MICs, while F. verticillioides isolates showed low posaconazole MICs.


arrow
TEXT
 
Fusarium species are hyaline filamentous fungi that cause a broad spectrum of infections in humans, including superficial, locally invasive, and disseminated infections. The clinical presentation of fusariosis largely depends on the immune status of the host and the fungal portal of entry (7). Superficial infections, such as keratitis and onychomycosis, are usually observed in immunocompetent individuals, whereas invasive infections occur in immunocompromised patients, mainly in association with prolonged and profound neutropenia or severe T-cell immunodeficiency (6).

In immunocompromised patients, the mortality rate exceeds 70% (6, 12). The antifungal therapy of choice is amphotericin B; other treatment options include voriconazole and posaconazole (12).

Among the more than 50 Fusarium species identified, 12 have been described as causes of human infection. Traditional identification is based on morphological methods, is cumbersome, and requires adequate training. As a consequence, the identification of 33 to 50% of Fusarium isolates is erroneous or missed (3, 7). Fusarium solani is the most frequently reported species and causes approximately 50% of infections; the next most prevalent species are F. oxysporum (20%), F. verticillioides (10%), and Fusarium moniliforme (now classified as F. verticillioides; 10%) (7, 13).

Fusarium species are relatively resistant to most antifungals. However, different species have different susceptibility patterns (7). Therefore, reliable species identification is important for epidemiologic and clinical purposes.

The aim of the current study was to identify Fusarium isolates from cases occurring in northern Italy by molecular methods and to determine their in vitro susceptibilities to antifungals.

Isolates sequentially collected from 1985 to 2007 from 75 patients with Fusarium infections diagnosed in two hospital laboratories were studied. The isolates were maintained in a freeze-dried state in the Igiene Università Milano collection at the Department of Public Health—Microbiology—Virology, University of Milan, Milan, Italy.

Genomic DNA was extracted with an UltraClean microbial DNA isolation kit (Mo Bio Laboratories, Inc., Carlsbad, CA) and amplified with primers specific for F. proliferatum, F. verticillioides, and F. subglutinans (4). Samples that had negative results were reamplified with universal fungus-specific primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (14). The amplicons were purified with a Microcon centrifugal filter device (Millipore Corporation, Bedford, MA) and sequenced with BigDye terminators (Applera, Foster City, CA) in a 310 ABI Prism sequencer (Applera). Nucleotide sequences were analyzed by the use of Finch TV software (version 1.4.0) and a search of the GenBank database with the BLAST program. Further amplification and sequencing of the alpha-elongation gene (8) was performed for the strains presenting an ambiguous BLAST result for internal transcribed spacer (ITS) sequences.

In vitro susceptibility testing was performed by a broth microdilution assay following the Clinical and Laboratory Standards Institute (formerly NCCLS) guidelines for filamentous fungi (5). Amphotericin B (Sigma, Milan, Italy), itraconazole (Janssen Research Foundation, Bersee, Belgium), voriconazole (Molekula, Wimborne Dorset, United Kingdom), and posaconazole (Schering-Plough Research Institute, Kenilworth, NJ) were tested at final concentrations ranging from 0.03 to 16 µg/ml. Tests were performed in duplicate. Reference strains Candida parapsilosis ATCC 22019 and Candida krusei ATCC 6258 were used as quality controls.

Overall, F. verticillioides represented 41% of the isolates, followed by F. solani (25%), F. proliferatum (13%), and F. oxysporum (12%) (Table 1). However, the distribution of the isolated species differed among the patients with various clinical presentations: F. verticillioides accounted for 57% of the isolates from immunocompromised patients, whereas F. solani accounted for 46% of those from patients with superficial infections. Among the 17 onychomycosis cases, F. solani and F. oxysporum were responsible for 7 cases each, whereas 2 of 3 keratitis cases were caused by F. verticillioides.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Identification of 75 Fusarium isolates causing deep and superficial infections

The results of antifungal susceptibility testing (Table 2) showed different patterns of susceptibility among the species. The majority of F. solani isolates exhibited high azole MICs. In contrast, all F. verticillioides isolates were inhibited by ≤1 µg/ml posaconazole, and 90% and 84% of the isolates were inhibited by ≤2 µg/ml voriconazole and itraconazole, respectively. F. proliferatum and F. oxysporum isolates showed a broad range of MICs when they were tested against posaconazole and voriconazole. Amphotericin B was active at ≤2 µg/ml against 70 of the 75 isolates tested.


View this table:
[in this window]
[in a new window]

  		TABLE 2. In vitro susceptibility to antifungal drugs of 75 Fusarium isolates by species

Other investigators have reported on the poor in vitro activities of different antifungals against Fusarium species, with F. solani being more resistant than other members of the genus (1, 2, 7, 9). According to our results, amphotericin B was the most active drug against F. solani, while voriconazole and posaconazole were active against other Fusarium species, and their use in the treatment of infections caused by these species is promising. These observations are consistent with the favorable outcome observed in some patients with fusariosis treated with lipid-based amphotericin B or triazoles (10, 11, 12).

The difficulties in correlating in vitro susceptibility data with the results of clinical trials or the outcomes described in case reports are well known and have been related to several factors, including the low numbers of patients treated, the critical role of immune reconstitution in the outcome of fusariosis, delays in the initiation of antifungal treatment, and bias in patient selection in salvage therapy trials. In addition, the causative isolates are not identified to species level in the majority of reports. This lack of identification further hinders correlation of the data, given the different susceptibility patterns among different Fusarium species.

The distribution of Fusarium species reported in the current analysis is different from that reported in the literature (7). In our series from northern Italy, more than 50% of the cases of deep infection were caused by F. verticillioides, whereas F. solani accounted for most of the superficial infections. This may be due to the various geographic distributions of the species or may be a result of the more accurate identification obtained by molecular methods.

In conclusion, because of the different patterns of antifungal activity against different species, accurate identification to the species level of the causative agent of Fusarium infections can greatly aid in the choice of an appropriate antifungal therapy. Amphotericin B, particularly in lipid formulations, seems to be the most effective against F. solani infections, whereas voriconazole and posaconazole may be effective against the other species, with posaconazole showing activity against F. verticillioides. In addition, the peculiar distribution of Fusarium species causing deep and superficial infections that was observed in this study supports the need for local epidemiologic surveys that include molecular identification of the infecting species.


arrow
ACKNOWLEDGMENTS
 
Financial support for this study was provided by the Schering-Plough Corporation.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Public Health—Microbiology—Virology, Università degli Studi di Milano, Via Pascal 36, Milan 20133, Italy. Phone: 39 02 503 15145. Fax: 39 02 503 15146. E-mail: annamaria.tortorano{at}unimi.it Back

{triangledown} Published ahead of print on 28 April 2008. Back


arrow
REFERENCES
 
    1
  1. Arikan, S., M. Lozano-Chiu, V. Paetznick, S. Nangia, and J. H. Rex. 1999. Microdilution susceptibility testing of amphotericin B, itraconazole, and voriconazole against clinical isolates of Aspergillus and Fusarium species. J. Clin. Microbiol. 37:3946-3951.[Abstract/Free Full Text]
    2. 2
  2. Azor, M., J. Gené, J. Cano, and J. Guarro. 2007. Universal in vitro antifungal resistance of genetic clades of the Fusarium solani species complex. Antimicrob. Agents Chemother. 51:1500-1503.[Abstract/Free Full Text]
    3. 3
  3. Healy, M., K. Reece, D. Walton, J. Huong, S. Frye, I. I. Raad, and D. P. Kontoyiannis. 2005. Use of the Diversi Lab system for species and strain differentiation of Fusarium species isolates. J. Clin. Microbiol. 43:5278-5280.[Abstract/Free Full Text]
    4. 4
  4. Mulè, G., A. Susca, G. Stea, and A. Moretti. 2004. A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum, and F. subglutinans. Eur. J. Plant Pathol. 110:495-502.[CrossRef]
    5. 5
  5. National Committee for Clinical Laboratory Standards. 2002. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi. Approved standard. NCCLS document M38-A. National Committee for Clinical Laboratory Standards, Wayne, PA.
    6. 6
  6. Nucci, M., and E. Anaissie. 2002. Cutaneous infection by Fusarium species in healthy and immunocompromised hosts: implications for diagnosis and management. Clin. Infect. Dis. 35:909-920.[CrossRef][Medline]
    7. 7
  7. Nucci, M., and E. Anaissie. 2007. Fusarium infections in immunocompromised patients. Clin. Microbiol. Rev. 20:695-704.[Abstract/Free Full Text]
    8. 8
  8. O'Donnell, K., H. C. Kistler, E. Cigelnik, and R. C. Ploetz. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 95:2044-2049.[Abstract/Free Full Text]
    9. 9
  9. Paphitou, N. I., L. Ostrosky-Zeichner, V. L. Paetznick, J. R. Rodriguez, E. Chen, and J. H. Rex. 2002. In vitro activities of investigational triazoles against Fusarium species: effects of inoculum size and incubation time on broth microdilution susceptibility test results. Antimicrob. Agents Chemother. 46:3298-3300.[Abstract/Free Full Text]
    10. 10
  10. Perfect, J. R. 2005. Treatment of non-Aspergillus moulds in immunocompromised patients, with amphotericin B lipid complex. Clin. Infect. Dis. 40(Suppl. 6):S401-S408.[CrossRef][Medline]
    11. 11
  11. Perfect, J. R., K. A. Marr, T. J. Walsh, R. N. Greenberg, B. DuPont, J. de la Torre-Cisneros, G. Just-Nubling, H. T. Schlamm, I. Lutsar, A. Espinel-Ingroff, and E. Johnson. 2003. Voriconazole treatment for less-common, emerging, or refractory fungal infections. Clin. Infect. Dis. 36:1122-1131.[CrossRef][Medline]
    12. 12
  12. Raad, I. I., R. Y. Hachem, R. Herbrecht, J. R. Graybill, R. Hare, G. Corcoran, and D. P. Kontoyiannis. 2006. Posaconazole as salvage treatment for invasive fusariosis in patients with underlying hematologic malignancy and other conditions. Clin. Infect. Dis. 42:1398-1403.[CrossRef][Medline]
    13. 13
  13. Seifert, K. A., T. Aoki, R. P. Baayen, D. Brayford, L. W. Burgess, S. Chulze, W. Gams, D. Geiger, J. De Gruyter, J. F. Leslie, A. Logrieco, W. F. O. Marasas, H. I. Nirenberg, K. O'Donnell, J. Rheeder, G. J. Samuels, B. A. Summerell, U. Thrane, and C. Waalwijk. 2003. The name Fusarium moniliforme should no longer be used. Mycol. Res. 107:643-644.[CrossRef]
    14. 14
  14. White, T. J., T. Burns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. A. Innis, D. H. Gelfald, J. J. Sninsky, and T. J. White (ed.), PCR protocol: a guide to methods and applications. Academic Press, Inc., New York, NY.

Antimicrobial Agents and Chemotherapy, July 2008, p. 2683-2685, Vol. 52, No. 7
0066-4804/08/$08.00+0     doi:10.1128/AAC.00272-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Azor, M., Gene, J., Cano, J., Manikandan, P., Venkatapathy, N., Guarro, J. (2009). Less-Frequent Fusarium Species of Clinical Interest: Correlation between Morphological and Molecular Identification and Antifungal Susceptibility. J. Clin. Microbiol. 47: 1463-1468 [Abstract] [Full Text]  
  • Ruiz-Cendoya, M., Marine, M., Rodriguez, M. M., Guarro, J. (2009). Interactions between Triazoles and Amphotericin B in Treatment of Disseminated Murine Infection by Fusarium oxysporum. Antimicrob. Agents Chemother. 53: 1705-1708 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tortorano, A. M.
Right arrow Articles by Viviani, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tortorano, A. M.
Right arrow Articles by Viviani, M. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»