This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gootz, T. D.
Right arrow Articles by Huard, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gootz, T. D.
Right arrow Articles by Huard, R. C.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, May 2009, p. 1998-2004, Vol. 53, No. 5
0066-4804/09/$08.00+0     doi:10.1128/AAC.01355-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Genetic Organization of Transposase Regions Surrounding blaKPC Carbapenemase Genes on Plasmids from Klebsiella Strains Isolated in a New York City Hospital{triangledown}

Thomas D. Gootz,1* Mary Kay Lescoe,1 Fadia Dib-Hajj,1 Brian A. Dougherty,2 Wen He,2 Phyllis Della-Latta,3 and Richard C. Huard3

Department of Infectious Diseases,1 Molecular Biology, Pfizer Global Research and Development, Groton, Connecticut 06340,2 Clinical Microbiology Service and the Department of Pathology, New York-Presbyterian Hospital, Columbia University Medical Center, New York, New York 100323

Received 9 October 2008/ Returned for modification 12 December 2008/ Accepted 19 February 2009


arrow
ABSTRACT
 
Carbapenem-resistant Klebsiella strains carrying Klebsiella pneumoniae carbapenemases (KPC) are endemic to New York City and are spreading across the United States and internationally. Recent studies have indicated that the KPC structural gene is located on a 10-kb plasmid-borne element designated Tn4401. Fourteen Klebsiella pneumoniae strains and one Klebsiella oxytoca strain isolated at a New York City hospital in 2005 carrying either blaKPC-2 or blaKPC-3 were examined for isoforms of Tn4401. Ten of the Klebsiella strains contained a 100-bp deletion in Tn4401, corresponding to the Tn4401a isoform. The presence of this deletion adjacent to the upstream promoter region of blaKPC in Tn4401a resulted in a different –35 promoter sequence of TGGAGA than that of CTGATT present in isoform Tn4401b. Complete sequencing of one plasmid carrying blaKPC from each of three nonclonal isolates indicated the presence of genes encoding other types of antibiotic resistance determinants. The 70.6-kb plasmid from K. pneumoniae strain S9 carrying blaKPC-2 revealed two identical copies of Tn4401b inserted in an inverse fashion, but in this case, one of the elements disrupted a group II self-splicing intron. In K. pneumoniae strain S15, the Tn4401a element carrying blaKPC-2 was found on both a large 120-kb plasmid and a smaller 24-kb plasmid. Pulsed-field gel electrophoresis results indicate that the isolates studied represent a heterogeneous group composed of unrelated as well as closely related Klebsiella strains. Our results suggest that endemic KPC-positive Klebsiella strains constitute a generally nonclonal population comprised of various alleles of blaKPC on several distinct plasmid genetic backgrounds. This study increases our understanding of the genetic composition of the evolving and expanding role of KPC-producing, healthcare-associated, gram-negative pathogens.


arrow
INTRODUCTION
 
Several recent studies have documented the existence of an Ambler class A carbapenemase (1, 7, 11) encoded on plasmids of Klebsiella pneumoniae called the K. pneumoniae carbapenemase (KPC). Currently there are eight KPC-type enzymes, although the sequences of KPC-1 and KPC-2 have been shown to be identical (http://www.lahey.org/Studies). Since first described in a K. pneumoniae isolate from the United States in 2001 (35), K. pneumoniae strains carrying the KPC gene have increased in frequency (3-6, 13, 21, 34, 37), global distribution (7-9, 16, 20, 30, 31), and host range with regard to the number of different species of gram-negative bacilli (GNB) that also carry them (8, 11, 15, 18, 21, 23, 33, 36, 37). In 2007, the first KPC variant was isolated from a Pseudomonas aeruginosa strain from Colombia, South America (29). KPC-positive strains have the potential to cause serious infections, as illustrated in one study (4) where a 47% mortality rate (9/19 patients) in intensive-care unit (ICU) patients was observed within 14 days of the patient having a positive blood culture with the microorganism. An important issue that complicates accurate detection of carbapenem resistance in such strains involves the problem with some rapid susceptibility testing procedures that employ small amounts of bacterial inocula, generating an MIC in the susceptible range (2, 22, 28). This can lead to false susceptibility results with respect to carbapenems and likely causes underreporting of KPC-containing microorganisms. To date, an approved susceptibility testing procedure has not been identified for these organisms (14).

Due to the rapid global dissemination of KPC-positive GNB, as well as the technical complexity observed with susceptibility testing methods for detecting strains carrying KPC carbapenemases (2, 28, 32), it is of great interest to determine the genetic mechanism responsible for the dissemination of the KPC gene. It is also important to characterize the clonality of healthcare-associated strains and the genetic environment surrounding KPC genes found in multiple isolates of GNB carrying this gene within local regions where these bacteria are endemic.

Initial studies of K. pneumoniae carrying KPC found that the blaKPC gene was carried by plasmids of various sizes (11, 20, 21). Early insight that this gene may be transposable between different genetic elements was suggested from the observation that portions of putative transposase and transposase helper genes were linked to the KPC structural gene (18, 20, 21). Recently, the genetic environment surrounding the blaKPC-2 gene on plasmids from three strains of K. pneumoniae and one of P. aeruginosa from diverse geographic sources was extensively characterized, identifying it as part of a 10-kb Tn3-based transposon designated Tn4401 (19). In addition to carrying blaKPC, this genetic element contained 39-bp imperfect inverted-repeat sequences, a transposase gene, a resolvase gene, and two novel insertion sequences, designated ISKpn6 and ISKpn7. Tn4401 was present in two isoforms which differed by a 100-bp deletion upstream of the KPC-2 structural gene. Tn4401a (containing the deletion) was identified in K. pneumoniae YC and K. pneumoniae GR isolated from the United States and Greece, respectively (19), while isoform Tn4401b (lacking the deletion) was identified from a K. pneumoniae strain and a P. aeruginosa strain isolated from Colombia (19). All of the Tn4401 elements were flanked by a 5-bp target site of duplication, suggestive of a recent transposition event. These authors proposed a series of genetic events that may have led to the genesis of Tn4401, accounting for the dissemination of the KPC gene on different plasmids in different species of bacteria around the globe.

The current study extends these observations and describes identical 10-kb elements carrying the blaKPC-2 or blaKPC-3 genes on several different plasmids recovered from 15 carbapenem-resistant Klebsiella strains isolated from patients at a New York City hospital in 2005. Both isoforms of Tn4401 were detected in these strains, and the element was inserted in duplicate as part of a group II intron on the same plasmid in one strain. Considerations for detection and identification of KPC genes in clinical isolates of bacteria are also discussed.

(Portions of this study were presented at the 18th European Congress of Clinical Microbiology and Infectious Diseases, Barcelona, Spain, 19 to 22 April 2008 [17].)


arrow
MATERIALS AND METHODS
 
Bacterial strains. A collection of 14 clinical isolates of K. pneumoniae and 1 Klebsiella oxytoca isolate was obtained from the New York-Presbyterian Hospital, Columbia University Medical Center, over the period of January to October 2005 (10). Information describing the isolation date, specimen source, hospital ward, and the antibiotic therapy received by each patient was also obtained. Electrocompetent Escherichia coli DH10B that does not express carbapenemase was used as the recipient in electroporation experiments. Several strains of GNB carrying genetically characterized β-lactamases were used as positive controls in PCR experiments as described previously (12).

Antimicrobial agents and MIC determinations. Initial MICs were determined at the hospital clinical microbiology laboratory using the Vitek 2 system (bioMérieux, Durham, NC) and at the Pfizer laboratories using the BD Phoenix microbiology system (Becton Dickinson, Sparks, MD) and broth microdilution tests, which were performed according to standards set by CLSI using cation-supplemented Mueller-Hinton broth (6). Samples of amikacin, gentamicin, and polymyxin B were obtained from Sigma (St. Louis, MO), while cefepime, ceftazidime, aztreonam, ciprofloxacin, imipenem, and meropenem were obtained from U.S. Pharmacopeia (Rockville, MD). Tigecycline was synthesized by Pfizer (Groton, CT).

Isolation of large plasmids. Plasmid DNA was isolated from the clinical strains using a Hi-Speed Qiagen kit (Valencia, CA) according to the manufacturer's instructions. Plasmids were separated on 0.5% agarose gels prepared with 0.04 M Tris-acetate-EDTA (pH 8.4) by electrophoresis at 90 V for 18 h at 4°C. Plasmids were treated with Epicentre plasmid-safe DNase (Epicentre, Madison, WI) in order to enrich plasmid DNA from contaminating genomic material. The supercoiled plasmid size markers (ranging from 165 kb to 8 kb) used in agarose gel electrophoresis experiments included the BAC-Tracker supercoiled DNA ladder (Epicentre, Madison, WI).

PFGE. Genomic DNA for pulsed-field gel electrophoresis (PFGE) was prepared as described previously by Saito et al. (25) and separated by the CHEF-DR IIII system (Bio-Rad, Hercules, CA). Genomic DNA fingerprints were generated from an XbaI digestion of DNA, followed by electrophoresis in agarose employing a pulse time of 2.2 to 63.8 s and a current of 6 V for 24 h in 0.5x Tris-borate-EDTA buffer (pH 8.4) at 14°C. The genetic relatedness among the clinical isolates was determined from the number of band differences observed in the resulting PFGE pattern (27). PFGE patterns that clustered at >85% similarity using the unweighted pair-group method using average linkages and Dice coefficients (BioNumerics v5.1; Applied Maths, Kortrijk, Belgium) were considered to be within the same pulsed-field type.

PCR and DNA sequencing of KPC genes. Identification of blaKPC genes was determined by PCR using isolated plasmid DNA with the following primers: KPCF (5'-TGTCACTGTATCGCCGTCTAG-3') and KPCR (5'-TTACTGCCCGTTGACGCCCAATCC-3'). PCR conditions were as follows: 3 min at 94°C and 30 cycles of 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C, followed by an elongation step for 10 min at 72°C which produced a band of 880 bp encompassing the entire KPC coding region. The primers used to amplify TEM and SHV β-lactamases were as follows: blaTEM-1-F (ATGAGTATTCAACATTTCCG), TEM-1-R (CTTAATCAGTGAGGCACC), SHV-OS-5-F (TTATCTCCCTGTTAGCCACC), and SHV-OS-6-R (GATTTGCTGATTTCGCTCGG). PCR analysis was performed with HiFi Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA). Cycle sequencing was performed according to the Applied Biosystems BigDye Terminator TaqFS v3.0 cycle sequencing protocol.

Southern blot hybridization analysis. Plasmid DNA digested with XhoI was hybridized to the 880-bp amplicon blaKPC DNA probe using a labeled digoxigenin nucleic acid detection system (Roche Diagnostics, Indianapolis, IN) by using standard methods (26).

Transformation experiments. Multiple attempts to electroporate KPC-containing plasmids were performed with plasmid DNA extracted from all 15 clinical isolates. Transformants were selected on LB agar plates containing 1 µg/ml imipenem after incubation for 24 h at 35°C.

Plasmid DNA sequencing. Determination of the genetic environment surrounding the blaKPC gene was initially accomplished by sequencing 8 kb of adjacent DNA from each end of the KPC structural gene encoded on the 75.6-kb plasmid isolated from K. pneumoniae strain S12 (17). Sequencing of three full-length plasmids isolated from three clonally distinct isolates of K. pneumoniae (strains S9, S12, and S15) expressing the blaKPC-2 or blaKPC-3 gene was conducted by Agencourt Bioscience (Beverly, MA). Sequencing analyses were performed online using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/), and the DNA sequence was submitted to the JCVI Annotation Service, where it was run through JCVI's prokaryotic annotation pipeline. The manual annotation tool Manatee was downloaded from Source Forge (http://manatee.sourceforge.net) and used to manually review the output from the pipeline. Determination of the genetic environment around the KPC gene for the remaining 12 strains was accomplished by using the following primers: CETnF1 (5'-CATGGCGTAGGTTGTTGTCGC) and CETnR1 (5'-GCGGCAGAAGCCAAAATCG). Promoter analysis for all 15 blaKPC genes was determined using the BProm software (http://www.softberry.com).


arrow
RESULTS
 
Description of 14 K. pneumoniae isolates and 1 K. oxytoca clinical isolate. The 15 carbapenem-resistant Klebsiella strains were isolated from samples of sputum, wounds, urine, blood, abscess drainage, and tracheal aspirates from different patients from widely dispersed wards in a New York City hospital (cardiac ICU, medicine, surgery, neurology, oncology, and surgical and pediatric ICUs). There was little evidence available to suggest a point source of the KPC-positive infections. More recent information indicates that such strains are now endemic to this hospital (32). Records indicated that 11 of the 15 isolates came from patients who had received a wide variety of antibiotics (piperacillin-tazobactam, aztreonam, ciprofloxacin, levofloxacin, imipenem, meropenem, or tobramycin) alone or in combination within 30 days prior to isolation of the KPC-containing isolate. As illustrated in Table 1, these isolates were resistant to multiple antimicrobial agents, including imipenem, meropenem, ceftazidime, cefepime, aztreonam, ciprofloxacin, and amikacin. Susceptibility to tigecycline was variable, with MICs ranging from 0.25 to 4 µg/ml. The activity of polymyxin B was also variable, with MICs from 2 to 16 µg/ml.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Susceptibility test results for the 15 KPC-containing strains

Plasmid analysis for blaKPC. Whole plasmids extracted from the clinical isolates followed by electrophoresis in agarose revealed a very heterogeneous range of plasmids among the strains, ranging in size from 30 kb to >120 kb (17). Several isolates also contained smaller plasmids in the 14- to 20-kb range. The isolated plasmids were then digested with XhoI, followed by electrophoresis in agarose, and the resulting DNA fragments were transferred to nitrocellulose paper and probed with the 880-bp KPC gene. The resulting XhoI digest revealed the presence of an approximately 3.5-kb common DNA fragment which hybridized with the KPC probe, indicating that the genetic organization within the element is very similar among the different strains tested (17). Amplification and sequencing of the complete KPC genes from all 15 strains indicated that 13/15 strains contained blaKPC-2, while 2/15 contained blaKPC-3 (Table 2). Multiple attempts to transfer the KPC gene to E. coli DH10B by electroporation were successful with plasmids from three Klebsiella strains (S9, S12, and S15). Carbapenem resistance (16 µg/ml) was transferred with acquisition of the KPC-carrying plasmid from S9 and S15, indicating that no other resistance determinant was necessary to elevate carbapenem MICs to 16 to 32 µg/ml. The transformant containing the 76.6-kb plasmid from S12 had imipenem and meropenem MICs of 2 µg/ml.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Genetic characterization of the 15 KPC-positive Klebsiella isolates

Sequencing of the open reading frames surrounding the blaKPC genes from all 15 strains revealed that the structural gene is part of a 10-kb element containing transposase genes related to Tn3. This element was designated Tn4401 by Naas et al. (19) and has been found entirely or in part in all of the blaKPC sequences so far deposited in GenBank. A comparison of the 10-kb Tn4401 element found in the 15 strains we studied with those deposited in EMBL/GenBank (accession numbers EU176011 to EU176014) indicated that this Tn3-related element existed as two distinct isoforms differing by a 100-bp deletion occurring at nucleotide 7666 according to sequence accession number EU176012 (19). The Tn4401 regions in these strains had a high G+C content (~62%). The region contains genes for three transposases and two transposase-associated proteins, blaKPC, and a 67% G+C TnpR gene that is often part of integrative and conjugative elements. As shown in Table 2, 10/15 of the elements carried this deletion and were classified as Tn4401a following the designation of Naas et al. (19). The presence of this deletion adjacent to the upstream promoter region of blaKPC in Tn4401a resulted in a different –35 promoter sequence of TGGAGA than that of CTGATT present in isoform Tn4401b. Whether this difference affected expression of the carbapenemase genes in these two isoforms is unknown. The blaKPC-2 was found to be associated with both the Tn4401a and Tn4401b isoforms, while blaKPC-3 was restricted to the Tn4401b isoform. No meaningful differences in the magnitude of carbapenem MICs were observed between strains containing the two isoforms.

An important aspect describing the acquisition of KPC-containing Klebsiella strains at a given medical center involves a molecular comparison of the strains to determine whether there is an ongoing clonal outbreak or if multiple infections are due to the acquisition of unrelated isolates. KPC-positive clinical strains have been recurrently isolated from the hospital site over several years, and so a collection of the unique strains for further evaluation was organized based upon their antimicrobial susceptibility patterns. Genomic DNA samples prepared from 14 K. pneumoniae strains were subjected to restriction analysis with XbaI and compared directly by PFGE. As indicated by the dendrogram (Fig. 1) this set of strains consists of six major pulsotypes (A to F). The most common pattern observed has been designated pulsotype A, containing seven subtypes, A1 through A7. The remaining strains (S11, S7, S9, S4, and S12) are more heterogeneous and are designated on the dendrogram as pulsotypes B1, C1, D1, E1, and F1, respectively (27).


Figure 1
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 1. Dendrogram derived from PFGE analysis of XbaI genomic digests of 14 K. pneumoniae strains.

Detection of other β-lactamase genes. The presence of KPC suggested that the carbapenem resistance observed in all 15 isolates was mediated by this Ambler class A enzyme. PCR analysis of all strains using family primers and positive control strains for Ambler class B (IMP, SPM-1, and VIM) metallo-β-lactamases, Ambler class D carbapenemases (OXA-23 to OXA-27 and OXA-33, OXA-40, OXA-48, OXA-49, OXA-51, and OXA-58), or other Ambler class A carbapenemases (IMI, NMC, and SME-1) failed to reveal the presence of other carbapenemase genes. Additional PCR and sequencing analyses revealed the presence of TEM-1 and/or SHV-11 and SHV-12 in all of the strains so evaluated (Table 2).

Complete plasmid sequencing. The genetic environments of the blaKPC genes were examined in detail by obtaining the complete sequence of plasmids from K. pneumoniae strains S9, S12, and S15 shown by PFGE to be clonally distinct (Fig. 1). The KPC-carrying plasmids isolated from E. coli DH10B following electroporation included a 75.6-kb plasmid from S12, a 24.3-kb plasmid from S15, and a 70.6-kb plasmid from S9. A BLAST comparison of these plasmids against sequenced plasmids from K. pneumoniae deposited in GenBank revealed various degrees of homology. The plasmid from S9 showed the highest degree of homology (51%) with a recently submitted Klebsiella plasmid from China (EU195449), particularly in genes associated with conjugal transfer. Similarly, the plasmid from S12 showed partial alignment with several plasmids, mainly in genes associated with conjugal transfer and aminoglycoside resistance. The 24.3-kb plasmid from S15 possessed 25% alignment with plasmid KPN4 (CP.000649) from K. pneumoniae MGH78578. Much of this alignment was in genes encoding aminoglycoside resistance.

The map of the 75.6-kb plasmid (accession number FJ223605) is provided in Fig. 2. The 10-kb Tn4401b element is shown on this plasmid carrying blaKPC-3 surrounded by genes encoding full-length transposases and a recombinase. In addition, genes putatively encoding other antimicrobial resistance determinants were present, including a streptomycin phosphotransferase, a 3'-adenyltransferase, and the AAC(6') acetyltransferase. Also, genes encoding an OXA-9 penicillinase and a dihydropteroate synthetase were identified. Resistance to gentamicin, amikacin, and tobramycin (MICs of 32, 32, and >64 µg/ml, respectively) was transferred to E. coli DH10B that received this plasmid, indicating that the gene(s) encoding aminoglycoside resistance was functional. Genes associated with the Tra family of plasmid transfer were also identified on this plasmid, suggesting that it may be self-transmissible to other bacteria (Fig. 2). Analysis of a 24-kb plasmid (accession number FJ223606) and a 120-kb plasmid from K. pneumoniae strain S15 indicated that both contained a complete 10-kb copy of Tn4401a carrying KPC-2 which was inserted within a MobB gene. In addition, the 24-kb plasmid carried an aminoglycoside acetyltransferase AAC(6') and a MobC gene (Fig. 3).


Figure 2
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 2. Partial annotation of full-length 75.6-kb plasmid carrying blaKPC-3 from K. pneumoniae S12.


Figure 3
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 3. Partial annotation of the full-length 24.3-kb plasmid carrying blaKPC-2 from K. pneumoniae S15.

Examination of the genetic environment around the blaKPC-2 gene carried by a 70.6-kb plasmid (accession number FJ223607) from K. pneumoniae strain S9 revealed the presence of two Tn4401b elements inserted in an inverted orientation. Both elements were separated by a group II intron maturase, IS110, esterase, and alcohol dehydrogenase genes (Fig. 4). Interestingly, a copy of the intron reverse transcriptase gene was found at the end of one of the elements, but both maturase and reverse transcriptase were not in the same reading frame. Examination of this region indicates that one or both copies of Tn4401b inserted into the group II intron, one copy at the maturase gene and one adjacent to the reverse transcriptase gene. To our knowledge, this is the first report of this type of insertional arrangement of genetic elements encoding KPC.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		FIG. 4. Linear map (10,860 bp) from 70.6-kb plasmid isolated from K. pneumoniae S9 showing the double, inverted insertion of Tn4401b element (striped bar) adjacent to group II intron genes.


arrow
DISCUSSION
 
While genetic information for the strains in this study was presented in early 2008 (17), a subsequent study detailing the genetic environment surrounding the KPC gene was published describing the common 10-kb element Tn4401 (19). This important paper provided critical insight into the formation of a putatively transposable element found on plasmids in K. pneumoniae and P. aeruginosa that may well be responsible for the rapid global dissemination of this gene. In our study, the KPC gene was carried on a broad variety of different plasmids isolated from 15 Klebsiella spp., and most strains were resistant to carbapenems and many other β-lactams when tested by broth microdilution at the appropriate inoculum. These strains were also resistant to most other commonly used antimicrobial agents, and transfer of two of the plasmids to an E. coli DH10B recipient confirmed that aminoglycoside resistance was also encoded on those plasmids. The presence of multiple antimicrobial resistance determinants on these KPC-containing plasmids results in multiple points of selective pressure for plasmid maintenance in the original isolate as well as in the clinical environment. Since the KPC carbapenemases possess such a broad substrate spectrum, use of penicillins and cephalosporins also supplies selective pressure in the clinical environment. This situation favors an endemic relationship with these isolates over time and also likely helps to transfer plasmids from one isolate to another. As in a recently reported case (19), one of the current strains (S15) contained the KPC gene on two different plasmids, reflecting the ability of the gene to mobilize to different species of DNA in a cell.

It has proven difficult to identify a point source for dissemination of KPC-positive strains. To this point, the strains in this study were isolated from patients housed in several different hospital locations. Thus, this study represented an endemic situation at this institution as opposed to being a first isolation, and this was reflected in the heterogeneous nature of the strains examined. A major advance in understanding the mechanism of dissemination of blaKPC occurred when the gene was found to be part of an identical 10-kb element in K. pneumoniae and P. aeruginosa isolated from diverse global locales. Ten out of 15 of the Klebsiella strains studied herein contained the Tn4401a isoform containing a 100-bp deletion, while the remaining five strains contained the full-length Tn4401b. We determined that the presence of this deletion upstream of blaKPC causes a change in the –35 promoter sequence (TGGAGA to CTGATT) and so may have some as-yet-undetermined biological consequences. Naas et al. (19) identified the 100-bp deletion in this region from two clinical strains of K. pneumoniae, GR and YC, isolated from Greece and the United States, respectively, and they point out that another KPC sequence deposited in GenBank (DQ989640) contains a 200-bp deletion in this area. These authors propose that this region of the element is unstable, suggesting that other isoforms of Tn4401 likely exist. It is interesting that in the current study, both isoforms were identified from different Klebsiella strains isolated in the same hospital in New York City over a 10-month period. It is unusual that the KPC element, which was found as part of the 70.6-kb plasmid in strain S9, was inserted into a group II intron as a double copy. It is not known whether this duplicate copy of the element is related to its position in the intron. Group II introns are self-splicing elements that can encode complicated RNA secondary structures, and the presence of the KPC encoding element surrounded by both reverse transcriptase and maturase genes in different orientations is unusual (24). It can only be hypothesized that the self-splicing properties of the group II intron on this plasmid contributed to the duplication of the Tn4401b element. It is unclear whether this duplication provides any advantage in terms of resistance to carbapenems. There was no evident gene duplication effect in terms of the magnitude of the carbapenem MICs in this strain or in strain S15 carrying blaKPC on two different plasmids.

PFGE analysis of genomic digests indicated that several of the isolates in our study were unrelated, suggesting that different clones containing different isoforms of Tn4401 have arrived in this hospital environment from varied sources or that some closely related clones have acquired the KPC element, perhaps from genetic transfer of DNA between isolates resident in the New York City hospital environment. These possibilities reflect the plasticity of the Klebsiella genome, particularly during its active evolution under the selective pressure of antibiotic use.

Our observations regarding the heterogeneity of Klebsiella carrying blaKPC in the New York City hospital environment reflect the dynamics during a situation in which multiantibiotic-resistant bacteria are endemic. As the KPC strains disseminate globally, initial outbreak isolates from a single institution will likely be composed of clonal isolates. Since definitive identification of KPC isolates must involve amplification of the KPC gene, care must be taken over time to molecularly characterize subsequent KPC isolates. This is important since efforts to contain the spread of an initial clonal isolate throughout a hospital may be very different from efforts aimed at managing an endemic situation involving multiple strains and species containing this gene. Between 2002 and 2006, the rate of carbapenem-resistant K. pneumoniae strains rose from 4 to 18% in the institution where the KPC-containing Klebsiella strain studied herein was isolated (32). Given the important role carbapenems play in the treatment of multiantibiotic-resistant bacteria, such rates of endemicity are disconcerting as is the high-level resistance to fluoroquinolones present in many β-lactam-resistant E. coli and Klebsiella strains, which removes another important class of antimicrobials from effective use (4, 5, 8).

Our results, together with those of Naas et al. (19), provide important information regarding the active evolution of plasmid-carried KPC carbapenemase genes as part of two isoforms of Tn4401. Unfortunately, this element is now found on plasmids from P. aeruginosa and other antibiotic-resistant Enterobacteriaceae. Clinicians and hospital laboratories must take an aggressive approach in conducting molecular epidemiological tests that can document and monitor the spread of this important resistance element throughout the global population of multidrug-resistant GNB.


arrow
ACKNOWLEDGMENTS
 
We thank Richard Goering for help with the dendrogram analysis. We also thank JCVI for providing the JCVI Annotation Service, which provided us with automatic annotation data and the manual annotation tool Manatee. We also acknowledge the assistance of A. Marra and J. Quinn in the review of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Pfizer Global Research and Development, MS 8118W-211, Building 118W, Groton, CT 06340. Phone: (860) 526-4541. Fax: (860) 715-8162. E-mail: tdgootz{at}yahoo.com Back

{triangledown} Published ahead of print on 2 March 2009. Back


arrow
REFERENCES
 
    1
  1. Alba, J., Y. Ishii, K. Thomson, S. Moland Ellen, and K. Yamaguchi. 2005. Kinetics study of KPC-3, a plasmid-encoded class A carbapenem-hydrolyzing β-lactamase. Antimicrob. Agents Chemother. 49:4760-4762.[Abstract/Free Full Text]
    2. 2
  2. Anderson, K. F., D. R. Lonsway, J. K. Rasheed, J. Biddle, B. Jensen, L. K. McDougal, R. B. Carey, A. Thompson, S. Stocker, B. Limbago, and J. B. Patel. 2007. Evaluation of methods to identify the Klebsiella pneumoniae carbapenemase in Enterobacteriaceae. J. Clin. Microbiol. 45:2723-2725.[Abstract/Free Full Text]
    3. 3
  3. Bradford, P. A., S. Bratu, C. Urban, M. Visalli, N. Mariano, D. Landman, J. J. Rahal, S. Brooks, S. Cebular, and J. Quale. 2004. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 β-lactamases in New York City. Clin. Infect. Dis. 39:55-60.[CrossRef][Medline]
    4. 4
  4. Bratu, S., D. Landman, R. Haag, R. Recco, A. Eramo, M. Alam, and J. Quale. 2005. Rapid spread of carbapenem-resistant Klebsiella pneumoniae in New York City: a new threat to our antibiotic armamentarium. Arch. Intern. Med. 165:1430-1435.[Abstract/Free Full Text]
    5. 5
  5. Bratu, S., P. Tolaney, U. Karumudi, J. Quale, M. Mooty, S. Nichani, and D. Landman. 2005. Carbapenemase-producing Klebsiella pneumoniae in Brooklyn, N.Y.: molecular epidemiology and in vitro activity of polymyxin B and other agents. J. Antimicrob. Chemother. 56:128-132.[Abstract/Free Full Text]
    6. 6
  6. Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial susceptibility testing; 15th informational supplement. CLSI M100-S15. Clinical and Laboratory Standards Institute, Wayne, PA.
    7. 7
  7. Cuzon, G., T. Naas, M. C. Demachy, and P. Nordmann. 2008. Plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC in Klebsiella pneumoniae isolate from Greece. Antimicrob. Agents Chemother. 52:796-797.[Free Full Text]
    8. 8
  8. Deshpande, L. M., P. R. Rhomberg, H. S. Sader, and R. N. Jones. 2006. Emergence of serine carbapenemases (KPC and SME) among clinical strains of Enterobacteriaceae isolated in the United States medical centers: report from the MYSTIC Program (1999-2005). Diagn. Microbiol. Infect. Dis. 56:367-372.[CrossRef][Medline]
    9. 9
  9. Gootz, T. D. 2006. The forgotten Gram-negative bacilli: what genetic determinants are telling us about the spread of antibiotic resistance. Biochem. Pharmacol. 71:1073-1084.[CrossRef][Medline]
    10. 10
  10. Gootz, T., F. Dib-Hajj, M. K. Lescoe, R. C. Huard, and P. Della Latta. 2007. Multiresistant Klebsiella pneumoniae from NYC hospitals contain β-lactamase KPC-2 or KPC-3 and porin changes, abstr. 0496. Abstr. 17th Eur. Congr. Clin. Microbiol. Infect. Dis., Munich, Germany.
    11. 11
  11. Hossain, A., M. J. Ferraro, R. M. Pino, R. B. Dew III, E. S. Moland, T. J. Lockhart, K. S. Thomson, R. V. Goering, and N. D. Hanson. 2004. Plasmid-mediated carbapenem-hydrolyzing enzyme KPC-2 in an Enterobacter sp. Antimicrob. Agents Chemother. 48:4438-4440.[Abstract/Free Full Text]
    12. 12
  12. Kaczmarek, F. M., F. Dib-Hajj, W. Shang, and T. D. Gootz. 2006. High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of blaACT-1 β-lactamase production, porin OmpK35/36 insertional inactivation, and down-regulation of the phosphate transport porin PhoE. Antimicrob. Agents Chemother. 50:3396-3406.[Abstract/Free Full Text]
    13. 13
  13. Ke, W., C. R. Bethel, J. M. Thomson, R. A. Bonomo, and F. van den Akker. 2007. Crystal structure of KPC-2: insights into carbapenemase activity in class A beta-lactamases. Biochemistry 46:5732-5740.[CrossRef][Medline]
    14. 14
  14. LaBombardi, V. J. 2007. The emergence of the KPC carbapenemases: clinical and laboratory issues. Rev. Med. Microbiol. 18:29-34.
    15. 15
  15. Landman, D., S. Bratu, S. Kochar, M. Panwar, M. Trehan, M. Doymaz, and J. Quale. 2007. Evolution of antimicrobial resistance among Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumoniae in Brooklyn, N.Y. J. Antimicrob. Chemother. 60:78-82.[Abstract/Free Full Text]
    16. 16
  16. Leavitt, A., S. Navon-Venezia, L. Chmelnitsky. M. J. Schwaber, and Y. Carmeli. 2007. Emergence of KPC-2 and KPC-3 in carbapenem-resistant Klebsiella pneumoniae strains in an Israeli hospital. Antimicrob. Agents Chemother. 51:3026-3029.[Abstract/Free Full Text]
    17. 17
  17. Lescoe, M. K., B. Dougherty, S. Williams, W. He, F. Dib-Hajj, and T. Gootz. 2008. Genetic organization of transposase regions surrounding bla-KPC carbapenemase genes on plasmids from Klebsiella pneumoniae, abstr. P-2004. Abstr. 18th Eur. Congr. Clin. Microbiol. Infect. Dis., Barcelona, Spain.
    18. 18
  18. Miriagou, V., L. S. Tzouvelekis, S. Rossiter, E. Tzelepi, F. J. Angulo, and J. Whichard. 2003. Imipenem resistance in a Salmonella clinical strain due to plasmid-mediated class A carbapenemase KPC-2. Antimicrob. Agents Chemother. 47:1297-1300.[Abstract/Free Full Text]
    19. 19
  19. Naas, T., G. Cuzon, M.-V. Villegas, M.-F. Lartigue, J. P. Quinn, and P. Nordmann. 2008. Genetic structures at the origin of acquisition of the β-lactamase blaKPC gene. Antimicrob. Agents Chemother. 52:1257-1263.[Abstract/Free Full Text]
    20. 20
  20. Naas, T., P. Nordmann, G. Vedel, and C. Poyart. 2005. Plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC in a Klebsiella pneumoniae isolate from France. Antimicrob. Agents Chemother. 49:4423-4424.[Free Full Text]
    21. 21
  21. Navon-Venezia, S., I. Chmelnitsky, A. Leavitt, M. J. Schwaber, D. Schwartz, and Y. Carmeli. 2006. Plasmid-mediated imipenem-hydrolyzing enzyme KPC-2 among multiple carbapenem-resistant Escherichia coli clones in Israel. Antimicrob. Agents Chemother. 50:3098-3101.[Abstract/Free Full Text]
    22. 22
  22. Nordmann, P., and L. Poirel. 2002. Emerging carbapenemases in gram-negative aerobes. Clin. Microbiol. Infect. 8:321-331.[CrossRef][Medline]
    23. 23
  23. Petrella, S, N. Ziental-Gelus, C. Mayer, M. Renard, V. Jarlier, and W. Sougakoff. 2008. Genetic and structural insights into the dissemination potential of the extremely broad-spectrum class A β-lactamase KPC-2 identified in an Escherichia coli strain and an Enterobacter cloacae strain isolated from the same patient in France. Antimicrob. Agents Chemother. 52:3725-3736.[Abstract/Free Full Text]
    24. 24
  24. Rodríguez-Trelles, F., R. Tarrio, and F. Ayala. 2006. Models of the spliceosomal intron proliferation in the FACE of widespread ectopic expression. Gene 366:201-208.[CrossRef][Medline]
    25. 25
  25. Saito, M., A. Ukmeda, and S.-I. Yoshida. 1999. Subtyping of Haemophilus influenzae strains by pulsed-field gel electrophoresis. J. Clin. Microbiol. 37:2141-2147.
    26. 26
  26. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
    27. 27
  27. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaninathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239.[Medline]
    28. 28
  28. Tenover, F. C., R. K. Kalsi, P. P. Williams, R. B. Carey, S. Stocker, D. Lonsway, J. K. Rasheed, J. W. Biddle, J. E. McGowan, Jr., and B. Hanna. 2006. Carbapenem resistance in Klebsiella pneumoniae not detected by automated susceptibility testing. Emerg. Infect. Dis. 12:1209-1213.[Medline]
    29. 29
  29. Villegas, M. V., K. Lolans, A. Correa, J. N. Kattan, J. A. Lopez, J. P. Quinn, and the Colombian Nosocomial Resistance Study Group. 2007. First identification of Pseudomonas aeruginosa isolates producing a KPC-type carbapenem-hydrolyzing β-lactamase. Antimicrob. Agents Chemother. 51:1553-1555.[Abstract/Free Full Text]
    30. 30
  30. Villegas, M. V., K. Lolans, A. Correa, C. J. Suarez, J. A. Lopez, M. Vallejo, J. P. Quinn, and the Colombian Nosocomial Resistance Study Group. 2006. First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrob. Agents Chemother. 50:2880-2882.[Abstract/Free Full Text]
    31. 31
  31. Wei, Z.-Q., X.-X. Du, Y.-S. Yu, P. Shen, Y.-G. Chen, and L.-J. Li. 2007. Plasmid-mediated KPC-2 in a Klebsiella pneumoniae isolate from China. Antimicrob. Agents Chemother. 51:763-765.[Abstract/Free Full Text]
    32. 32
  32. Whittier, S., F. Wu, and P. Della-Latta. 2007. Comparison of antimicrobial susceptibility tests for the detection of KPC-positive strains of Klebsiella pneumoniae, abstr. P-1629. Abstr. 17th Congr. Clin. Microbiol. Infect. Dis., Munich, Germany.
    33. 33
  33. Woodford, N., J. W. Dallow, R. L. Hill, M. F. Palepou, R. Pike, M. E. Ward, M. Warner, and D. M. Livermore. 2007. Ertapenem resistance among Klebsiella and Enterobacter submitted in the UK to a reference laboratory. Int. J. Antimicrob. Agents 29:456-459.[CrossRef][Medline]
    34. 34
  34. Woodford, N., P. M. Tierno, Jr., K. Young, L. Tysall, M. F. I. Papelou, E. Ward, R. E. Painter, D. F. Suber, D. Shungu, L. L. Silver, K. Inglima, J. Kornblum, and D. M. Livermore. 2004. Outbreak of Klebsiella pneumoniae producing a new carbapenem-hydrolyzing class A β-lactamase, KPC-3, in a New York medical center. Antimicrob. Agents Chemother. 48:4793-4799.[Abstract/Free Full Text]
    35. 35
  35. Yigit, H., A. M. Queenan, G. J. Anderson, A. Domenech-Sanchez, J. W. Biddle, C. D. Steward, S. Ablerti, K. Bush, and F. C. Tenover. 2001. Novel carbapenem-hydrolyzing β-lactamase KPC-1 from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45:1151-1161.[Abstract/Free Full Text]
    36. 36
  36. Yigit, H., A. M. Queenan, J. K. Rasheed, J. W. Biddle, A. Domenech-Sanchez, S. Ablerti, K. Bush, and F. C. Tenover. 2003. Carbapenem-resistant strains of Klebsiella oxytoca harboring carbapenem-hydrolyzing β-lactamase KPC-2. Antimicrob. Agents Chemother. 47:3881-3889.[Abstract/Free Full Text]
    37. 37
  37. Zhang, R., H. W. Zhou, J. C. Cai, and G. X. Chen. 2007. Plasmid-mediated carbapenem-hydrolysing β-lactamase KPC-2 in carbapenem-resistant Serratia marcescens isolates from Hangzhou, China. J. Antimicrob. Chemother. 59:574-576.[Free Full Text]

Antimicrobial Agents and Chemotherapy, May 2009, p. 1998-2004, Vol. 53, No. 5
0066-4804/09/$08.00+0     doi:10.1128/AAC.01355-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Leavitt, A., Chmelnitsky, I., Ofek, I., Carmeli, Y., Navon-Venezia, S. (2009). Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain. J Antimicrob Chemother 0: dkp417v1-dkp417 [Abstract] [Full Text]  
  • Giani, T., D'Andrea, M. M., Pecile, P., Borgianni, L., Nicoletti, P., Tonelli, F., Bartoloni, A., Rossolini, G. M. (2009). Emergence in Italy of Klebsiella pneumoniae Sequence Type 258 Producing KPC-3 Carbapenemase. J. Clin. Microbiol. 47: 3793-3794 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gootz, T. D.
Right arrow Articles by Huard, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gootz, T. D.
Right arrow Articles by Huard, R. C.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»