Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Antimicrobial Agents and Chemotherapy
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AAC
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • AAC Podcast
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Mechanisms of Resistance

Construction and Characterization of Mutants of the TEM-1 β-Lactamase Containing Amino Acid Substitutions Associated with both Extended-Spectrum Resistance and Resistance to β-Lactamase Inhibitors

Paul D. Stapleton, Kevin P. Shannon, Gary L. French
Paul D. Stapleton
Department of Microbiology, The Guy’s, King’s & St. Thomas’ School of Medicine, St. Thomas’ Campus, London SE1 7EH, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kevin P. Shannon
Department of Microbiology, The Guy’s, King’s & St. Thomas’ School of Medicine, St. Thomas’ Campus, London SE1 7EH, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Gary L. French
Department of Microbiology, The Guy’s, King’s & St. Thomas’ School of Medicine, St. Thomas’ Campus, London SE1 7EH, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/AAC.43.8.1881
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Tables

  • Table 1.

    Oligonucleotides used in site-directed mutagenesis experiments and in DNA sequencing

    Procedure and oligonucleotideSequence (5′-3′)aCodon change and nucleotide positionb
    Mutagenesis
     Ile86→ValGGCGTCAACACGGGATAATATT→GTT
     Val184→AlaATTGCGGCAGGCATCGTGGGTA→GCC
     Met69→LeuTAAAAGTGCTCAGCATTGGAAAACATG→CTG
     Asn276→AspTCTGTCTATCTCGTTCATCCAAT→GAT
     Arg244→CysATGATACCGCAAGACCCCGC→TGC
     Glu104→LysGTGAGTATTTAACCAAGTCGAG→AAA
     Gly238→SerCACGCTCACTGGCTCCAGATTTATGGT→AGT
     Arg164→SerGTTCCCAAGAATCAAGGCCGT→TCT
    Sequencing
     f-TEM2FGTATGAGTATTCAACATTTCCGTGTCG205-231
     f-TEM2RACCAATGCTTAATCAGTGAGGCA1064-1042
     f-TEMiACTGTCATGCCATCCGTAAGA556-536
     f-TEM2iCTGCGGCCAACTTACTTCTGACAA598-621
    • ↵a Altered bases are underlined.

    • ↵b Nucleotide positions are according to Sutcliffe (27).

  • Table 2.

    MICs of β-lactams and β-lactamase inhibitor combinations for E. coli MV1190 producing the TEM-1 and mutant TEM β-lactamases

    Strain or amino acid changes from TEM-1aDesignationMIC (μg/ml)b
    AMXAMX + CLAcTICTIC + CLAcPIPPIP + TZBdCLDCTXCAZCAZ + CLAcFEPAZMTEM
    TEM-1eTEM-1>1,024256>1,02425612832640.060.50.250.120.254
    M69LTEM-33>1,024>1,024>1,0241,02412864160.060.50.25≤0.060.254
    M69L, N276DTEM-35>1,024>1,0241,02451212832160.060.250.25≤0.060.124
    R244CTEM-311,02451264648420.060.250.12≤0.060.124
    G238STEM-19>1,024161,0241632≤13210.50.250.120.54
    G238S, M69L>1,024325121632≤1320.250.250.250.120.258
    G238S, M69L, N276D>1,0241285123232≤1320.120.250.250.250.124
    G238S, R244C1,02412864168240.060.250.25≤0.060.124
    G238S, E104KTEM-15>1,024161,0243232≤132880.250.2548
    G238S, E104K, M69L>1,024321,0246432≤132440.250.2514
    G238S, E104K, M69L, N276DTEM-50>1,0241281,02412832≤132440.50.524
    G238S, E104K, R244C1,02464256648≤140.060.250.250.2514
    R164STEM-12>1,024321,02432642320.1280.25118
    R164S, M69L>1,0242565126432≤180.1280.250.514
    R164S, M69L, N276D>1,0241,02451212832280.06820.50.54
    R164S, R244C1,0242561684220.060.250.25≤0.060.124
    R164S, E104KTEM-26>1,02416>1,0243264≤181640.51168
    R164S, E104K, M69L>1,024641,0246464280.56421164
    R164S, E104K, M69L, N276D>1,02425651212832280.12648144
    R164S, E104K, R244C512641283232820.06410.2518
    E. coli MV1190 (recipient strain)8422≤1≤120.060.120.12≤0.060.124
    • ↵a M69L refers to an amino acid substitution of leucine for methionine at position 69 in the TEM-1 β-lactamase protein sequence. The single amino acid codes for the other substitutions are as follows: N, asparagine; D, aspartate; G, glycine; R, arginine; C, cysteine; S, serine; E, glutamate; and K, lysine.

    • ↵b AMX, amoxicillin; CLA, clavulanate; TIC, ticarcillin; PIP, piperacillin; TZB, tazobactam; CLD, cephaloridine; CTX, cefotaxime; CAZ, ceftazidime; FEP, cefepime; AZM, aztreonam; TEM, temocillin.

    • ↵c Fixed concentration of clavulanate (2 μg/ml).

    • ↵d Fixed concentration of tazobactam (4 μg/ml).

    • ↵e TEM with amino acid modifications engineered to be identical to natural TEM-1.

  • Table 3.

    β-Lactamase activities and clavulanate and tazobactam IC50s for TEM-1 β-lactamase and TEM mutant enzymes

    Amino acid change from TEM-1aDesignationβ-Lactamase activitybIC50 (μM)
    ClavulanateTazobactam
    TEM-1TEM-15,3300.080.03
    M69LTEM-3358620.5
    M69L, N276DTEM-351,190120.6
    R244CTEM-31514101.7
    G238STEM-192,9500.0010.002
    G238S, M69L8530.030.02
    G238S, M69L, N276D2,3600.380.04
    G238S, R244C4851.50.3
    G238S, E104KTEM-15290.0020.004
    G238S, E104K, M69L3190.070.01
    G238S, E104K, M69L, N276DTEM-509520.30.02
    G238S, E104K, R244C6961.11.2
    R164STEM-12250.020.02
    R164S, M69L490.250.2
    R164S, M69L, N276D1,4401.80.3
    R164S, R244C9374.55
    R164S, E104KTEM-26523<0.010.06
    R164S, E104K, M69L2110.080.3
    R164S, E104K, M69L, N276D4580.350.2
    R164S, E104K, R244C543.52
    • ↵a See footnote a to Table 2for a key to the amino acid substitutions.

    • ↵b Activities are expressed as nanomoles of nitrocefin hydrolyzed per minute per milligram of protein.

PreviousNext
Back to top
Download PDF
Citation Tools
Construction and Characterization of Mutants of the TEM-1 β-Lactamase Containing Amino Acid Substitutions Associated with both Extended-Spectrum Resistance and Resistance to β-Lactamase Inhibitors
Paul D. Stapleton, Kevin P. Shannon, Gary L. French
Antimicrobial Agents and Chemotherapy Aug 1999, 43 (8) 1881-1887; DOI: 10.1128/AAC.43.8.1881

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Antimicrobial Agents and Chemotherapy article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Construction and Characterization of Mutants of the TEM-1 β-Lactamase Containing Amino Acid Substitutions Associated with both Extended-Spectrum Resistance and Resistance to β-Lactamase Inhibitors
(Your Name) has forwarded a page to you from Antimicrobial Agents and Chemotherapy
(Your Name) thought you would be interested in this article in Antimicrobial Agents and Chemotherapy.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Construction and Characterization of Mutants of the TEM-1 β-Lactamase Containing Amino Acid Substitutions Associated with both Extended-Spectrum Resistance and Resistance to β-Lactamase Inhibitors
Paul D. Stapleton, Kevin P. Shannon, Gary L. French
Antimicrobial Agents and Chemotherapy Aug 1999, 43 (8) 1881-1887; DOI: 10.1128/AAC.43.8.1881
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENT
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Amino Acid Substitution
Cephalosporin Resistance
Enzyme Inhibitors
penicillin resistance
beta-lactamase inhibitors
beta-lactamases

Related Articles

Cited By...

About

  • About AAC
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • AAC Podcast
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AACJournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0066-4804; Online ISSN: 1098-6596