Article Figures & Data
Figures
- Fig. 1.
Sequencing strategy for CARB-6 β-lactamase gene. The CARB-6 gene is represented by the black box. The arrows indicate the oligonucleotide positions.
- Fig. 2.
Gene sequence and deduced amino acid sequence of theV. cholerae β-lactamase (CARB-6). The deduced amino acid sequence is designated by the one-letter code. The active site,STFK, is boxed, and the differences relative to CARB-1 to CARB-3 are underlined.
- Fig. 3.
Multiple sequence alignment of the amino acid sequences of CARB-1, CARB-2, CARB-3, CARB-4, P. mirabilis N29,P. mirabilis GN79, and CARB-6 β-lactamases. The shadowed boxes (I to VII) correspond to amino acid boxes conserved in all penicillin-recognizing enzymes, as identified by Joris et al. (14). Alpha-helix and beta-barrel motifs are indicated from the PC-1 crystal structure (4, 12). Asterisks indicate the conserved residues specific for class A β-lactamases. Amino acid changes are written as black letters in white boxes. Sequences are numbered as described by Ambler (2).
Tables
- Table 1.
Oligonucleotide primers used for PCR amplification
Primer pair Location (5′-3′)a Sequence (5′-3′) V1 44–65 TTGATGTTATGGAGCAGCAACG V1′ 266–248 CAATTGCCTTAACGTCTTG V2 75–88 AGCAGGGCAGTCGC V2′ 254–236 CGTCTTGTTCAACTTGCTG V3 235–254 TCAGCAAGTTGAACAAGACG V3′ 899–878 CAACTGCTGTAATACTCCGAGC V4 684–708 TGAGGGATACGACAACTCCTAAGGC V4′ 1047–1027 TGTTAGCCTTATCAGCGCGAC ↵a Oligonucleotide positions are given according to their location on the CARB-3 gene sequence as described elsewhere (4).
- Table 2.
Physicochemical properties of the CARB-6 β-lactamase ofV. cholerae and comparison with TEM-1 and other carbenicillin-hydrolyzing enzymes
β-Lactamase Mol wt pIa CARB-6 33,000b 5.35 SAR-1 33,700b 4.9 TEM-1 28,911c 5.4 CARB-1 31,405c 5.3 CARB-2 31,347c 5.7 CARB-3 31,313c 5.75 ↵a pI was determined in a polyacrylamide gel with an Ampholine gradient (pH 3.5 to 9.5; Pharmacia).
↵b Molecular weight determined by electrophoresis in an SDS–12% polyacrylamide gel by the method of Laemmli (19) with low-range prestained SDS-polyacrylamide gel electrophoresis standards.
↵c Molecular weight as estimated according to the amino acid sequence. The molecular mass of CARB-6 calculated according to the amino acid composition is 31,429 Da (Bio-Oriented Web Server Facilities, ABIM-Aix Marseille University).
- Table 3.
Kinetic parameters for V. cholerae CARB-6 β-lactamase in comparison with the published values for β-lactamases TEM-1, SAR-1, and CARB-1 to CARB-3a
Antibiotic Km(μM) Vm(relative)b CARB-6 SAR-1 TEM-1 CARB-1 CARB-2 CARB-3 CARB-6 SAR-1 TEM-1 CARB-1 CARB-2 CARB-3 Penicillin G 96 42 24 13 7.3 9.8 100 100 100 100 100 100 Amoxicillin 157 —c 43 13.6 16.4 21.8 266 — 84 63 128 97 Ampicillin — 68 35 30 20.9 24 — 63 111 94.5 93 100 Ticarcillin 55 — 10 40 18.8 21 59 — 3 88 126 97 Carbenicillin — 190 14 122 72 95 — 122 10 126 343 147 Piperacillin 7 — 43 — — — 15.9 — 86 — — — Mezlocillin 58.5 — 246 15.5 14 20 100 — 100 86 83 111 Oxacillin 37 — 6 58 31 24.5 5.25 — 5 5.4 11.4 12.5 Cephaloridine 526 93 950 40.5 208 418 59.5 21 76 14.6 16 44.2 Cephalothin — — — — — — <0.5 — 20 1.25 0.8 0.5 - Table 4.
Effects of chemical and β-lactam inhibitors on CARB-6, SAR-1, and TEM-1 β-lactamasesa
Substrates % Inhibition (concn [μM] of inhibitor)a CARB-6 SAR-1 TEM-1 NaCl 3 (5.104) —b 0 Cloxacillin 100 (100) 50 (7) 70 (100) Oxacillin 50 (100) — — Methicillin 100 (100) — — Tazobactam 50 (0.06) — 50 (0.74) Sulbactam 50 (1.4) — 50 (19) Clavulanic acid 50 (0.075) 50 (0.005) 50 (0.034) PCMBc 52 (20) 50 (>100) 50 (200) ↵a Data for SAR-1 (29) and TEM-1 (21) have been published previously. Results are expressed as percentage of inhibited activity at the indicated concentration of inhibitor in the presence of benzylpenicillin. The inhibitory effects of clavulanic acid and sulbactam were determined after preincubation with the enzyme for 10 min at 37°C.
↵b —, not determined.
↵c PCMB, p-hydroxymercuribenzoate.
- Table 5.
Amino acid point mutations in β-lactamases CARB-1, CARB-2, CARB-3, and CARB-6
Amino acid positiona Amino acid changeb CARB-6 CARB-1 CARB-2 CARB-3 192 Gln Lys Lys Lys 193 Lys Phe Phe Lys 198 Thr Ala Ala Ala 202 Ala Met Met Met 203 Ser Asn Asn Asn 227 Val Ala Ala Ala 228 Lys Gly Gly Gly 230 Ser Asn Asn Asn 249 Ile Val Val Val 255 Glu His His His 256 Lys Gln Gln Gln 257 Lys Ala Ala Ala 258 Thr Pro Pro Pro 269 Glu Gln Gln Gln 273 Ala Glu Ala Ala 284 Arg His His His 288 Glu Asp Asp Asp
