This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Walsh, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Walsh, T. R.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, September 2008, p. 3099-3105, Vol. 52, No. 9
0066-4804/08/$08.00+0     doi:10.1128/AAC.01093-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Complete Sequence of p07-406, a 24,179-Base-Pair Plasmid Harboring the blaVIM-7 Metallo-β-Lactamase Gene in a Pseudomonas aeruginosa Isolate from the United States{triangledown}

Hongyang Li,1 Mark A. Toleman,2 Peter M. Bennett,1 Ronald N. Jones,3 and Timothy R. Walsh2*

Department of Cellular Molecular Medicine, University of Bristol, Bristol BS8 1TD, United Kingdom,1 Department of Medical Microbiology, School of Medicine, University of Cardiff, Cardiff CF14 4XN, United Kingdom,2 JMI Laboratories, 345 Beaver Kreek Centre, Suite A, North Liberty, Iowa 523173

Received 21 August 2007/ Returned for modification 2 December 2007/ Accepted 21 June 2008


arrow
ABSTRACT
 
An outbreak involving a Pseudomonas aeruginosa strain that was resistant to all tested antimicrobials except polymyxin B occurred in a hospital in Houston, TX. Previous studies on this strain showed that it possesses a novel mobile metallo-β-lactamase (MBL) gene, designated blaVIM-7, located on a plasmid (p07-406). Here, we report the complete sequence, annotation, and functional characterization of this plasmid. p07-406 is 24,179 bp in length, and 29 open reading frames were identified related to known or putatively recognized proteins. Analysis of this plasmid showed it to be comprised of four distinct regions: (i) a region of 5,200 bp having a Tn501-like mercuric resistance (mer) transposon upstream of the replication region; (ii) a Tn3-like transposon carrying a truncated integron with a blaVIM-7 gene and an insertion sequence inserted at the other end of this transposon; (iii) a region of four genes, upstream of the Tn3-like transposon, possessing very high similarity to plasmid pXcB from Xanthomonas campestris pv. citri commonly associated with plants; (iv) a backbone sequence similar to the backbone structure of the IncP group plasmid Rms149, pB10, and R751. This is the first plasmid to be sequenced carrying an MBL gene and highlights the amelioration of DNA segments from disparate origins, most noticeably from plant pathogens.


arrow
INTRODUCTION
 
In recent years reports of clinical isolates of Pseudomonas aeruginosa resistant to all β-lactams have become increasingly common. In some geographical regions this resistance has risen to approximately 40% to all antipseudomonal β-lactams, including carbapenems (1, 40). A number of these isolates have been shown to produce a metallo-β-lactamase (MBL) enzyme encoded by the transferable gene blaIMP, blaVIM, blaSPM, or blaGIM. (28, 39).

The VIM MBL family was first described in 1999 from a P. aeruginosa isolate in Italy. Subsequently, it was found in different species in Europe, Asia, and, more recently, in the United States (5, 7, 13, 14, 17, 19, 21, 22, 23-25, 27, 33). To date, more than 20 different VIM-type enzymes (http://www.lahey.org) have been identified; the dominant type is VIM-2, which has been found in more than 30 countries (3, 10, 14, 20, 21, 23, 26, 27, 30, 31, 39, 40). The blaVIM gene is often carried on mobile gene cassettes inserted into class 1 integrons and is located either chromosomally or carried on plasmids.

P. aeruginosa strain 07-406 was isolated at a hospital in Houston, TX, from sputum of a cancer patient who presented with pneumonia. This isolate was resistant to all antimicrobials except polymyxin B, according to standard testing methods (4), and also gave a positive result with the MBL Etest strip (AB Biodisk, Solna, Sweden) (37).

The MBL gene (blaVIM-7) from P. aeruginosa 07-406 and its immediate genetic context have been previously characterized (37). The encoded enzyme shares 77% identity with VIM-1 and 74% with VIM-2; it is the most divergent of the VIM MBLs characterized thus far and constitutes the third subgroup among the VIM-type β-lactamase family. blaVIM-7 was shown to be located on a plasmid of approximately 24 kb (37).

Herein, we report the full nucleotide sequence of plasmid p07-406, including its complete annotation, and examine its functional characteristics.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids. P. aeruginosa strain 07-406 carrying plasmid p07-406 was used for plasmid isolation. Escherichia coli strain DH5{alpha} [{lambda} {phi}80dlacZ{Delta}M15 {Delta}(lacZYA-argF)U169 recA1 endA1 hsdR17(rK mK) supE44 thi-1 gyrA relA1] was used as the recipient host for p07-406, and its fragments were cloned into pK18 as described previously (38).

Antimicrobials, reagents, and mercury susceptibility testing. Antimicrobial agents used in this study were ceftazidime (GlaxoSmithKline, Worthing, United Kingdom) and kanamycin (Sigma Chemical Co., St. Louis, MO). Other general reagents were purchased from Sigma Chemical Co. or BDH (Poole, United Kingdom). Mercury resistance testing was carried out by plating 105 CFU in 5 µl onto Muller Hinton agar containing serial dilutions of mercury (HgCl) in a manner similar to one previously described (18).

Plasmid subcloning construction, sequencing, and sequence analysis. p07-406 plasmid DNA was isolated by an alkaline lysis method and the Qiagen maxi plasmid isolation kit (Qiagen Ltd., Cranley, United Kingdom). Plasmid DNA was restricted into four fragments (7.3 kb, 6.3 kb, 5.5 kb, and 5 kb) by EcoRI, which were subcloned into pK18 (38). Clones were sequenced on both strands by the dideoxynucleotide chain termination method. (ABC Sequencing Centre, Imperial College, London, United Kingdom). Sequence reads were assembled by Seqman (DNASTAR software [http://www.ebi.ac.uk/fasta33/nucleotide.html]), and finishing methods were included using the parent plasmid as a sequencing template for completing sequences across each junction. Sequencing analysis was performed with the Lasergene DNASTAR software package. The nucleotides were searched for potential open reading frames (ORFs) by using BLAST (http://www.ebi.ac.uk/blast2) against the EMBL prokaryotic database (http://www.ebi.ac.uk/embl/index.html).

Conjugations. Donor (strain 07-406) and recipient bacterial cells (rifampin-resistant mutants of E. coli DH5{alpha} and P. aeruginosa strain PAO1) were grown separately to mid-log phase and harvested by centrifugation (at 12,000 x g), and the supernatant was discarded. The pellets were resuspended, and the cell suspensions were mixed together in a donor/recipient ratio of 1:1, spread on a nutrient agar plate without selective antibiotics, and incubated for 18 h at 37°C. The cell mixture was then plated onto selective medium (ceftazidime at 10 and 50 µg/ml and rifampin at 50 µg/ml) and incubated for 18 h at 37°C. E. coli DH5{alpha} and P. aeruginosa strain PAO1 carrying pUB6061 (kanamycin resistance) were used as positive controls for the mating experiments, as previously described (2).

Electroporation of p07-406. Plasmid p07-406 was extracted using a Qiagen maxi kit and transformed by electroporation into rifampin-resistant mutants of either E. coli DH5{alpha} or P. aeruginosa PAO1. Electroporation was carried out at 2.5 kV, 25 µF, and 200 {Omega} with a Genepulser apparatus (Bio-Rad Laboratories, Corston, United Kingdom). Electrotransformants were selected on LB medium supplemented with ceftazidime (10 and 50 µg/ml) and rifampin (50 µg/ml).

Nucleotide sequence accession number. The full sequence of plasmid p07-406 has been deposited under accession number AM 778842.


arrow
RESULTS AND DISCUSSION
 
General features of p07-406. Plasmid p07-406 consists 24,179 nucleotides and possesses an overall GC content of 63.81%. It is predicted to contain a total of 29 ORFs possessing significant homology to functional proteins from databases. The deduced physical and genetic maps of p07-406 are shown in Fig. 1, and the genes are listed in Table 1. Numbering of this plasmid starts with the merR gene in the Tn501-like transposon. The main regions in this plasmid are the following: (i) a region of 5,200 bp having a Tn501-like mercuric resistance (mer) transposon upstream of replication region; (ii) a Tn3-like transposon carrying a truncated integron with the blaVIM-7 gene and an insertion sequence inserted at the other end of this transposon; (iii) a region of four genes, upstream of the Tn3-like transposon, possessing very high similarity to a plasmid pXcB from Xanthomonas campestris pv. citri commonly associated with plants; and (iv) a backbone sequence similar to the backbone structure of the IncP group plasmids Rms149, pB10, and R751.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 1. (A) Genetic map of plasmid p07-406 (accession number AM778842) showing the arrangement of the major DNA segments. Blue, Tra region; red, Mer; green, Rep; pink, ParA and ParC; yellow, class 1 integron containing blaVIM-7; and aqua, ParE. (B) Physical maps of the regions containing transposons and transfer regions in plasmid p07-406.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Predicted ORFs in plasmid p07-406

Replication and partition region. The putative gene for replication (rep) of p07-406 was identified and was found to encode a 491-amino-acid protein. The highest level of similarity at the amino acid level is 75.3% identity to the putative replication protein from the IncP-6 plasmid, Rms149, characterized from P. aeruginosa strain Ps142 (accession no. NC007100). This Rep protein is also related (68% identity) to the replication protein encoded by an IncU plasmid, pFBAOT6 (accession no. CR376602), characterized from Aeromonas caviae (Fig. 2). The replicative origins of these two plasmids remain unclear (9, 29). Furthermore, we were unable to identify any of the promoter consensus sequences in the rep gene (36). Most notably, the series of identical direct repeat sequences proposed to be involved in the replication function in both Rms149 and pFBAOT6 (two copies in Rms 149 and five copies in pFBAOT6; accession numbers NC007100 and CR376602, respectively) were not found in the corresponding region of plasmid p07-406. Therefore, the rep region carried by p07-406 is clearly atypical.


Figure 2
View larger version (70K):
[in this window]
[in a new window]

 
FIG. 2. Alignment of replication protein (RepA pro) of p07-406 with its closest relatives from IncP-6 plasmid Rms 149 and IncU plasmid pFBAOT6 (accession numbers NC007100 and CR376602, respectively). A black background indicates amino acids that are fully conserved.

The parC gene immediately next to the rep gene is most closely related to the parC gene (44.9%) carried on the IncP-6 plasmid Rms149 (accession no. NC007100). Interestingly, a cluster of three genes downstream of parC show very high identity (94.5%, 100%, and 94%) to orf215, parA1, and orf217, respectively, carried on plasmid pXcB from a X. campestris pv. citri strain, originating from South America and involved in the disease citrus canker (accession numbers NC005240 and AY228335).

The last gene of this region was predicted to encode a resolvase protein possessing 84.5% identity to ParA in Xanthomonas axonopodis pv. citri (accession number NC003921). There is a 16-bp inverted repeat flanking the orf215 and parA1 genes and a predicted stem-loop structure between the orf217 and parA genes. The parABC genes play a very important role in the inheritance of plasmid (6, 12, 34, 35); however, thus far, no definitive function has been attributed to either orf215 or orf217. It is unclear as to whether p07-406 possesses a ParB-type function and, if so, which ORF serves this role. It is possible that this is in part addressed by the function of KfrA.

In p07-406 the kfrA gene is separated from this section by insertion of a Tn501-like transposon between kfrA and repA. The predicted product of kfrA possesses 57% identity to the KfrA protein from plasmids R751 or pADP-1 (accession numbers AJ877225 and NC004956, respectively).

E. coli and the P. aeruginosa PAO1 strain were transformed to ceftazidime resistance by p07-406. The transformants appeared to be very stable, with 100% retention after 20 passages in nonselective growth medium; accordingly, it may be assumed that the kfrA gene from p07-406 is functional.

Nonfunctional transfer region. To determine the transfer region of p07-406, conjugation experiments were undertaken to examine the possibility of transferring the plasmid from P. aeruginosa 07-406 (donor) to E. coli DH5{alpha} and P. aeruginosa PAO1 (recipients). p07-406 failed to transfer to the recipient strains using conjugation under laboratory conditions. However, p07-406 could be readily transferred by electroporation into both E. coli DH5{alpha} and P. aeruginosa PAO1.

The proposed conjugative region between bp 17006 and 22956 possesses a GC content of 66.3% and contains the loci trb (trbL, trbK, and trbJ) and tra (traI, traJ, and traK). These regions are very closely related to their corresponding counterparts of the IncP group plasmid pB10 (accession number AJ564903) isolated from a wastewater treatment plant and another IncP group plasmid pADP-1 (accession number NC 004956), as well as R751 (accession number AJ877225). The transfer region of p07-406 is approximately 6 kb. Comparisons with the functional transfer region of related plasmid R751 (Fig. 3) showed that there are many more genes present and involved in its conjugative transfer function, although in R751 the tra and trb regions are interrupted by insertion of a transposable element (accession numbers X5548 and U07618). The essential tra function genes traF and traG are missing in p07-406 (16). The trb region possesses genes (trbM, trbN, and trbP) which are known not to be essential for plasmid transfer and all are missing from p07-406 (14, 15). The largest segment normally associated with this locus and present in R751, trbA to trbI (accession number U07618) which is thought to play an unknown role in transfer, is also absent in p07-406.


Figure 3
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 3. Comparison of the transfer regions of plasmids p07-406 and R751. Genes are shown by arrows indicating the direction of transcription. The trb region is represented by gray fill; the tra region is shown as open arrows. The origin of transfer (oriT) in R751 and the predicted oriT are denoted by black circles. Genes encoding similar products are connected by broken lines. In the case of R751, the tra and trb regions are not adjacent to each other.

We attempted to identify the putative oriT of p07-406 by comparing it to the corresponding oriT sequence from plasmids R751 and RP4 (Fig. 4). The predicted oriT sequences are highly conserved and contain several inverted repeats that may be involved in target recognition during DNA processing. These data also suggest that the lack of transfer functions possessed by p07-406 may not relate to the oriT structure. These data would explain the lack of conjugation under experimental conditions.


Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 4. Proposed oriT region of p07-406 aligned with the oriT region from plasmids R751 and RP4. The nucleotide numbers for the region in p07-406 are indicated on the right. A black background indicates residues that are fully conserved. seq, sequence.

Plasmid p07-406 contains a Tn501-like transposon. p07-406 possesses a 5,200-bp region encoding the mercuric resistance (mer) transposon which has a GC content of 63% (Table 1). This mercuric resistance region of p07-406 is highly homologous to the transposon Tn501 even though it does not possess the tnpA gene required for transposition (accession number Z00027). The merA region of p07-406 displays 99.8% identity to the merA gene in Tn501. Adjacent to this region is the helix-turn-helix-type transcriptional regulator gene merD and another mercuric resistance gene, merE. Downstream of merD and merE is a large ORF, orf2, encoding a protein of 329 amino acids which is thought to play a role in the signaling cascade to MerR and MerD. This internal resolution site (res) located upstream of the tnpR gene is 127 bp long and homologous to the res site in Tn501. The transposase gene, tnpA, commonly found in Tn501 is not present in p07-406, presumably because it was deleted during the transposition event into this plasmid. In p07-406, there is a 25-bp inverted repeat sequence CGTGCTTTATTTTCCGTTTTCTGAG/CTCAGAAAACGGAAAATAAAGCACG immediately flanking the Tn501-like transposon.

The level or resistance to Hg ions was 8 µg/ml in E. coli carrying p07-406 and 16 µg/ml in the host strain (P. aeruginosa 07-406) compared to 0.25 µg/ml for the E. coli DH5{alpha} alone, indicating that the mer region is likely to be functional.

The Tn3 family transposon carries a truncated integron with the blaVIM-7 gene and an insertion sequence. There is a second transposition element present in this plasmid between bp 10913 and 14550 immediately downstream of the partition region and possessing a GC content of 59%. This region has a truncated class 1 integron, carrying the blaVIM-7 gene, inserted into transposase gene tnpM. This gene is also truncated, only having 257 bp left from the N terminus, but the amino acid sequence showed 98% identity to other transposases from various plasmids including R478 and pAPEC-O1-R (8, 11). Another transposase gene, orfL1, possessing 70% identity to an insertion element from Janthinobacterium spp., is located downstream of the aacA4. Therefore, given the evidence, it is likely that orfL1 inserted into the aac gene cassette of the class 1 integron (also carrying blaVIM-7) and that this region inserted into transposase gene tnpM.

Other unknown regions. p07-406 possesses a large section of DNA (bp 14690 to 16682, between the Tn3-like transposon and the conjugative transfer region) having a GC content of 66%, but the encoded products from these ORFs have no defined function. Genes denoted p07-406.19 and p07-406.20 (downstream of the Tn3-like transposon) show homology to genes carried on the plasmid, pB8, from P. aeruginosa. p07-406.19 displays 75% identity to a unknown gene, orf3, and p07-406.20 encodes a protein possessing 80% identity to a plasmid stabilization protein, ParE (encoded on plasmid pB8) (32). Genes p07-406.21 and p07-406.22 (adjacent to the aforementioned p07-406.19 and p07-406.20) also encode proteins of undefined function. However, it is possible that this region is involved in either plasmid stabilization and/or transfer.

Conclusions. Our molecular studies on plasmid p07-406 have revealed significant sections of the plasmid containing DNA related to the plant pathogen X. campestris pv. citri. The overall GC content of p07-406 is 64%, which suggests that it did not originate in Enterobacteriaceae but in environmental bacteria such as Pseudomonas or Xanthomonas (36). The two main segments of p07-406 (for conjugative transfer and mating-pair formation, on the one hand, and replication and stable inheritance, on the other) are derived from different ancestral IncP-type plasmids. Different sections of this plasmid suggest that p07-406 has been created from both environmental (plants) and clinical DNA segments. This is the first report of the complete nucleotide sequence of a plasmid harboring an MBL gene, in this case, blaVIM-7, from the United States.


arrow
ACKNOWLEDGMENTS
 
This work was funded by EU grant LSHM-CT-2005-018705.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Medical Microbiology, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, United Kingdom. Phone: 44 29 2074 4725. Fax: 44 29 2074 2161. E-mail: WalshTR{at}Cardiff.ac.uk Back

{triangledown} Published ahead of print on 30 June 2008. Back


arrow
REFERENCES
 
    1
  1. Andrade, S. S., R. N. Jones, A. C. Gales, and H. S. Sader. 2003. Increasing prevalence of antimicrobial resistance among Pseudomonas aeruginosa isolates in Latin American medical centres: 5 year report of the SENTRY Antimicrobial Surveillance Program (1997-2001). J. Antimicrob. Chemother. 52:140-147.[Free Full Text]
  2. 2
  3. Avison, M. B., T. R. Walsh, and P. M. Bennett. 2001. pUb6060: a broad-host-range, DNA polymerase-I-independent ColE2-like plasmid. Plasmid 45:88-100.[CrossRef][Medline]
  4. 3
  5. Cardoso, O., R. Leitao, A. Figueiredo, J. C. Sousa, A. Duarte, and L. V. Peixe. 2002. Metallo-β-lactamase VIM-2 in clinical isolates of Pseudomonas aeruginosa from Portugal. Microb. Drug. Resist. 8:93-97.[CrossRef][Medline]
  6. 4
  7. Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial susceptibility testing, 15th informational supplement. CLSI/NCCLS M100-S15. Clinical and Laboratory Standards Institute, Wayne, PA.
  8. 5
  9. Cornaglia, G., A. Mazzariol, L. Lauretti, G. M. Rossolini, and R. Fontana. 2000. Hospital outbreak of carbapenem-resistant Pseudomonas aeruginosa producing VIM-1, a novel transferable metallo-β-lactamase. Clin. Infect. Dis. 31:1119-1125.[CrossRef][Medline]
  10. 6
  11. Gerlitz, M., O. Hrabak, and H. Schwab. 1990. Partitioning of broad-host-range plasmid RP4 is a complex system involving site-specific recombination. J. Bacteriol. 172:6194-6203.[Abstract/Free Full Text]
  12. 7
  13. Giakkoupi, P., A. Xanthaki, M. Kanelopoulou, A. Vlahaki, V. Miriagou, S. Kontou, E. Papafraggas, H. Malamou-Lada, L. S. Tzouvelekis, N. J. Legakis, and A. C. Vatopoulos. 2003. VIM-1 metallo-β-lactamase-producing Klebsiella pneumoniae strains in Greek hospitals. J. Clin. Microbiol. 41:3893-3896.[Abstract/Free Full Text]
  14. 8
  15. Gilmour, M. W., N. R. Thomson, M. Sanders, J. Parkhill, and D. E. Taylor. 2004. The complete nucleotide sequence of the resistance plasmid R478: defining the backbone components of incompatibility group H conjugative plasmids through comparative genomics. Plasmid 52:182-202.[CrossRef][Medline]
  16. 9
  17. Haines, A. S., K. Jones, M. Cheung, and C. M. Thomas. 2005. The IncP-6 plasmid Rms149 consists of a small mobilizable backbone with multiple large insertions. J. Bacteriol. 187:4728-4738.[Abstract/Free Full Text]
  18. 10
  19. Jeong, S. H., K. Lee, Y. Chong, J. H. Yum, S. H. Lee, H. J. Choi, J. M. Kim, K. H. Park, B. H. Han, S. W. Lee, and T. S. Jeong. 2003. Characterization of a new integron containing VIM-2, a metallo-β-lactamase gene cassette, in a clinical isolate of Enterobacter cloacae. J. Antimicrob. Chemother. 51:397-400.[Abstract/Free Full Text]
  20. 11
  21. Johnson, T. J., Y. M. Wannemeuhler, and J. A. Scaccianoce. 2006. Complete DNA sequence, comparative genomics, and prevalence of an IncHI2 plasmid occurring among extraintestinal pathogenic Escherichia coli isolates. Antimicrob. Agents Chemother. 50:3929-3933.[Abstract/Free Full Text]
  22. 12
  23. Kwong, S. M., C. C. Yeo, and C. L. Poh. 2001. Molecular analysis of the pRA2 partitioning region: ParB autoregulates parAB transcription and forms a nucleoprotein complex with the plasmid partition site, parS. Mol. Microbiol. 40:621-633.[CrossRef][Medline]
  24. 13
  25. Lauretti, L., M. L. Riccio, A. Mazzariol, G. Cornaglia, G. Amicosante, R. Fontana, and G. M. Rossolini. 1999. Cloning and characterization of blaVIM, a new integron-borne metallo-β-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob. Agents Chemother. 43:1548-1590.
  26. 14
  27. Lee, K., J. B. Lim, J. H. Yum, D. Yong, Y. Chong, J. M. Kim, and D. M. Livermore. 2002. blaVIM-2 cassette-containing novel integrons in metallo-β-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob. Agents and Chemother. 46:1053-1058.[Abstract/Free Full Text]
  28. 15
  29. Lessl, M., D. Balzer, K. Weyrauch, and E. Lanka. 1993. The mating pair formation system of plasmid RP4 defined by RSF1010 mobilization and donor-specific phage propagation. J. Bacteriol. 175:6415-6425.[Abstract/Free Full Text]
  30. 16
  31. Lessl, M., W. Pansegrau, and E. Lanka. 1992. Relationship of DNA-transfer-systems: essential transfer factors of plasmids RP4, Ti and F share common sequences. Nucleic Acids Res. 25:6099-6100.
  32. 17
  33. Lombardi, G., F. Luzzaro, J. D. Docquier, M. L. Riccio, M. Perilli, A. Coli, G. Amicosante, G. M. Rossolini, and A. Toniolo. 2002. Nosocomial infections caused by multidrug-resistant isolates of Pseudomonas putida producing VIM-1 metallo-β-lactamase. J. Clin. Microbiol. 40:4051-4055.[Abstract/Free Full Text]
  34. 18
  35. Mantengoli, E., and G. M. Rossolini. 2005. Tn5393d, a complex Tn5393 derivative carrying the PER-1 extended-spectrum β-lactamase gene and other resistance determinants. Antimicrob. Agents Chemother. 49:3289-3296.[Abstract/Free Full Text]
  36. 19
  37. Mavroidi, A., A. Tsakris, E. Tzelepi, S. Pournaras, V. Loukova, and L. S. Tzouvelekis. 2000. Carbapenem-hydrolysing VIM-2 metallo-β-lactamase in Pseudomonas aeruginosa from Greece. J. Antimicrob. Chemother. 46:1041-1042.[Free Full Text]
  38. 20
  39. Mendes, R. E., M. Castanheira, P. Garcia, M. Guzman, M. A. Toleman, T. R. Walsh, and R. N. Jones. 2004. First isolation of blaVIM-2 in Latin America: report from the SENTRY Antimicrobial Surveillance Program. Antimicrob. Agents Chemother. 48:1433-1434.[Free Full Text]
  40. 21
  41. Pallecchi, L., M. L. Riccio, J. D. Docquier, R. Fontana, and G. M. Rossolini. 2001. Molecular heterogeneity of blaVIM-2-containing integrons from Pseudomonas aeruginosa plasmids encoding the VIM-2 metallo-β-lactamase. FEMS Microbiol. Lett. 195:45-50.
  42. 22
  43. Poirel, L., T. Naas, D. Nicolas, L. Collet, S. Bellais, J. D. Cavallo, and P. Nordmann. 2000. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-β-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother. 44:891-897.[Abstract/Free Full Text]
  44. 23
  45. Poirel, L., L. Collet, and P. Nordmann. 2000. Carbapenem-hydrolyzing metallo-β-lactamase from a nosocomial isolate of Pseudomonas aeruginosa in France. Emerg. Infect. Dis. 6:84-85.[Medline]
  46. 24
  47. Poirel, L., T. Lambert, S. Turkoglu, E. Ramo, L. Gaillard, and P. Nordmann. 2001. Characterization of class 1 integrons from Pseudomonas aeruginosa that contain the blaVIM-2 carbapenem-hydrolyzing β-lactamase gene and of two novel aminoglycoside resistance gene cassettes. Antimicrob. Agents Chemother. 45:546-552.[Abstract/Free Full Text]
  48. 25
  49. Pournaras, S., A. Tsakris, M. Maniati, L. S. Tzouvelekis, and A. N. Maniatis. 2002. Novel variant (blaVIM-4) of the metallo-β-lactamase gene blaVIM-1 in a clinical strain of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 46:4026-4028.[Abstract/Free Full Text]
  50. 26
  51. Pournaras, S., M. Maniati, E. Petinaki, L. S. Tzouvelekis, A. Tsakris, N. J. Legakis, and A. N. Maniatis. 2003. Hospital outbreak of multiple clones of Pseudomonas aeruginosa carrying the unrelated metallo-β-lactamase gene variants blaVIM-2 and blaVIM-4. J. Antimicrob. Chemother. 51:1409-1414.[Abstract/Free Full Text]
  52. 27
  53. Prats, G., E. Miro, B. Mirelis, L. Poirel S. Bellais, and P. Nordmann. 2002. First isolation of a carbapenem-hydrolyzing β-lactamase in Pseudomonas aeruginosa in Spain. Antimicrob. Agents Chemother. 46:932-933.[Free Full Text]
  54. 28
  55. Queenan, A. M., and K. Bush. 2007. Carbapenemases: the versatile β-lactamases. Clin. Microbiol. Rev. 20:440-458.[Abstract/Free Full Text]
  56. 29
  57. Rhodes, G., J. Parkhill, C. Bird, K. Ambrose, M. C. Jones, G. Huys, J. Swings, and R. W. Pickup. 2004. Complete nucleotide sequence of the conjugative tetracycline resistance plasmid pFBAOT6, a member of a group of IncU plasmid with global ubiquity. Appl. Environ. Microbiol. 70:7497-7510.[Abstract/Free Full Text]
  58. 30
  59. Riccio, M. L., L. Pallecchi, R. Fontana, and G. M. Rossolini. 2001. In70 of plasmid pAX22, a blaVIM-1-containing integron carrying a new aminoglycoside phosphotransferase gene cassette. Antimicrob. Agents Chemother. 45:1249-1253.[Abstract/Free Full Text]
  60. 31
  61. Sardelic, S., L. Pallecchi, V. Punda-Polic, and G. M. Rossolini. 2003. Carbapenem-resistant Pseudomonas aeruginosa-carrying VIM-2 metallo-β-lactamase determinants, Croatia. Emerg. Infect. Dis. 9:1022-1023.[Medline]
  62. 32
  63. Schluter, A., H. Heuer, R. Szczepanowski, S. M. Poler, S. Schneiker, A. Puhler, and E. M. Top. 2005. Plasmid pB8 is closely related to the prototype IncP-1 β plasmid R751 but transfers poorly to Escherichia coli and carries a new transposon encoding a small multi-drug resistance efflux protein. Plasmid 54:135-148.[CrossRef][Medline]
  64. 33
  65. Scoulica, E. V., I. K. Neonakis, A. I. Gikas, and Y. J. Tselentis. 2004. Spread of blaVIM-1-producing Escherichia coli in a university hospital in Greece. Genetic analysis of the integron carrying the blaVIM-1 metallo-β-lactamase gene. Diagn. Microbiol. Infect. Dis. 48:167-172.[CrossRef][Medline]
  66. 34
  67. Sia, E. A., R. C. Roberts, C. Easter, D. R. Helinski, and D. H. Figurski. 1995. Different relative importance of the par operons and the effect of conjugal transfer on the maintenance of intact promiscuous plasmid RK2. J. Bacteriol. 177:2789-2797.[Abstract/Free Full Text]
  68. 35
  69. Sobecky, P. A., C. L. Easter, P. D. Bear, and D. R. Helinski. 1996. Characterization of the stable maintenance properties of the par region of broad-host-range plasmid RK2. J. Bacteriol. 178:2086-2093.[Abstract/Free Full Text]
  70. 36
  71. Thorsted, P. B., D. P. Macartney, P. Akhtar, A. S. Haines, N. Ali, P. Davidson, T. Stafford, M. J. Pocklington, W. Pansegrau, B. M. Wilkins, E. Lanka, and C. M. Thomas. 1998. Complete sequence of the IncP beta plasmid R751: implications for evolution and organisation of the IncP backbone. J. Mol. Biol. 282:969-990.[CrossRef][Medline]
  72. 37
  73. Toleman, M. A., K. Rolston, R. N. Jones, and T. R. Walsh. 2004. blaVIM-7, an evolutionarily distinct metallo-β-lactamase gene in a Pseudomonas aeruginosa isolate from the United States. Antimicrob. Agents Chemother. 48:329-332.[Abstract/Free Full Text]
  74. 38
  75. Walsh, T. R., M. A. Toleman, W. Hryniewicz, P. M. Bennett, and R. N. Jones. 2003. Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program. J. Antimicrob. Chemother. 52:116-119.[Abstract/Free Full Text]
  76. 39
  77. Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo-β-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306-325.[Abstract/Free Full Text]
  78. 40
  79. Zavascki, A. P., P. B. Gaspareto, A. F. Martins, A. L. Goncalves, and A. L. Barth. 2005. Outbreak of carbapenem-resistant Pseudomonas aeruginosa producing SPM-1 metallo-β-lactamase in a teaching hospital in southern Brazil. J. Antimicrob. Chemother. 56:1148-1151.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, September 2008, p. 3099-3105, Vol. 52, No. 9
0066-4804/08/$08.00+0     doi:10.1128/AAC.01093-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Walsh, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Walsh, T. R.