This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsui, H.
Right arrow Articles by Nakamura, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsui, H.
Right arrow Articles by Nakamura, M.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, August 2008, p. 2988-2989, Vol. 52, No. 8
0066-4804/08/$08.00+0     doi:10.1128/AAC.01662-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Evaluation of Antibiotic Therapy for Eradication of "Candidatus Helicobacter heilmannii"{triangledown}

Hidenori Matsui,1,2* Chihiro Aikawa,1 Yukie Sekiya,2 Shinichi Takahashi,3 Somay Yamagata Murayama,1,2 and Masahiko Nakamura4*

Kitasato Institute for Life Sciences and Graduate School of Infection Control Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8641 Japan,1 Center for Basic Research, The Kitasato Institute, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8642, Japan,2 3rd Department of Internal Medicine, Kyorin University, Mitaka, Tokyo 181-8611, Japan,3 Center for Clinical Pharmacy and Clinical Sciences, School of Pharmaceutical Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8641, Japan4

Received 24 December 2007/ Returned for modification 4 February 2008/ Accepted 12 May 2008


arrow
ABSTRACT
 
Triple-agent therapy with lansoprazole (15 mg/kg)-clarithromycin (50 mg/kg)-amoxicillin (50 mg/kg) twice daily for 7 days fully cleared "Candidatus Helicobacter heilmannii" from infected mouse stomachs. Moreover, gastric mucosa-associated lymphoid tissue lymphoma-like lesions in the stomach nearly disappeared in the treated mice 4 months after the therapy.


arrow
TEXT
 
"Candidatus Helicobacter heilmannii," previously known as Gastrospirillum hominis (4, 9), has a very large number of known mammalian hosts. Though in comparison to Helicobacter pylori it is present at a low prevalence in humans (1), it has been suggested that "Ca. Helicobacter heilmannii" possibly plays a role in the pathogenesis of human gastric B-cell mucosa-associated lymphoid tissue (MALT) lymphoma (5, 7, 8). In vivo mouse models of infection with "Ca. Helicobacter heilmannii" are necessary for screening potential therapeutic agents, and one paper has previously noted that combination therapy with amoxicillin (AMX) and omeprazole results in a decrease in "Ca. Helicobacter heilmannii" DNA in mouse feces (2). However, that study lacked a quantitative analysis of the colonization of "Ca. Helicobacter heilmannii." The objective of this study is to evaluate the efficacy of triple-agent therapy with lansoprazole (LAN)-clarithromycin (CLR)-AMX in the eradication of "Ca. Helicobacter heilmannii" and the remission of gastric MALT lymphoma in mouse models of infection.

Uninfected C57BL/6J mice were inoculated with gastric mucosal homogenates from mice infected with "Ca. Helicobacter heilmannii." Two weeks postinfection, the infected mice were intragastrically administered LAN (15 mg/kg)-CLR (50 mg/kg)-AMX (50 mg/kg) or LAN (15 mg/kg)-azithromycin (AZM; 50 mg/kg)-AMX (50 mg/kg) triple-agent therapy twice daily for 7 days. The efficacy of each therapy was evaluated by the level of the reduction in copy number of 16S rRNA genes of "Ca. Helicobacter heilmannii" in the stomach 1 month after the final treatment. Alternatively, 6-week-old female C57BL/6J mice were inoculated every other day for a total of three times with a 0.1-ml solution containing 1 x 109 CFU of H. pylori and treated with the CLR-containing triple therapy. Figure 1A shows that only 0.6% of the bacterial genes were detected in the mouse stomachs 1 month following the LAN-CLR-AMX triple-agent therapy twice daily for 7 days, compared to the total amount of viable bacterial genes detected in the stomachs of the control group mice. In contrast, triple-agent therapy containing AZM instead of CLR failed to clear "Ca. Helicobacter heilmannii" bacilli in the mouse stomachs. About 30% of the bacterial genes were detected in the mouse stomachs for 1 month after the LAN (15 mg/kg)-AZM (50 mg/kg)-AMX (50 mg/kg) triple-agent therapy. Lower doses of the CLR-containing combination (LAN, 0.6 mg/kg; CLR, 4 mg/kg; and AMX, 15 mg/kg) were suboptimal at clearing "Ca. Helicobacter heilmannii" from the mouse stomachs (data not shown). The ureB gene of H. pylori was not detected in the mouse stomachs 1 month following the high-dose LAN-CLR-AMX triple-agent therapy twice daily for 7 days, in contrast to the 3 x 103 copies of ureB genes detected in the stomachs of the control group mice (Fig. 1B). In fact, no bacterial colony of H. pylori was detected by plating 1 month following the therapy (data not shown). These findings suggest that the high-dose LAN-CLR-AMX triple-agent therapy twice daily for 7 days was effective for the clearance of the Helicobacter species "Ca. Helicobacter heilmannii" and H. pylori from the mouse stomachs. However, it should be noted that this therapeutic approach did not lead to complete clearance of "Ca. Helicobacter heilmannii" in the mouse model of infection.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 1. Comparison of bacterial clearances in two antibiotic combination groups. (A) Six-week-old female C57BL/6J mice were inoculated with gastric mucosal homogenates from mice infected with "Ca. Helicobacter heilmannii" strain TKY using phosphate-buffered saline (pH 7.4) containing 0.01% gelatin and an infection dose of approximately 1 x 104 copies of Helicobacter 16S rRNA genes per mouse (6). Two weeks postinfection, the infected mice were intragastrically administered 0.5% (wt/vol) methylcellulose (400 cP) (column 1), the LAN (15 mg/kg)-CLR (50 mg/kg)-AMX (50 mg/kg) triple-agent therapy (column 2), or the LAN (15 mg/kg)-AZM (50 mg/kg)-AMX (50 mg/kg) triple-agent therapy (column 3) twice daily for 7 days. The efficacy of each therapy was evaluated based on the level of reduction in copy number of 16S rRNA genes of "Ca. Helicobacter heilmannii" in the mouse stomachs 1 month after the final treatment by use of the quantitative real-time PCR method (6). (B) Mice were inoculated every other day for a total of three times with a 0.1-ml solution containing 1 x 109 CFU of highly virulent H. pylori strain TN2GF4, originally isolated from a patient with a gastric ulcer (3), and treated with methylcellulose (column 1) or the LAN-CLR-AMX triple-agent therapy (column 2). The efficacy of the therapy was evaluated based on the level of reduction in copy number of ureB genes of H. pylori. A 110-bp fragment of the ureB gene of H. pylori was amplified with a pair of primers, CLF-s (5'AGCGGGACAGCAGTAAGG3') and CLF-r (5'GCTTGTCTATCAACCAATGCG3'). The results from two experiments, with four to seven mice in each group, were combined. Data represent the means ± standard deviations (n = 8 to 14). ND, not detected. Significant differences were examined using a two-tailed Student t test. A P value of <0.05 was regarded as statistically significant.

Two months postinfection with "Ca. Helicobacter heilmannii," several small, round, and protrusive lesions in the fundic area of the stomach were visible to the naked eye in all of the infected mice. No lesions were detected in any of the uninfected mice. Figure 2A shows that 4.1 x 104 copies of bacterial genes were detected in the stomachs of the control group mice; in contrast, only 90 copies of bacterial genes were detected in mouse stomachs after the high-dose LAN-CLR-AMX triple-agent therapy twice daily for 7 days. Moreover, Fig. 2B shows that quantitative analysis of the lesion area revealed about 80% occupancy of protrusive lesions in the fundic area of stomach tissues in the control group, in contrast to about 10% occupancy of protrusive lesions in the fundic area of stomach tissues in the therapy group. Therefore, it appears to be likely that the protrusive lesions in the fundic area of the mouse stomachs were formed due to persistent infection with "Ca. Helicobacter heilmannii." In that regard, after more than 99% bacterial clearance was achieved by treatment with high-dose LAN-CLR-AMX therapy twice daily for 7 days, most primary lesions disappeared, and the remaining lesions did not develop further in the mouse stomachs. These studies have demonstrated that LAN-CLR-AMX triple-agent therapy can significantly reduce the burden of "Ca. Helicobacter heilmannii" in mice.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 2. Efficacy of bacterial clearance and remission of gastric MALT lymphoma by triple-agent therapy. Mice were infected with "Ca. Helicobacter heilmannii" strain TKY. Two months postinfection, the infected mice were intragastrically administered methylcellulose (column 1) or LAN (15 mg/kg)-CLR (50 mg/kg)-AMX (50 mg/kg) (column 2) twice daily for 7 days. The copy number of 16S rRNA genes (A) and the occupancy ratio of protrusive lesions in the entire fundic mucosa (B) were determined by the quantitative real-time PCR method and by using the public domain NIH Image program (6), respectively, 4 months after the final treatment. The results from two experiments, with four or five mice in each group, were combined. Data represent the means ± standard deviations (n = 8 or 10). Significant differences were examined using a two-tailed Student t test. A P value of <0.05 was regarded as statistically significant.


arrow
ACKNOWLEDGMENTS
 
We thank Yoshihiro Fukuda (Hyogo Medical College) for providing H. pylori strain TN2GF4.

This study was supported by a Grant-in-Aid for Exploratory Research (19659113) from the Japanese Ministry of Education, Culture, Sports, Sciences, and Technology.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address for Hidenori Matsui (correspondence and reprint requests): Laboratory of Immunoregulation, Department of Infection Control and Immunology, Kitasato Institute for Life Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8641, Japan. Phone and fax: 81-3-5791-6267. E-mail: hmatsui{at}lisci.kitasato-u.ac.jp. Mailing address for Masahiko Nakamura: Center for Clinical Pharmacy and Clinical Sciences, School of Pharmaceutical Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8641, Japan. Phone and fax: 81-3-3446-9036. E-mail: nakamuram{at}pharm.kitasato-u.ac.jp Back

{triangledown} Published ahead of print on 19 May 2008. Back


arrow
REFERENCES
 
    1
  1. Fox, J. G. 2002. The non-H pylori helicobacters: their expanding role in gastrointestinal and systemic diseases. Gut 50:273-283.[Abstract/Free Full Text]
    2. 2
  2. Hellemans, A., A. Decostere, F. Haesebrouck, and R. Ducatelle. 2005. Evaluation of antibiotic treatment against "Candidatus Helicobacter suis" in a mouse model. Antimicrob. Agents Chemother. 49:4530-4535.[Abstract/Free Full Text]
    3. 3
  3. Keto, Y., M. Ebata, and S. Okabe. 2001. Gastric mucosal changes induced by long term infection with Helicobacter pylori in Mongolian gerbils: effects of bacteria eradication. J. Physiol. Paris 95:429-436.[CrossRef][Medline]
    4. 4
  4. McNulty, C. A., J. C. Dent, A. Curry, J. S. Uff, G. A. Ford, M. W. Gear, and S. P. Wilkinson. 1989. New spiral bacterium in gastric mucosa. J. Clin. Pathol. 42:585-591.[Abstract/Free Full Text]
    5. 5
  5. Morgner, A., N. Lehn, L. P. Andersen, C. Thiede, M. Bennedsen, K. Trebesius, B. Neubauer, A. Neubauer, M. Stolte, and E. Bayerdorffer. 2000. Helicobacter heilmannii-associated primary gastric low-grade MALT lymphoma: complete remission after curing the infection. Gastroenterology 118:821-828.[CrossRef][Medline]
    6. 6
  6. Nakamura, M., S. Y. Murayama, H. Serizawa, Y. Sekiya, M. Eguchi, S. Takahashi, K. Nishikawa, T. Takahashi, T. Matsumoto, H. Yamada, T. Hibi, K. Tsuchimoto, and H. Matsui. 2007. "Candidatus Helicobacter heilmannii" from a cynomolgus monkey induces gastric mucosa-associated lymphoid tissue lymphomas in C57BL/6 mice. Infect. Immun. 75:1214-1222.[Abstract/Free Full Text]
    7. 7
  7. Okiyama, Y., K. Matsuzawa, E. Hidaka, K. Sano, T. Akamatsu, and H. Ota. 2005. Helicobacter heilmannii infection: clinical, endoscopic and histopathological features in Japanese patients. Pathol. Int. 55:398-404.[CrossRef][Medline]
    8. 8
  8. Regimbeau, C., D. Karsenti, V. Durand, L. D'Alteroche, C. Copie-Bergman, E. H. Metman, and M. C. Machet. 1998. Low-grade gastric MALT lymphoma and helicobacter heilmannii (Gastrospirillum hominis). Gastroenterol. Clin. Biol. 22:720-723. (In French.)[Medline]
    9. 9
  9. Solnick, J. V., and D. B. Schauer. 2001. Emergence of diverse Helicobacter species in the pathogenesis of gastric and enterohepatic diseases. Clin. Microbiol. Rev. 14:59-97.[Abstract/Free Full Text]

Antimicrobial Agents and Chemotherapy, August 2008, p. 2988-2989, Vol. 52, No. 8
0066-4804/08/$08.00+0     doi:10.1128/AAC.01662-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsui, H.
Right arrow Articles by Nakamura, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsui, H.
Right arrow Articles by Nakamura, M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»