Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, M. Articles by Hooper, D. C. Search for Related Content PubMed PubMed Citation Articles by Wang, M. Articles by Hooper, D. C.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, February 2009, p. 821-823, Vol. 53, No. 2
0066-4804/09/$08.00+0     doi:10.1128/AAC.00132-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

SOS Regulation of qnrB Expression

Minghua Wang,^1,2 George A. Jacoby,^3* Debra M. Mills,³ and David C. Hooper¹

Massachusetts General Hospital, Boston, Massachusetts,¹ Institute of Antibiotics, Huashan Hospital, Fudan University, Shanghai, China,² Lahey Clinic, Burlington, Massachusetts³

Received 30 January 2008/ Returned for modification 3 April 2008/ Accepted 12 November 2008

Top ABSTRACT INTRODUCTION REFERENCES

 
In the sequence upstream from qnrB (but not qnrA or qnrS) is a LexA binding site. qnrB was shown to be under SOS control by demonstrating that quinolone susceptibility decreased with increasing temperature in a strain with a recA441(Ts) allele, whereas qnrB expression increased in response to ciprofloxacin or mitomycin C in strains with an intact lexA gene.

Top ABSTRACT INTRODUCTION REFERENCES

 
Plasmid-mediated Qnr proteins provide low-level quinolone resistance and protect bacterial DNA gyrase and topoisomerase IV from quinolone inhibition (21, 22). QnrA, QnrB, and QnrS are currently known (7, 10, 14). All are pentapeptide repeat proteins differing from each other by 40% or more in amino acid sequence, while within each type minor variations in sequence define alleles such as QnrB1 and QnrB2 (18). In addition to protecting DNA gyrase, QnrB1 (but not QnrA1) at high concentrations has been shown to inhibit the enzyme in vitro, which may explain the bacterial growth inhibition observed when the gene is maximally expressed (10). We have discovered that qnrB is regulated by the SOS system so that quinolone exposure augments its expression.

Table 1 shows the DNA sequences at the starts of the qnr genes. Two in-phase ATG start codons are present in qnrB1, qnrB3, and qnrB5. In qnrB2 and qnrB4 the first ATG is out of phase with the remainder of the reading frame, suggesting that for all five alleles translation may be initiated at the second ATG codon. Between the two start codons is a LexA binding site or box, the canonical sequence of which is TACTGTATATATATACAGTA with the 5'-CTGT essential and the central (AT)₄ known to vary in different LexA boxes (4, 23). No LexA binding site was found upstream from qnrA1 or qnrS1. A similar LexA box, however, is found upstream from all those qnrB alleles in GenBank for which this region of the sequence has been reported, including qnrB6, qnrB10, qnrB12, qnrB13, qnrB14, qnrB15, qnrB16, qnrB17, and qnrB18 (8).

View this table: [in this window] [in a new window]

TABLE 1. Nucleotide sequences at the starts of plasmid-mediated qnrB, qnrA, and qnrS alleles

To determine whether expression of qnrB alleles is under SOS control, plasmids were introduced into Escherichia coli GW1000 (11) with recA441, which encodes a RecA protease that is more easily activated, so that the strain would be SOS inducible at 30°C but constitutive at 42°C, and into E. coli J53 azide^r (9), which has wild-type lexA and recA alleles. qnrB1 plasmid pMG298 (10), qnrB2 plasmid pMG301 (10), qnrB3 plasmid pMG317 (19), qnrB4 plasmid pMG319 (19), qnrB5 plasmid pMG305 (6), and qnrA1 plasmid pMG252 (14) (all natural plasmids) were introduced by conjugation. Tra^– qnrS1 plasmid pMG306 (6) was introduced into GW1000 by transformation.

As shown in Table 2 GW1000 derivatives containing plasmids with qnrB alleles demonstrated two- to eightfold decreases in ciprofloxacin susceptibility as the growth temperature increased. R^– GW1000 also showed a decrease in susceptibility with rising temperature, but the decrease was less than that observed in qnrB derivatives. A two- to threefold decrease in susceptibility was also seen in strains with plasmids carrying qnrA1 or qnrS1 alleles. In E. coli J53 with unmodified SOS regulation, temperature had only a twofold effect on the level of qnrB1-mediated ciprofloxacin resistance.

View this table: [in this window] [in a new window]

TABLE 2. Quinolone susceptibility as a function of temperature in strains with varying SOS response regulation

While the trend observed suggested that qnrB alleles are specifically regulated by the SOS system, the MIC results were not clear-cut because of a background effect of temperature on quinolone susceptibility. To document SOS regulation directly, the expression of qnr genes was measured by real-time quantitative PCR after a 15- to 30-min exposure to agents known to trigger the SOS response. Strains were grown in LB broth at 37°C to exponential phase in triplicate. When the optical density at 600 nm reached 0.08 to 0.1, 0.1 µg/ml ciprofloxacin or 0.2 µg/ml mitomycin C was added, leaving one culture as a control. Aliquots (200 to 300 µl) were treated with RNAprotect bacteria reagent (Qiagen, Valencia, CA) and centrifuged, the pellet was briefly frozen and treated with lysozyme, and the RNA was extracted with an RNeasy Mini kit (Qiagen) and treated with Turbo DNA-free (Ambion, Austin, TX). cDNA synthesis was performed with a Verso reverse transcription-PCR kit (Abgene, Epsom, United Kingdom) using gene-specific reverse primers (Table 3). Quantitative PCR amplification was conducted in an MJ Research PTC-200 thermal cycler with a Chromo4 detector (Bio-Rad, Hercules, CA) using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the listed primers (Table 3). The housekeeping mdh (malate dehydrogenase) gene was used as an internal control and did not change in response to the inducing agents. Experiments were repeated at least twice. RNA transcript levels were calculated using the 2^–CT method (12), where C_T is the cycle number of the detection threshold, and are expressed relative to levels in the unsupplemented control.

View this table: [in this window] [in a new window]

TABLE 3. Primers used for RT-PCR

Table 4 shows that in E. coli J53 with intact lexA and recA genes expression of qnrB alleles increased between 2.1- and 9.9-fold in response to the inducing agents while expression of qnrA1 was unchanged. Proof that this increase in qnrB expression required an intact SOS system was obtained with a set of related strains. Expression of qnrB4 increased in response to ciprofloxacin or mitomycin C in E. coli AB1157 with wild-type lexA and recA genes but not in two strains derived from it: strain AB1157 LexA300::spec, which has a defective LexA protein so that LexA-regulated genes are constitutively expressed, or strain DM49 (15), which has a protease-resistant LexA product and consequently is defective in SOS induction.

View this table: [in this window] [in a new window]

TABLE 4. Expression of qnr alleles

The SOS response is triggered by DNA damage, such as that generated by quinolones (13, 24). The RecA protein is activated by single-stranded DNA and acts as a coprotease to cleave the LexA protein, which otherwise binds as a dimer to LexA boxes, repressing expression of adjacent genes. More than 40 genes or operators on the chromosome of E. coli are so regulated (4, 5). Most are involved in DNA repair or regulation of cell division. The native function of qnr genes is not known. They have been found on the chromosome of both gram-negative and gram-positive bacteria (1, 2, 16, 17, 20). SOS regulation of QnrB could be a carryover reflecting a role for this topoisomerase-interacting protein in response to DNA damage. Alternatively, SOS regulation serves to protect the host cell from the potentially toxic effects of QnrB while allowing augmented production upon exposure to quinolone antimicrobial agents. Since the SOS response also results in derepression of specialized DNA polymerases that promote quinolone resistance by mutations (3), it thus coordinates both qnrB plasmid-mediated and chromosomal target-derived resistance.

 
We thank Jamie Foti and Graham Walker for providing E. coli DM49, GW1000, and AB1157 LexA300::spec and the E. coli Genetic Resource Center for E. coli AB1157.

M.W. was supported by the China Scholarship Council and grant no. 2005CB0523101 from the National Basic Research Program of China from the Ministry of Science and Technology. The work was also supported by grants AI43312 (G.A.J.) and AI57576 (D.C.H.) from the National Institutes of Health, U.S. Public Health Service.

 
* Corresponding author. Mailing address: 41 Mall Road, Burlington, MA 01805. Phone: (781) 744-2928. Fax: (781) 744-5486. E-mail: george.a.jacoby{at}lahey.org

Published ahead of print on 24 November 2008.

Top ABSTRACT INTRODUCTION REFERENCES

 

1
1. Arsène, S., and R. Leclercq. 2007. Role of a qnr-like gene in the intrinsic resistance of Enterococcus faecalis to fluoroquinolones. Antimicrob. Agents Chemother. 51:3254-3258.[Abstract/Free Full Text]
2
2. Cattoir, V., L. Poirel, D. Mazel, C.-J. Soussy, and P. Nordmann. 2007. Vibrio splendidus as the source of plasmid-mediated QnrS-like quinolone resistance determinants. Antimicrob. Agents Chemother. 51:2650-2651.[Free Full Text]
3
3. Cirz, R. T., and F. E. Romesberg. 2006. Induction and inhibition of ciprofloxacin resistance-conferring mutations in hypermutator bacteria. Antimicrob. Agents Chemother. 50:220-225.[Abstract/Free Full Text]
4
4. Courcelle, J., A. Khodursky, B. Peter, P. O. Brown, and P. C. Hanawalt. 2001. Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics 158:41-64.[Abstract/Free Full Text]
5
5. Fernandez De Henestrosa, A. R., T. Ogi, S. Aoyagi, D. Chafin, J. J. Hayes, H. Ohmori, and R. Woodgate. 2000. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol. Microbiol. 35:1560-1572.[CrossRef][Medline]
6
6. Gay, K., A. Robicsek, J. Strahilevitz, C. H. Park, G. Jacoby, T. J. Barrett, F. Medalla, T. M. Chiller, and D. C. Hooper. 2006. Plasmid-mediated quinolone resistance in non-Typhi serotypes of Salmonella enterica. Clin. Infect. Dis. 43:297-304.[CrossRef][Medline]
7
7. Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K. Sakae. 2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:801-803.[Abstract/Free Full Text]
8
8. Jacoby, G., V. Cattoir, D. Hooper, L. Martínez-Martínez, P. Nordmann, A. Pascual, L. Poirel, and M. Wang. 2008. qnr gene nomenclature. Antimicrob. Agents Chemother. 52:2297-2299.[Free Full Text]
9
9. Jacoby, G. A., and P. Han. 1996. Detection of extended-spectrum β-lactamases in clinical isolates of Klebsiella pneumoniae and Escherichia coli. J. Clin. Microbiol. 34:908-911.[Abstract]
10
10. Jacoby, G. A., K. E. Walsh, D. M. Mills, V. J. Walker, H. Oh, A. Robicsek, and D. C. Hooper. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178-1182.[Abstract/Free Full Text]
11
11. Kenyon, C. J., and G. C. Walker. 1980. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli. Proc. Natl. Acad. Sci. USA 77:2819-2823.[Abstract/Free Full Text]
12
12. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2^–CT method. Methods 25:402-408.[CrossRef][Medline]
13
13. Malik, M., X. Zhao, and K. Drlica. 2006. Lethal fragmentation of bacterial chromosomes mediated by DNA gyrase and quinolones. Mol. Microbiol. 61:810-825.[CrossRef][Medline]
14
14. Martínez-Martínez, L., A. Pascual, and G. A. Jacoby. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797-799.[CrossRef][Medline]
15
15. Mount, D. W., K. B. Low, and S. J. Edminston. 1972. Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet light-induced mutations. J. Bacteriol. 112:886-893.[Abstract/Free Full Text]
16
16. Poirel, L., A. Liard, J. M. Rodriguez-Martinez, and P. Nordmann. 2005. Vibrionaceae as a possible source of Qnr-like quinolone resistance determinants. J. Antimicrob. Chemother. 56:1118-1121.[Abstract/Free Full Text]
17
17. Poirel, L., J. M. Rodriguez-Martinez, H. Mammeri, A. Liard, and P. Nordmann. 2005. Origin of plasmid-mediated quinolone resistance determinant QnrA. Antimicrob. Agents Chemother. 49:3523-3525.[Abstract/Free Full Text]
18
18. Robicsek, A., G. A. Jacoby, and D. C. Hooper. 2006. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect. Dis. 6:629-640.[CrossRef][Medline]
19
19. Robicsek, A., J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 50:2872-2874.[Abstract/Free Full Text]
20
20. Rodríguez-Martínez, J. M., C. Velasco, A. Briales, I. García, M. C. Conejo, and A. Pascual. 2008. Qnr-like pentapeptide repeat proteins in gram-positive bacteria. J. Antimicrob. Chemother. 61:1240-1243.[Abstract/Free Full Text]
21
21. Tran, J. H., and G. A. Jacoby. 2002. Mechanism of plasmid-mediated quinolone resistance. Proc. Natl. Acad. Sci. USA 99:5638-5642.[Abstract/Free Full Text]
22
22. Tran, J. H., G. A. Jacoby, and D. C. Hooper. 2005. Interaction of the plasmid-encoded quinolone resistance protein QnrA with Escherichia coli topoisomerase IV. Antimicrob. Agents Chemother. 49:3050-3052.[Abstract/Free Full Text]
23
23. Walker, G. C. 1984. Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli. Microbiol. Rev. 48:60-93.[Free Full Text]
24
24. Ysern, P., B. Clerch, M. Castano, I. Gibert, J. Barbe, and M. Llagostera. 1990. Induction of SOS genes in Escherichia coli and mutagenesis in Salmonella typhimurium by fluoroquinolones. Mutagenesis 5:63-66.[Abstract/Free Full Text]

---

Antimicrobial Agents and Chemotherapy, February 2009, p. 821-823, Vol. 53, No. 2
0066-4804/09/$08.00+0     doi:10.1128/AAC.00132-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Strahilevitz, J., Jacoby, G. A., Hooper, D. C., Robicsek, A. (2009). Plasmid-Mediated Quinolone Resistance: a Multifaceted Threat. Clin. Microbiol. Rev. 22: 664-689 [Abstract] [Full Text]  
• Rodriguez-Martinez, J. M., Briales, A., Velasco, C., Conejo, M. C., Martinez-Martinez, L., Pascual, A. (2009). Mutational analysis of quinolone resistance in the plasmid-encoded pentapeptide repeat proteins QnrA, QnrB and QnrS. J Antimicrob Chemother 63: 1128-1134 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, M. Articles by Hooper, D. C. Search for Related Content PubMed PubMed Citation Articles by Wang, M. Articles by Hooper, D. C.