This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Depardieu, F.
Right arrow Articles by Courvalin, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Depardieu, F.
Right arrow Articles by Courvalin, P.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, May 2009, p. 1952-1963, Vol. 53, No. 5
0066-4804/09/$08.00+0     doi:10.1128/AAC.01348-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains {triangledown}

F. Depardieu,1 M.-L. Foucault,1 J. Bell,2 A. Dubouix,3 M. Guibert,4 J.-P. Lavigne,5 M. Levast,6 and P. Courvalin1*

Unité des Agents Antibactériens, Institut Pasteur, 75724 Paris, Cedex 15,1 Department of Microbiology and Infection Control and Epidemiology and Public Health, Centre Hospitalier Universitaire Rangueil, Toulouse,3 Department of Internal Medicine, Hôpital Antoine Béclère, Clamart,4 INSERM, Espri 26, Université Montpellier 1, UFR de Médecine, 30908 Nimes Cedex,5 Service de Bactériologie, Centre Hospitalier de Chambéry, F-73011 Chambéry Cedex, France,6 Department of Infectious Diseases, Women's and Children's Hospital, North Adelaide, Australia2

Received 8 October 2008/ Returned for modification 27 January 2009/ Accepted 15 February 2009


arrow
ABSTRACT
 
We studied the clinical isolates Enterococcus faecium NEF1, resistant to high levels of vancomycin (MIC, 512 µg/ml) and teicoplanin (MIC, 64 µg/ml); Enterococcus faecium BM4653 and BM4656 and Enterococcus avium BM4655, resistant to moderate levels of vancomycin (MIC, 32 µg/ml) and to low levels of teicoplanin (MIC, 4 µg/ml); and Enterococcus faecalis BM4654, moderately resistant to vancomycin (MIC, 16 µg/ml) but susceptible to teicoplanin (MIC, 0.5 µg/ml). The strains were distinct, were constitutively resistant via the synthesis of peptidoglycan precursors ending in D-alanyl-D-lactate, and harbored a chromosomal vanD gene cluster that was not transferable. New mutations were found in conserved domains of VanSD: at T170I near the phosphorylation site in NEF1, at V67A at the membrane surface in BM4653, at G340S in the G2 ATP-binding domain in BM4655, in the F domain in BM4656 (a 6-bp insertion), and in the G1 and G2 domains of BM4654 (three mutations). The mutations resulted in constitutivity, presumably through the loss of the phosphatase activity of the sensor. The chromosomal Ddl D-Ala:D-Ala ligase had an IS19 copy in NEF1, a mutation in the serine (S185F) or near the arginine (T289P) involved in D-Ala1 binding in BM4653 or BM4655, respectively, and a mutation next to the lysine (P180S) involved in D-Ala2 binding in BM4654, leading to the production of an impaired enzyme. In BM4653 vanYD, a new insertion sequence, ISEfa9, belonging to the IS3 family, resulted in the absence of D,D-carboxypeptidase activity. Strain BM4656 had a functional D-Ala:D-Ala ligase, associated with high levels of both VanXD and VanYD activities, and is the first example of a VanD-type strain with a functional Ddl enzyme. Study of these five clinical isolates, displaying various assortments of mutations, confirms that all VanD-type strains isolated so far have undergone mutations in the vanSD or vanRD gene, leading to constitutive resistance, but that the Ddl host ligase is not always impaired. Based on sequence differences, the vanD gene clusters could be assigned to two subtypes: vanD-1 and vanD-4.


arrow
INTRODUCTION
 
Vancomycin-resistant enterococci have spread with unanticipated rapidity and are now encountered in hospitals in most countries. Three types, VanA, VanB, and VanD, with acquired resistance to the glycopeptides vancomycin and teicoplanin by means of production of peptidoglycan precursors ending in the depsipeptide D-alanyl-D-lactate (D-Ala-D-Lac) instead of the dipeptide D-Ala-D-alanine (D-Ala-D-Ala), have been characterized. VanA and VanB are the most prevalent phenotypes and have been found primarily in Enterococcus faecium and Enterococcus faecalis. VanD has been found only in a few strains of E. faecium (6, 7, 10, 13, 16, 31), two E. faecalis strains (13), one Enterococcus gallinarum strain (8), and one Enterococcus raffinosus strain (37). Recently, the vanD operon was detected in a Ruminococcus sp., an anaerobic gram-positive bacterium from human bowel flora, suggesting a potential reservoir for vancomycin resistance genes in commensals of the digestive tract (17).

VanD-type strains share various characteristics that distinguish them from VanA- and VanB-type enterococci. In particular, resistance to moderate levels of the two glycopeptides is constitutively expressed and is not transferable by conjugation to other enterococci (10, 13, 16, 31). The organization of the vanD gene cluster, located exclusively in the chromosome, is similar to those of vanA and vanB (13, 16). The vanD operon contains the vanHDDXD resistance genes, encoding, respectively, a dehydrogenase that converts pyruvate to D-lactate, a ligase required for the synthesis of D-Ala-D-Lac, and a dipeptidase; these enzymes have high levels of sequence identity (59 to 70%) with the corresponding deduced proteins of the vanA and vanB operons (15). The VanYD D,D-carboxypeptidase belongs to the penicillin-binding protein (PBP) family of catalytic serine enzymes, which are susceptible to benzylpenicillin (10, 13, 16, 31), and is distinct from VanY and VanYB, which are penicillin-insensitive Zn2+-dependent D,D-carboxypeptidases. The vanRDSD regulatory genes, encoding a two-component regulatory system composed of a membrane-bound histidine kinase (VanSD) and a cytoplasmic response regulator (VanRD) that acts as a transcriptional activator, are present upstream of the resistance genes and are only distantly related to VanRS and VanRBSB (19 to 58% identity). The regulatory and resistance genes are transcribed from distinct promoters (PR, PRB, and PRD for the regulatory genes and PH, PYB, and PYD for the resistance genes) that are coordinately regulated (15). No genes homologous to vanZ or vanW from the vanA and vanB operons, respectively, are present.

The interaction of glycopeptides with their target, the late peptidoglycan precursors ending in D-Ala-D-Ala, is prevented by the removal of precursors terminating in D-Ala (33). Two enzymes are involved in this process: a cytoplasmic D,D-dipeptidase (VanX, VanXB, or VanXD) that hydrolyzes the dipeptide D-Ala-D-Ala synthesized by the host Ddl and a membrane-bound D,D-carboxypeptidase (VanY, VanYB, or VanYD) that removes the C-terminal D-Ala residue of late peptidoglycan precursors when elimination of D-Ala-D-Ala by VanX is incomplete (2). However, the VanD-type strains investigated previously have negligible D,D-dipeptidase activity, encoded by vanXD alleles, despite the presence in VanXD of the critical residues implicated in the binding of Zn2+ and in catalysis (27). The lack of such an activity should result in a glycopeptide-susceptible phenotype, since these bacteria are unable to eliminate peptidoglycan precursors ending in D-Ala-D-Ala. However, in VanD-type strains, the susceptible pathway does not function due to an inactive D-Ala:D-Ala ligase resulting from various mutations in the chromosomal ddl gene (6, 7, 13, 16, 31). Consequently, the strains should grow only in the presence of vancomycin, since they rely on the inducible resistance pathway for peptidoglycan synthesis. However, this is not the case, since the vanD clusters are expressed constitutively due to mutations either in the VanSD sensor (13, 16) or in the VanRD regulator (13) of the two-component regulatory system.

We report the organization of the vanD gene clusters, the regulation of the expression of the resistance genes, and the sequences of the ddl genes in the clinical isolates E. faecium NEF1 (23), BM4653, and BM4656 and E. faecalis BM4654, and in the first VanD-type E. avium strain, BM4655.


arrow
MATERIALS AND METHODS
 
Strains, plasmids, and growth conditions. The origins and characteristics of the bacterial strains and plasmids used in this study are given in Table 1. E. faecium NEF1 (23), BM4653, and BM4656 and E. avium BM4655 were isolated from hospitalized patients in France (Nîmes, Chambéry, Toulouse, and Clamart, respectively), and E. faecalis BM4654 was isolated from a patient in Adelaide, South Australia. The susceptible E. avium strain ATCC 14025 was used as a control, and Escherichia coli Top10 (Invitrogen, Groningen, The Netherlands) was used as a host for recombinant plasmids. Kanamycin (50 µg/ml) was the selective agent for cloning PCR products into the pCR-Blunt vector (Invitrogen). Spectinomycin (60 µg/ml) or gentamicin (32 µg/ml) was added to the culture medium to prevent the loss of plasmids derived from pAT79 (4) or pAT392 (3), respectively. Strains were grown in brain heart infusion (BHI) broth or agar (Difco Laboratories, Detroit, MI) at 37°C. The MICs of glycopeptides were determined by the method of Steers et al. with 105 CFU per spot on BHI agar after 24 h of incubation at 37°C (36).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Strains and plasmids

Recombinant DNA techniques. Plasmid DNA isolation, digestion with restriction endonucleases (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, England), amplification of DNA by PCR with Pfu DNA polymerase (Stratagene, La Jolla, CA), ligation of DNA fragments with T4 DNA ligase (Amersham Pharmacia Biotech), and transformation of E. coli Top10 with recombinant plasmid DNA were performed by standard methods (5). Total DNA from enterococci was prepared according to the method of Le Bouguénec et al. (24).

Plasmid construction. (i) Plasmids pAT825, pAT826, pAT827, pAT828, and pAT829. To construct pAT825 [P2 ddl(S185F) cat] from E. faecium BM4653, pAT826 (P2 ddlBM4656 cat) from E. faecium BM4656, pAT827 [P2 ddl(P180S) cat] from E. faecalis BM4654, pAT828 (P2 ddlATCC 14025 cat) from E. avium ATCC 14025, and pAT829 [P2 ddl(T289P) cat] from E. avium BM4655, the chromosomal ddl gene with its ribosome binding site (RBS) was amplified by PCR from the total DNA of the corresponding strain with oligodeoxynucleotides 4147-1 and 4147-2 (10), or with oligodeoxynucleotides 4655-1 and 4655-2 for E. avium ATCC 14025 and BM4655. Primers 4147-1 (10) and 4655-1 (ATACGAGCTCGCTAAAATGTTAGGGAT) each contain a SacI restriction site (italicized). Primers 4147-2 (10) and 4655-2 (GCCATCTAGATTATTCAAAACGCGCCT) each contain an XbaI restriction site (italicized). The SacI and XbaI restriction sites allowed directional cloning of the ddl gene under the control of the constitutive P2 promoter and upstream of the cat reporter gene of the pAT79 shuttle vector (4). The 1,135-bp insert of the resulting pAT825 [P2 ddl(S185F) cat] and pAT827 [P2 ddl(P180S) cat] plasmids and the 1,105-bp insert of pAT829 [P2 ddl(T289P) cat] contained the mutated ddl gene with the resulting single S185F, P180S, or T289P amino acid substitution, respectively, and their cognate RBS, whereas plasmids pAT826 (P2 ddlBM4656 cat) from E. faecium BM4656 and pAT828 (P2 ddlATCC 14025 cat) from E. avium ATCC 14025 had no mutations in their ddl genes and were used as controls.

(ii) Plasmids pAT830, pAT831, pAT832, and pAT833. For the construction of pAT830 [P2 vanSD(V67A) aac(6')-aph(2'')], pAT831 [P2 vanSD::6bp330 aac(6')-aph(2'')], pAT832 [P2 vanSD(K308Q I309V R335Q) aac(6')-aph(2'')], and pAT833 [P2 vanSD(G340S) aac(6')-aph(2'')], the vanSD genes of BM4653, BM4656, and BM4654, respectively, were amplified using primer pair SDNH2-SDCOOH (or SD4NH2-SD4COOH for BM4655), and the total DNA of the corresponding strain was used as a template (Fig. 1 and Table 1). Oligodeoxynucleotides SDNH2 (5'-GCACGAGCTCTTGAAAGGAGACAGGAGCATGAAAAATAGAAAT AAAACC) and SD4NH2 (5'-GCACGAGCTCTTGAAAGGAGACAGGAGCATGAAAAATAAAAATATGACC) each contained a SacI restriction site (italicized), an RBS (underlined), and 21 bases complementary to vanSD, including the ATG translation initiation codon (underlined). Oligodeoxynucleotides SDCOOH (5'-TAACTCTAGATTACGATTTTCCTACGA) and SD4COOH (5'-TAACTCTAGATTACGATTTTCCTACGG) each harbored an XbaI restriction site (italicized), the stop codon (underlined), and 14 bases complementary to the 3'-end sequence of vanSD from BM4653, BM4656, BM4654, and BM4655. The SacI and XbaI restriction sites allowed directional cloning of vanSD upstream of the aac(6')-aph(2'') gentamicin resistance reporter gene of the shuttle vector pAT392, carrying the P2 promoter, to generate pAT830 [P2 vanSD(V67A) aac(6')-aph(2'')], pAT831 [P2 vanSD::6bp330 aac(6')-aph(2'')], pAT832 [P2 vanSD(K308Q I309V R335Q) aac(6')-aph(2'')], and pAT833 [P2 vanSD(G340S) aac(6')-aph(2'')]. The sequences of the amplified fragments were redetermined.


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 1. Schematic representation of the vanD gene cluster and of recombinant plasmids. Open arrows represent coding sequences and indicate the direction of transcription. The PCR fragment internal to the vanD gene used as a probe in hybridization experiments is indicated above the corresponding region. Horizontal bars represent PCR products corresponding to overlapping amplified fragments of VanD-type strains. The positions of the 5' ends of the primers complementary to the sequence of VanD-type reference strain BM4339 are in parentheses, with filled arrowheads showing the direction of DNA synthesis. Numbering begins at the A of the ATG start codon of the vanRD gene from BM4339. The size (in base pairs) of each PCR product is given in boldface. Below the vanD gene cluster diagram, the inserts in the plasmids cloned under the control of the P2 promoter are represented by dashed lines, and vectors are given in parentheses. For the recombinant plasmids, arrowheads represent the location and orientation of the oligodeoxynucleotides used for amplification of the insert.

Strain construction. E. faecium BM4663, BM4664, BM4665, BM4666, and BM4667 were produced by the introduction of DNA from plasmids pAT825 [P2 ddl(S185F) cat], pAT826 (P2 ddlBM4656 cat) from E. faecium BM4656, pAT827 [P2 ddl(P180S) cat], pAT828 (P2 ddlATCC 14025 cat) from the susceptible E. avium strain ATCC 14025, and pAT829 [P2 ddl(T289P) cat], respectively, into E. faecium BM4339 by electrotransformation with selection on spectinomycin (120 µg/ml), and the transformants were screened for resistance to chloramphenicol (10 µg/ml). Plasmid DNA from pAT830 [P2 vanSD(V67A) aac(6')-aph(2'')], pAT831 [P2 vanSD::6bp330 aac(6')-aph(2'')], pAT832 [P2 vanSD(K308Q I309V R335Q) aac(6')-aph(2'')], and pAT833 [P2 vanSD(G340S) aac(6')-aph(2'')] was introduced into BM4458 and BM4459 (Table 1) by electrotransformation, and the resulting transformants were selected on agar containing gentamicin (64 µg/ml or 128 µg/ml). Plasmid DNA from chloramphenicol- or gentamicin-resistant clones was digested with EcoRI plus HindIII and the restriction profile obtained was compared to that of the corresponding plasmids purified from E. coli Top10 in order to screen for possible DNA rearrangements.

TAIL-PCR amplification. Thermal asymmetric interlaced PCR (TAIL-PCR) (26) was used to determine the sequences of the 5' and 3' extremities of the ddl genes from E. avium ATCC 14025 and BM4655. The primary PCR mixture contained 0.15 µM gene-specific primer (ddl4 avium [GCTTCCCTCACATTTAT] for the 5' extremity and ddl8 avium [GTGAGGTCGTAAAGGAA] for the 3' extremity), an arbitrary degenerate (AD) primer (26) (at 5 µM for AD1 and AD2 and at 2.5 µM for AD3 and AD4, containing inosine residues), 200 µM each deoxynucleoside triphosphate (dNTP), 2.5 U of Expand Long Template enzyme mixture (Roche, Mannheim, Germany), and 1x PCR buffer with 22.5 mM MgCl2 supplied with the enzyme in a volume of 50 µl. The second PCR was carried out with a second specific primer (ddl5 avium [CCAGCTGCCTGCAAAAT] for the 5' extremity and ddl9 avium [CGGAAGATGTGATGCAA] for the 3' extremity) in combination with the arbitrary primer used in the first PCR. The reaction solution contained 0.2 µM gene-specific primer (ddl 6 avium [CAAGCACTCGTCATTACA] for the 5' extremity and ddl10 avium [GGTGGATCAGGATTAAGT] for the 3' extremity), an AD primer (at 3 µM for AD1 and AD2 and at 1.5 µM for AD3 and AD4, containing inosine residues), 200 µM each dNTP, 2.5 U of Expand Long Template enzyme mixture, and 8 µl of a 1/50 dilution of the primary PCR product as a template. For the third PCR, the solution was the same as for the second PCR except that 3 µl of a 1/10 dilution of the second or third PCR product was used as a template.

Three TAIL-PCRs were performed with the AD1, AD2, AD3, and AD4 random primers designed by Liu and Whittier (26). The reaction products of the first, second, and third PCR steps were separated by agarose gel electrophoresis. The bands corresponding to the third PCRs, which showed expected decreases in length consistent with the positions of the specific primers along the genome, were purified and sequenced. In order to rule out mismatches during TAIL-PCR, the nucleotide sequences of the amplification products were confirmed by conventional PCR with new primers.

DNA sequencing. Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

Computer analysis of sequence data. The degrees of identity and similarity with known proteins were determined using BLASTN, BLASTX, and BLASTP (1) and FASTA (30) from the Genetics Computer Group (GCG) suite of programs.

Contour-clamped homogeneous electric field gel electrophoresis. Genomic DNA embedded in agarose plugs was digested overnight at 27°C with 25 U of SmaI or for 3 h at 37°C with 0.01 U of I-CeuI, an intron-encoded endonuclease specific for rRNA genes (25). The products were separated on a 0.8% agarose gel using a CHEF-DRIII system (Bio-Rad Laboratories) under conditions described previously (16). Fragments were hybridized successively, as described previously (16), to an [{alpha}-32P]-labeled 16S rRNA (rrs) probe obtained by amplification of an internal portion of the rrs gene with primers RWO1 and DG74 (21) and to a vanD probe obtained by PCR with primers VanD1 (5'-TAAGGCGCTTGCATATACCG) and VanD2 (5'-TGCAGCCAAGTATCCGGTAA), internal to the gene, with BM4653 total DNA as a template (Fig. 1).

Analysis of peptidoglycan precursors. Peptidoglycan precursors were extracted and analyzed by high-performance liquid chromatography as described previously (3). Enterococci were grown in BHI medium without or with vancomycin (3 µg/ml) to the mid-exponential phase (A600, 1). Ramoplanin (3 µg/ml) was added to inhibit peptidoglycan synthesis, and incubation was continued for 15 min to cause accumulation of peptidoglycan precursors.

D,D-Dipeptidase (VanXD) and D,D-carboxypeptidase (VanYD) activities. The enzymatic activities in the supernatant and in the resuspended pellet fraction were assayed as described previously (3). Strains were grown to an optical density at 600 nm of 0.7 in the absence or presence of vancomycin (8 µg/ml) and with gentamicin (32 µg/ml) to counterselect the loss of derivatives of pAT392. Following cell breakage, the supernatant (S100) and the resuspended pellet (C100) were collected and assayed for D,D-peptidase (VanX or VanY) activities by measurement of the D-Ala released from substrate hydrolysis (6.56 mM D-Ala-D-Ala or 5 mM L-Ala-D-Glu-L-Lys-D-Ala-D-Ala) as described previously (3).

Nucleotide sequence accession numbers. The 1,384-bp fragments containing the ddl genes of strains ATCC 14025 and BM4655 and the 1,043-bp fragment containing the intD gene downstream of vanXD in BM4655 were submitted to GenBank and assigned accession no. EU999032, EU999033, and EU999034, respectively. The 1,366-bp ISEfa9 sequence inserted in the vanYD gene of BM4653 has been deposited in the GenBank database under accession no. EU999035. The entire vanD cluster of E. faecium A902 (13), sometimes designated VanD2, was submitted to GenBank and assigned accession no. EU999036.


arrow
RESULTS AND DISCUSSION
 
Characterization of VanD-type E. faecium NEF1, BM4653, and BM4656, E. faecalis BM4654, and E. avium BM4655. E. faecium NEF1 (23) was resistant to high levels of vancomycin (MIC, 512 µg/ml) and teicoplanin (MIC, 64 µg/ml), whereas E. faecium BM4653 and BM4656 and E. avium BM4655 were resistant to a moderate level of vancomycin (MIC, 32 µg/ml) and to a low level of teicoplanin (MIC, 4 µg/ml) (Fig. 2). E. faecalis BM4654 was moderately resistant to vancomycin (MIC, 16 µg/ml) but remained susceptible to teicoplanin (MIC, 0.5 µg/ml) (Fig. 2). The glycopeptide resistance genotype of these strains was determined by multiplex PCR (14) and found to be vanD. The patterns of the five strains obtained by pulsed-field gel electrophoresis after digestion of total DNA by SmaI differed, and a vanD probe hybridized with a DNA fragment of a different size in each strain, indicating that the clinical isolates were distinct (data not shown). Repeated attempts to transfer vancomycin resistance from the five strains to E. faecalis JH2-2 (22) or E. faecium 64/3 (38) by filter mating were unsuccessful (frequency < 10–9 per recipient).


Figure 2
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 2. Proportions of late soluble cytoplasmic peptidoglycan precursors from VanD-type strains. The strains studied are given along the x axis. Induction was performed with 3 µg/ml of vancomycin. Levels of resistance to vancomycin (Vm) and teicoplanin (Te) are given at the bottom.

Chromosomal location of the vanD gene cluster. The vanD gene cluster was assigned to a chromosomal fragment of ca. 380 kb in E. faecium NEF1, 365 kb in E. faecium BM4653, 350 kb in E. faecium BM4656, 450 kb in E. faecalis BM4654, and 565 kb in E. avium BM4655 by pulsed-field gel electrophoresis of total DNA digested with I-CeuI, followed by successive hybridizations with a 16S rRNA (rrs) probe and a probe internal to vanD (data not shown). This analysis confirmed the data obtained with SmaI, indicating that the VanD-type isolates were distinct and differed from those reported previously (13, 16).

Organization of the vanD operons. The products obtained following PCR mapping with primers complementary to the vanD operon (Fig. 1) from E. faecium BM4339 (10) were of the expected size for all the strains except E. faecium BM4653, for which PCR with primer pair VDB-YD1COOH gave rise to a product approximately 1,400 bp larger than expected due to an insertion sequence in the vanYD gene. All the genes of the vanD operon were present in the five strains, and their organization was identical to that in BM4339, i.e., two adjacent clusters, one containing the regulatory genes vanRDSD and the other containing the vanYDHDDXD resistance genes (Fig. 1). No large insertions or deletions in the noncoding regions were detected.

The deduced sequences from the vanRD and vanSD PCR products (Fig. 1) were almost identical to the VanRD response regulators (96 to 100% identity) and VanSD histidine protein kinases (92 to 100%) of the strains previously characterized (Tables 2 and 3; also data not shown). The gene for the VanD D-Ala:D-Lac ligase from E. faecium NEF1 has been characterized previously, and the enzyme had the highest degree of identity with that of BM4339 (Table 2) (23). The deduced sequences of the VanHD, VanD, and VanXD proteins of the five strains displayed 83 to 100% identity with the corresponding proteins from the previously described VanD-type strains (Tables 2 and 3; also data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Percentages of identity of the deduced proteins from the vanD operon of E. faecium NEF1 with those from other vanD operons


View this table:
[in this window]
[in a new window]

 
TABLE 3. Percentages of identity of the deduced proteins from the vanD operon of E. faecalis BM4654 with those from other vanD operons

Analysis of the translation products of the vanYD genes of E. faecium BM4656, E. faecalis BM4654, and E. avium BM4655 indicated that they contained the three motifs SXXK, SG(C/N), and KTG, characteristic of the penicillin binding domains of PBPs (16). However, the VanYD D,D-carboxypeptidase of E. faecium NEF1 was terminated prematurely after amino acid 183 due to a substitution (TGG to TGA) leading to a stop codon, resulting in a polypeptide with a conserved membrane-spanning portion at the N terminus and the first conserved active-site sequence (SXXK) but lacking the other two sequences that form the PBP active site. In E. faecium BM4653, the vanYD gene was interrupted by insertion sequence ISEfa9, belonging to the IS3 family, which generated a 3-bp (GAA) duplication of target DNA corresponding to nucleotides 583 to 585 of vanYD. The ISEfa9 copy was flanked by 40-bp imperfect inverted repeats and contained two open reading frames (ORFs), ORFA and ORFB, in the same orientation, which exhibited 55 and 54% identity with the structural genes for putative transposases of Clostridium phytofermentans and Lactobacillus salivarius, respectively. The VanYD D,D-carboxypeptidases of E. faecalis BM4654 and E. avium BM4655 had higher identities (96 to 100%, respectively) with 10/96A VanYD than with the VanYD enzymes of the other VanD-type strains (76 to 80%) (Table 3 and data not shown).

In both E. faecium NEF1 and E. avium BM4655, downstream of vanXD and associated with the vanD gene cluster, an intD gene for a putative integrase-like protein, displaying 100% and 94% amino acid sequence identity, respectively, with that of E. faecium BM4339, was present (Fig. 1). The vanD cluster of BM4655 was almost identical to that of 10/96A (Table 3), and an intD gene 100% identical to that of BM4655 was found downstream of vanXD in 10/96A.

As already mentioned, the vanRD and vanSD genes are highly conserved among all VanD-type strains, whereas the vanHD, vanD, and vanXD resistance genes are more distant. However, among the proteins encoded by the vanD clusters, VanYD presents the highest variability, with percentages of identity ranging from 78 to 100% (Tables 2 and 3; also data not shown). On the basis of the sequences of VanYD and VanD, VanD-type strains can be assigned to two subtypes: vanD-1 and vanD-4. The vanD clusters of the VanD-1 strains are closer to that of BM4339 (10), whereas those of VanD-4 strains are more closely related to that of 10/96A (16). In E. faecium NEF1, BM4653, BM4656, BM4416, and A902 and in E. faecalis BM4538 and BM4539, the vanD operon was similar to that of BM4339 (Table 2 and data not shown) except for vanYD in E. faecium A902, which had the highest identity with vanYD in E. faecium 10/96A (16). The vanD operon of E. avium BM4655 was identical to that of E. faecium 10/96A (Table 3). These two subtypes also hold true for other Enterococcus species and other bacterial genera. In E. gallinarum N04-0414 (8) and a Ruminococcus sp. (17), the vanD clusters are, respectively, 94% and 98.2% identical with that of BM4339, whereas in E. raffinosus GV5 (37), the vanD cluster is highly similar (99.5% identity) to that in 10/96A, except for the presence of a frameshift mutation in vanYD in the latter strain. However, E. faecalis BM4654 and E. faecium N03-0072 (7), which are identical, harbor hybrid operons: the predicted VanSD, VanYD, and VanD proteins are more similar to their counterparts in 10/96A than in BM4339 and its derivatives, whereas the opposite is true for the remaining proteins (VanRD, VanHD, and VanXD) (Table 3).

Study of the D-Ala:D-Ala ligases. Every VanD-type strain reported so far has undergone a mutation in the ddl gene that prevents the synthesis of peptidoglycan by the susceptible chromosomal pathway. The ddl genes for the D-Ala:D-Ala ligases of the VanD-type strains were amplified, and PCR products with the expected length of 1,154 bp for E. faecium BM4653 and BM4656 or 1,063 bp for E. faecalis BM4654 were sequenced. For E. faecium NEF1, amplification of the entire ddl gene gave rise to a 2,194-bp fragment, which was also sequenced. The sequences upstream and downstream of the 600-bp known portions of the ddl genes of E. avium ATCC 14025 (susceptible) (19) and BM4655 were obtained by TAIL-PCR, and the corresponding proteins were compared (Fig. 3).


Figure 3
View larger version (73K):
[in this window]
[in a new window]

 
FIG. 3. Alignment of the deduced amino acid sequences of the Ddl ligases of VanD-type strains. Numbers on the left and right of each line refer to the and last amino acids in the corresponding sequence. Identical amino acids are indicated below the alignment by dashed lines. The numbers in boldface above the alignment indicate the amino acids implicated in the binding of D-Ala1 (E13, H98, S185, and R293) (1), D-Ala2 (K179, K253, and E308) (2), and ATP (Y254, D295, and S319) (3) (20, 35), which are conserved in E. faecium, E. faecalis, and E. avium. In E. faecium NEF1, the position of IS19 is indicated by a vertical arrow between the two flanking deduced amino acids. In E. faecium BM4653, E. faecalis BM4654, and E. avium BM4655, the single-base differences relative to the ddl genes of E. faecium BM4147, E. faecalis V583, and the susceptible E. avium strain ATCC 14025, leading, respectively, to a Ser-to-Phe substitution at position 185, a Pro-to-Ser substitution at position 180, and a Thr-to-Pro substitution at position 289, are indicated by boldface italics. The Ddl sequence of E. faecium BM4656 is identical to that of BM4147, and no mutations were observed. The Ddl sequence of ATCC 14025, determined in this study, is shown for comparison with that of E. avium BM4655.

In E. faecium NEF1, an insertion sequence of 1,040 bp, similar to IS19 and ISEfm1, which belong to the IS982 family, was present at the beginning of the gene (Fig. 3) instead of in the middle as in E. faecium strain BM4416 (31), also designated N97-330 (6). Insertion of the element generated a 9-bp (ATTTATTAT) duplication of the target DNA corresponding to nucleotides 82 to 90 of the ddl gene. The IS19-like copy was terminated by 22-bp perfect inverted repeats (ACCCGTGGTGCTAGTTAATTTT) and contained an ORF that exhibited 100% identity with the structural gene for the putative transposase of IS4 from E. faecium DO and 99% identity with the genes for the putative transposases of IS19 and ISEfm1. In contrast to that of ISEfm1, the transposase of IS19-like, like that of IS19, was not truncated following a frameshift.

Comparative ddl analysis revealed a point mutation in codon 185 of E. faecium BM4653 and codon 180 of E. faecalis BM4654 relative to the ddl gene of E. faecium BM4147, resulting in a Ser-to-Phe or Pro-to-Ser substitution at a position involved in the binding of D-Ala1 or next to the lysine involved in the binding of D-Ala2, respectively; both of these point mutations presumably lead to a nonfunctional protein (Fig. 3). For E. avium BM4655, analysis relative to the ddl gene of the susceptible E. avium strain ATCC 14025 revealed a point mutation in codon 289 resulting in a Thr-to-Pro substitution located near the arginine involved in the binding of D-Ala1 (Fig. 3). The Ddl ligases of E. avium ATCC 14025 and BM4655 had the highest degree of identity (98%) with that of E. raffinosus (37) and only 79% and 72% identities with those of E. faecium and E. faecalis, respectively. Surprisingly, no mutations were present in the ddl gene of E. faecium BM4656. Consequently, the deduced protein contained all the amino acids implicated in the binding of D-Ala1, D-Ala2, and ATP that are conserved in E. faecium, E. faecalis, and E. avium (Fig. 3).

Strain BM4339 has an impaired Ddl enzyme, and the introduction of an intact ddl gene under the control of a constitutive promoter restores its susceptibility to glycopeptides (10). This was also observed with plasmids pAT826 (P2 ddlBM4656 cat) from E. faecium BM4656 and pAT828 (P2 ddlATCC 14025 cat) from the susceptible E. avium strain ATCC 14025 (Table 1). The decrease in glycopeptide resistance is due to the production of the heterologous Ddl enzyme, since BM4339 possesses only weak VanX D,D-dipeptidase activity (10). To test if the S185F, P180S, and T289P mutations were responsible for the impairment of the Ddl enzyme, plasmids pAT825 [P2 ddl(S185F) cat], pAT827 [P2 ddl(P180S) cat], and pAT829 [P2 ddl(T289P) cat], containing the ddl mutant genes and their RBS sequences from BM4653, BM4654, and BM4655, respectively, were cloned under the control of the constitutive P2 promoter and electrotransformed into BM4339 (Table 1). The resulting transformants, BM4663, BM4665, and BM4667 (Table 1), remained vancomycin resistant, confirming that the D-Ala:D-Ala ligases from the three strains were probably inactive.

Characterization of the peptidoglycan precursors. The cytoplasmic peptidoglycan precursors from cells grown in the absence or presence of vancomycin were analyzed (Fig. 2). E. faecium NEF1 synthesized essentially pentadepsipeptide precursors (96%), even in the absence of induction, indicating constitutive peptidoglycan synthesis using only the resistance pathway (Fig. 2). Therefore, the elevated glycopeptide resistance of strain NEF1 was associated with increased synthesis of UDP-MurNAc-pentadepsipeptide to the detriment of UDP-MurNAc-pentapeptide (<1%), as a consequence of the alteration of the regulation of the resistance genes and the absence of the host D-Ala:D-Ala ligase. It has been shown that in VanA-type strains, increased transcription of the vanHAX operon is associated with increased incorporation of D-Ala-D-Lac into peptidoglycan precursors to the detriment of D-Ala-D-Ala and with gradual increases in vancomycin resistance levels (3). However, more complete elimination of D-Ala-D-Ala-containing precursors is required for teicoplanin resistance (3). This situation was also observed in NEF1, which has a higher percentage of UDP-Mur-NAc-pentadepsipeptide (96%) than the other VanD-type strains of this study and the highest resistance to both vancomycin (512 µg/ml) and teicoplanin (64 µg/ml) (Fig. 2).

For the remaining strains, the results also showed that, whether in the absence or in the presence of vancomycin, UDP-MurNAc-pentadepsipeptide was the main precursor. However, in addition to the pentadepsipeptide, UDP-MurNAc-pentapeptide was present at 6 to 19% in E. faecium BM4653 and BM4656, E. faecalis BM4654, and E. avium BM4655, which could account for the lower levels of resistance of these four strains to vancomycin and teicoplanin in comparison with those of E. faecium NEF1. UDP-MurNAc-tetrapeptide (9 to 33%) was also present in E. faecium BM4656, E. faecalis BM4654, and E. avium BM4655, whereas in E. faecium NEF1 and BM4653 its levels were very low (4%) (Fig. 2) due to the synthesis of a truncated, and presumably nonfunctional, VanYD D,D-carboxypeptidase. The small amount of pentapeptide present could have been synthesized by the VanD ligase, as has already been shown for the VanA ligase (9). Since the D-Ala:D-Ala ligases of these strains probably have no activity (Fig. 3), little, if any, UDP-MurNAc-pentapeptide should be present; therefore, the tetrapeptide is likely to result from the removal of D-lactate from UDP-MurNAc-pentadepsipeptide. PBPs that function as D,D-carboxypeptidases hydrolyze esters and peptide bonds (32). It is thus presumed that the VanYD enzymes, which are PBPs and whose activities were inhibited by low concentrations of benzylpenicillin (data not shown), would hydrolyze UDP-MurNAc-pentadepsipeptide, with the production of tetrapeptide.

Taken together, these data indicate that the strains were constitutively resistant to vancomycin by means of the production of precursors ending in D-Ala-D-Lac and that they therefore used the resistance pathway exclusively. Thus, in four of the five strains, the production of an impaired Ddl enzyme (Fig. 3) accounts for the lack of peptidoglycan precursors terminating in D-Ala-D-Ala (Fig. 2). In contrast, the functionality of the Ddl enzyme from BM4656 explains the presence of the higher percentage of pentapeptide (14%) in comparison with those (<1% to 9%) in the other VanD-type E. faecium or E. faecalis strains (Fig. 2).

D,D-Peptidase activities. The regulation of the expression of the resistance genes was studied by analysis of VanXD D,D-dipeptidase and VanYD D,D-carboxypeptidase activities (Fig. 4). D,D-Dipeptidase activity was measured in the 100,000 x g supernatant of lysed bacteria that had been grown in the absence or presence of 4 or 8 µg/ml of vancomycin as an inducer. Weak D,D-dipeptidase activity (VanXD) was found in the cytoplasmic extracts from induced or uninduced E. faecalis BM4654 and E. avium BM4655 (Fig. 4). Since these strains do not produce D-Ala-D-Ala-containing peptidoglycan precursors due to mutations in the chromosomal ddl gene, no D,D-dipeptidase activity is required for glycopeptide resistance in this genetic background.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 4. Specific activities of VanX D,D-dipeptidase (A) and VanYD D,D-carboxypeptidase (B) in cytoplasmic and membrane extracts, respectively, from E. faecium NEF1, BM4653, and BM4656, E. faecalis BM4654, and E. avium BM4655. Induction was performed with 4 µg/ml of vancomycin. Specific activity was defined as the number of nanomoles of product formed at 37°C per minute per milligram of protein contained in the extracts. I, induced; NI, not induced.

In E. faecium NEF1, BM4653, and BM4656, VanXD was constitutively synthesized at moderate levels. In the case of BM4656, the D,D-dipeptidase was required, since the D-Ala:D-Ala ligase was functional. Constitutive production of VanXD was more surprising in E. faecium NEF1 and BM4653 (Fig. 4), since their Ddl enzymes were probably nonfunctional (Fig. 3). However, in these strains, VanYD, which is prematurely truncated after the first of the three motifs involved in the scaffolding of the active site (27) by a stop codon in NEF1 or by ISEfa9 in BM4653, is also likely to be nonfunctional, as confirmed by the very low D,D-carboxypeptidase activities (Fig. 4) and by the lack of tetrapeptide (Fig. 2); consequently, VanXD D,D-dipeptidase activity is required to eliminate the D-Ala-D-Ala that may be synthesized by the VanD ligase.

In E. faecium BM4656, E. faecalis BM4654, and E. avium BM4655, the D,D-carboxypeptidase specific activities in membrane extracts were high and were expressed constitutively (Fig. 4). This accounts for the presence of UDP-Mur-NAc-tetrapeptide in these strains. VanYD activity compensated for the very weak VanXD activity in BM4654 and BM4655. In BM4654 and BM4655, all the critical residues implicated in the binding of Zn2+ and in catalysis were present in VanXD. However, in BM4654 the DFM motif implicated in the binding of D-Ala-D-Ala was altered to DYM, and in BM4655 a mutation was observed next to the same motif. Both these mutations could explain the very weak VanXD activity observed in these strains (Fig. 4). In BM4656, since the D-Ala:D-Ala ligase was functional, VanXD hydrolyzed the D-Ala-D-Ala synthesized by the host Ddl, and VanYD could contribute to resistance by removing the C-terminal D-Ala residue of late peptidoglycan precursors when elimination of D-Ala-D-Ala by VanXD was incomplete. However, when VanYD is inactive, as in NEF1 and BM4653, VanXD is more active (Fig. 4). As in the VanD-type strains previously studied (13, 16, 31), D,D-carboxypeptidase activities were inhibited by benzylpenicillin, consistent with the fact that VanYD belongs to the PBP family of catalytic serine enzymes, which are susceptible to β-lactam antibiotics.

Mutations in the VanSD sensors. Mutants with an impaired D-Ala:D-Ala ligase require vancomycin for growth, since D-Ala-D-Lac is produced only under inducing conditions. However, this is not the case for the VanD-type strains studied previously, which express the vanD cluster constitutively due to mutations in either the VanSD sensor (6, 13, 16) or the VanRD regulator (13) of the two-component regulatory system.

In wild-type VanSD, five blocks of amino acids (H, N, G1, F, and G2) in the kinase domain are highly conserved (Fig. 5). The histidine residue of VanSD at position 166 in the H block is the putative site of autophosphorylation of the sensor. This block is responsible for both autophosphorylation and kinase/phosphatase activities, while the G1 and G2 blocks are involved in ATP binding. Sequence alignment of the sensors revealed a point mutation (T170I) in a critical region near the putative autophosphorylation site in NEF1; a point mutation (V67A) at the outer membrane surface in BM4653; a point mutation (G340S) in the G2 ATP-binding domain in BM4655; and three mutations (K308Q and I309V in the G1 ATP-binding domain and R335Q near the G2 ATP-binding domain) in BM4654 (Fig. 3). In BM4656, a duplication resulting in two tandemly arranged hexanucleotide (TTTACC) direct repeats occurred in the F domain, whose function remains unknown but which is always conserved (Fig. 5). In E. faecium BM4653, the V67A mutation, located at the outer surface of the membrane (Fig. 5), was presumably responsible for constitutive expression, as observed for other two-component regulatory systems, such as OmpR-EnvZ, which is related to the VanRS systems (34), BvgA-BvgS (28), NarL-NarX (11), and VirG-VirA (18). Although the five blocks of conserved amino acids characteristic of transmitter modules in histidine protein kinases were present in the C-terminal portion of VanSD in the five strains studied, the production of VanSD with mutations in these conserved domains may have resulted in a high steady-state level of phosphorylated VanRD and thus could account for the constitutive expression of the vanD operon in these strains.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 5. Schematic representation of the VanSD sensor and locations of the mutations in VanD-type strains. The putative membrane-associated sensor domain (stippled area), containing transmembrane segments (filled boxes), and the putative cytoplasmic kinase domain (open area) of VanSD are indicated. Conserved motifs H, N, G1, F, and G2 (checkerboard boxes), present in histidine protein kinases, are identified (29), and their amino acid positions are given in parentheses above the diagram. The histidine residue at position 166 is the putative autophosphorylation site. Arrows indicate the positions of mutations in conserved motifs that are putatively responsible for the constitutive expression of resistance in the strains. The partial sequence of the F domain and the downstream sequence of vanSD in strain BM4656 are shown at the bottom. The 6-bp insertion next to the F domain of VanSD in BM4656 is shown in boldface italics.

In contrast, in the VanD-type strains previously studied, constitutive vancomycin resistance was due to an insertion (ISEfa4 in E. faecium 10/96A [16] or 7 bp in E. faecalis BM4539 and BM4540 [13]) or a deletion (1 bp in E. faecium N97-330 [7], also designated BM4416 [31], and A902 [13] [accession no. EU999036]). These mutations resulted in a frameshift in the VanSD sensor and presumably led to truncated, nonfunctional proteins. In BM4539, BM4540, BM4416, and A902, only the H block, responsible for both autophosphorylation and kinase/phosphatase activities, was present, whereas the other conserved blocks (N, G1, F, and G2) in the kinase domains of the sensors were absent, strongly suggesting a loss of activity. This is in agreement with reports indicating that the G2 block could play a role in the modulation of enzyme conformation (29) and that the G2 box of VanSB (12), as well as that of EnvZ and its surrounding residues (39), plays an important role in modulating phosphatase activity.

The absence of mutations in BM4656 Ddl and the fact that two VanD-type E. faecalis strains harbor identical vanD operons but different mutations in their D-Ala:D-Ala ligases (13) strongly suggest that the mutations in the sensor or in the regulator were acquired before those in the Ddl ligase; otherwise, the strain would have been transiently dependent on glycopeptide for growth.

Study of the functionality of the VanSD sensors. The introduction of an intact vanSD gene under the control of a constitutive promoter into VanD-type E. faecium BM4458 and BM4459 (Table 1), both of which possess a functional Ddl enzyme at different locations in the chromosome but an impaired VanSD protein with a mutated vanSD gene, restores inducible expression of the resistance genes (13).

To investigate whether the mutated vanSD genes were responsible for the constitutive expression of the resistance genes, plasmids pAT830 [P2 vanSD(V67A) aac(6')-aph(2'')], pAT831 [P2 vanSD::6bp330 aac(6')-aph(2'')], pAT832 [P2 vanSD(K308Q I309V R335Q) aac(6')-aph(2'')], and pAT833 [P2 vanSD(G340S) aac(6')-aph(2'')], containing the mutated vanSD genes (Fig. 1), including an RBS, of BM4653, BM4656, BM4654, and BM4655, respectively, were electrotransformed into E. faecium BM4458 and BM4459 (Table 1). The effects of the presence of the various mutated VanSD sensors in the two strains on peptidoglycan biosynthesis were analyzed by estimating the relative amounts of peptidoglycan precursors (Fig. 6A). The regulation of the expression of the resistance genes was also studied by determining VanYD D,D-carboxypeptidase activities in membrane extracts from bacteria grown in the absence or presence of vancomycin (Fig. 6B). The introduction of plasmid pAT392 [P2 aac(6')-aph(2'')] as a control into BM4458 and BM4459 did not modify the regulation of the expression of vanYD nor the relative proportions of peptidoglycan precursors, as reported previously (14). In E. faecium BM4458 carrying pAT830 [P2 vanSD(V67A) aac(6')-aph(2'')], pAT831 [P2 vanSD::6bp330 aac(6')-aph(2'')], pAT832 [P2 vanSD(K308Q I309V R335Q) aac(6')-aph(2'')], or pAT833 [P2 vanSD(G340S) aac(6')-aph(2'')] (Table 1), as in BM4459 carrying these plasmids, UDP-MurNAc-pentadepsipeptide, UDP-MurNAc-pentapeptide, UDP-MurNAc-tetrapeptide, and UDP-MurNAc-tripeptide were synthesized in similar quantities in the absence or presence of vancomycin (2 µg/ml) (Fig. 6A and data not shown). The presence of the tripeptide could indicate that the VanD ligase was not sufficiently active to synthesize D-Ala-D-Lac as rapidly as the tripeptide was produced.


Figure 6
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 6. Proportions of late soluble cytoplasmic peptidoglycan precursors (A) and VanYD D,D-carboxypeptidase specific activities in membrane extracts (B) from BM4339 and derivatives of BM4458. Induction was performed with 2 µg/ml of vancomycin. (A) The levels of resistance to vancomycin (Vm) and teicoplanin (Te) are given below the bar graph. (B) Specific activity was defined as the number of nanomoles of product formed at 37°C per minute per milligram of protein contained in the extracts. I, induced; NI, not induced.

It therefore appears that the production of VanSD sensors from E. faecium BM4653 and BM4656, E. faecalis BM4654, and E. avium BM4655 in strains BM4458 and BM4459 did not restore inducible expression of the resistance genes, as indicated by the constitutivity of D,D-carboxypeptidase activity (Fig. 6B and data not shown), confirming that the VanSD sensors from the former strains had lost their phosphatase activity.

In summary, in all the strains, acquired VanD-type resistance is due to constitutive production of peptidoglycan precursors, with the majority ending in D-Ala-D-Lac. The vanD operon located exclusively in the chromosome can be divided into two subtypes, vanD-1 and vanD-4, on the basis of sequence differences in VanD and VanYD. In almost all VanD-type strains, the susceptible pathway does not function due to an inactive D-Ala:D-Ala ligase resulting from various mutations in the chromosomal ddl gene. These mutations have most probably been acquired following those in the VanSD sensor or the VanRD regulator and circumvent the weakness of VanXD activity, allowing higher levels of antibiotic resistance.


arrow
ACKNOWLEDGMENTS
 
We thank P. E. Reynolds for helpful discussions and for critical reading of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Unité des Agents Antibactériens, Institut Pasteur, 25, rue du Docteur Roux, 75724 Paris Cedex 15, France. Phone: (33) (1) 45 68 83 20. Fax: (33) (1) 45 68 83 19. E-mail: pcourval{at}pasteur.fr Back

{triangledown} Published ahead of print on 2 March 2009. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. 2
  3. Arthur, M., F. Depardieu, L. Cabanié, P. Reynolds, and P. Courvalin. 1998. Requirement of the VanY and VanX D,D-peptidases for glycopeptide resistance in enterococci. Mol. Microbiol. 30:819-830.[CrossRef][Medline]
  4. 3
  5. Arthur, M., F. Depardieu, P. Reynolds, and P. Courvalin. 1996. Quantitative analysis of the metabolism of soluble cytoplasmic peptidoglycan precursors of glycopeptide-resistant enterococci. Mol. Microbiol. 21:33-44.[CrossRef][Medline]
  6. 4
  7. Arthur, M., C. Molinas, and P. Courvalin. 1992. The VanS-VanR two-component regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J. Bacteriol. 174:2582-2591.[Abstract/Free Full Text]
  8. 5
  9. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, NY.
  10. 6
  11. Boyd, D. A., J. Conly, H. Dedier, G. Peters, L. Robertson, E. Slater, and M. R. Mulvey. 2000. Molecular characterization of the vanD gene cluster and a novel insertion element in a vancomycin-resistant enterococcus isolated in Canada. J. Clin. Microbiol. 38:2392-2394.[Abstract/Free Full Text]
  12. 7
  13. Boyd, D. A., P. Kibsey, D. Roscoe, and M. R. Mulvey. 2004. Enterococcus faecium N03-0072 carries a new VanD-type vancomycin resistance determinant: characterization of the VanD5 operon. J. Antimicrob. Chemother. 54:680-683.[Abstract/Free Full Text]
  14. 8
  15. Boyd, D. A., M. A. Miller, and M. R. Mulvey. 2006. Enterococcus gallinarum N04-0414 harbors a VanD-type vancomycin resistance operon and does not contain a D-alanine:D-alanine 2 (ddl2) gene. Antimicrob. Agents Chemother. 50:1067-1070.[Abstract/Free Full Text]
  16. 9
  17. Bugg, T. D. H., G. D. Wright, S. Dutka-Malen, M. Arthur, P. Courvalin, and C. T. Walsh. 1991. Molecular basis for vancomycin resistance in Enterococcus faecium BM4147: biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance proteins VanH and VanA. Biochemistry 30:10408-10415.[CrossRef][Medline]
  18. 10
  19. Casadewall, B., and P. Courvalin. 1999. Characterization of the vanD glycopeptide resistance gene cluster from Enterococcus faecium BM4339. J. Bacteriol. 181:3644-3648.[Abstract/Free Full Text]
  20. 11
  21. Collins, L. A., S. M. Egan, and V. Stewart. 1992. Mutational analysis reveals functional similarity between NarX, a nitrate sensor in Escherichia coli K-12, and the methyl-accepting chemotaxis proteins. J. Bacteriol. 174:3667-3675.[Abstract/Free Full Text]
  22. 12
  23. Depardieu, F., P. Courvalin, and T. Msadek. 2003. A six amino acid deletion, partially overlapping the VanSB G2 ATP-binding motif, leads to constitutive glycopeptide resistance in VanB-type Enterococcus faecium. Mol. Microbiol. 50:1069-1083.[CrossRef][Medline]
  24. 13
  25. Depardieu, F., M. Kolbert, H. Pruul, J. Bell, and P. Courvalin. 2004. VanD-type vancomycin-resistant Enterococcus faecium and Enterococcus faecalis. Antimicrob. Agents Chemother. 48:3892-3904.[Abstract/Free Full Text]
  26. 14
  27. Depardieu, F., B. Perichon, and P. Courvalin. 2004. Detection of the van alphabet and identification of enterococci and staphylococci at the species level by multiplex PCR. J. Clin. Microbiol. 42:5857-5860.[Abstract/Free Full Text]
  28. 15
  29. Depardieu, F., I. Podglajen, R. Leclercq, E. Collatz, and P. Courvalin. 2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20:79-114.[Abstract/Free Full Text]
  30. 16
  31. Depardieu, F., P. E. Reynolds, and P. Courvalin. 2003. VanD-type vancomycin-resistant Enterococcus faecium 10/96A. Antimicrob. Agents Chemother. 47:7-18.[Abstract/Free Full Text]
  32. 17
  33. Domingo, M. C., A. Huletsky, R. Giroux, F. J. Picard, and M. G. Bergeron. 2007. vanD and vanG-like gene clusters in a Ruminococcus species isolated from human bowel flora. Antimicrob. Agents Chemother. 51:4111-4117.[Abstract/Free Full Text]
  34. 18
  35. Doty, S. L., M. C. Yu, J. I. Lundin, J. D. Heath, and E. W. Nester. 1996. Mutational analysis of the input domain of the VirA protein of Agrobacterium tumefaciens. J. Bacteriol. 178:961-970.[Abstract/Free Full Text]
  36. 19
  37. Evers, S., B. Casadewall, M. Charles, S. Dutka-Malen, M. Galimand, and P. Courvalin. 1996. Evolution of structure and substrate specificity in D-alanine:D-alanine ligases and related enzymes. J. Mol. Evol. 42:706-712.[CrossRef][Medline]
  38. 20
  39. Fan, C., P. C. Moews, C. T. Walsh, and J. R. Knox. 1994. Vancomycin resistance: structure of D-alanine:D-alanine ligase at 2.3 Å resolution. Science 266:439-443.[Abstract/Free Full Text]
  40. 21
  41. Greisen, K., M. Loeffelholz, A. Purohit, and D. Leong. 1994. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J. Clin. Microbiol. 32:335-351.[Abstract/Free Full Text]
  42. 22
  43. Jacob, A. E., and S. J. Hobbs. 1974. Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J. Bacteriol. 117:360-372.[Abstract/Free Full Text]
  44. 23
  45. Lavigne, J. P., H. Marchandin, N. Bouziges, and A. Sotto. 2005. First infection with VanD-type glycopeptide-resistant Enterococcus faecium in Europe. J. Clin. Microbiol. 43:3512-3515.[Abstract/Free Full Text]
  46. 24
  47. Le Bouguénec, C., G. de Cespédès, and T. Horaud. 1990. Presence of chromosomal elements resembling the composite structure Tn3701 in streptococci. J. Bacteriol. 172:727-734.[Abstract/Free Full Text]
  48. 25
  49. Liu, S. L., A. Hessel, and K. E. Sanderson. 1993. Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc. Natl. Acad. Sci. USA 90:6874-6878.[Abstract/Free Full Text]
  50. 26
  51. Liu, Y. G., and R. F. Whittier. 1995. Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25:674-681.[CrossRef][Medline]
  52. 27
  53. McCafferty, D. G., I. A. Lessard, and C. T. Walsh. 1997. Mutational analysis of potential zinc-binding residues in the active site of the enterococcal D-Ala-D-Ala dipeptidase VanX. Biochemistry 36:10498-10505.[CrossRef][Medline]
  54. 28
  55. Miller, J. F., S. A. Johnson, W. J. Black, D. T. Beattie, J. J. Mekalanos, and S. Falkow. 1992. Constitutive sensory transduction mutations in the Bordetella pertussis bvgS gene. J. Bacteriol. 174:970-979.[Abstract/Free Full Text]
  56. 29
  57. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71-112.[CrossRef][Medline]
  58. 30
  59. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448.[Abstract/Free Full Text]
  60. 31
  61. Périchon, B., B. Casadewall, P. Reynolds, and P. Courvalin. 2000. Glycopeptide-resistant Enterococcus faecium BM4416 is a VanD-type strain with an impaired D-alanine:D-alanine ligase. Antimicrob. Agents Chemother. 44:1346-1348.[Abstract/Free Full Text]
  62. 32
  63. Rasmussen, J. R., and J. L. Strominger. 1978. Utilization of a depsipeptide substrate for trapping acyl-enzyme intermediates of penicillin-sensitive D-alanine carboxypeptidases. Proc. Natl. Acad. Sci. USA 75:84-88.[Abstract/Free Full Text]
  64. 33
  65. Reynolds, P. E. 1998. Control of peptidoglycan synthesis in vancomycin-resistant enterococci: D,D-peptidases and D,D-carboxypeptidases. Cell. Mol. Life Sci. 54:325-331.[CrossRef][Medline]
  66. 34
  67. Russo, F. D., and T. J. Silhavy. 1991. EnvZ controls the concentration of phosphorylated OmpR to mediate osmoregulation of the porin genes. J. Mol. Biol. 222:567-580.[CrossRef][Medline]
  68. 35
  69. Shi, Y., and C. T. Walsh. 1995. Active site mapping of Escherichia coli D-Ala-D-Ala ligase by structure-based mutagenesis. Biochemistry 34:2768-2776.[CrossRef][Medline]
  70. 36
  71. Steers, E., E. L. Foltz, B. S. Graves, and J. Riden. 1959. An inocula replicating apparatus for routine testing of bacterial susceptibility to antibiotics. Antibiot. Chemother. (Basel) 9:307-311.
  72. 37
  73. Tanimoto, K., T. Nomura, H. Maruyama, H. Tomita, N. Shibata, Y. Arakawa, and Y. Ike. 2006. First VanD-type vancomycin-resistant Enterococcus raffinosus isolate. Antimicrob. Agents Chemother. 50:3966-3967.[Free Full Text]
  74. 38
  75. Werner, G., R. J. Willems, B. Hildebrandt, I. Klare, and W. Witte. 2003. Influence of transferable genetic determinants on the outcome of typing methods commonly used for Enterococcus faecium. J. Clin. Microbiol. 41:1499-1506.[Abstract/Free Full Text]
  76. 39
  77. Zhu, Y., and M. Inouye. 2002. The role of the G2 box, a conserved motif in the histidine kinase superfamily, in modulating the function of EnvZ. Mol. Microbiol. 45:653-663.[CrossRef][Medline]


Antimicrobial Agents and Chemotherapy, May 2009, p. 1952-1963, Vol. 53, No. 5
0066-4804/09/$08.00+0     doi:10.1128/AAC.01348-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Depardieu, F.
Right arrow Articles by Courvalin, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Depardieu, F.
Right arrow Articles by Courvalin, P.